ID: 1113269322

View in Genome Browser
Species Human (GRCh38)
Location 13:108655578-108655600
Sequence CCATCTTCCAGACCCCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5361
Summary {0: 67, 1: 862, 2: 1366, 3: 1582, 4: 1484}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113269319_1113269322 4 Left 1113269319 13:108655551-108655573 CCTAGTGGAGCTTTGGGAAGAGA 0: 1
1: 5
2: 218
3: 2167
4: 2606
Right 1113269322 13:108655578-108655600 CCATCTTCCAGACCCCAGAATGG 0: 67
1: 862
2: 1366
3: 1582
4: 1484
1113269314_1113269322 21 Left 1113269314 13:108655534-108655556 CCTCCACTGGGGCACTGCCTAGT 0: 15
1: 42
2: 72
3: 90
4: 211
Right 1113269322 13:108655578-108655600 CCATCTTCCAGACCCCAGAATGG 0: 67
1: 862
2: 1366
3: 1582
4: 1484
1113269316_1113269322 18 Left 1113269316 13:108655537-108655559 CCACTGGGGCACTGCCTAGTGGA 0: 668
1: 1163
2: 1065
3: 900
4: 652
Right 1113269322 13:108655578-108655600 CCATCTTCCAGACCCCAGAATGG 0: 67
1: 862
2: 1366
3: 1582
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113269322 Original CRISPR CCATCTTCCAGACCCCAGAA TGG Intronic