ID: 1113271210

View in Genome Browser
Species Human (GRCh38)
Location 13:108676725-108676747
Sequence CACGCCTCTCCTCTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 5, 2: 25, 3: 123, 4: 475}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113271210_1113271213 -9 Left 1113271210 13:108676725-108676747 CCAGAAGCCAGAGGAGAGGCGTG 0: 1
1: 5
2: 25
3: 123
4: 475
Right 1113271213 13:108676739-108676761 AGAGGCGTGGTTTGTTACTCTGG 0: 1
1: 0
2: 0
3: 8
4: 288
1113271210_1113271215 2 Left 1113271210 13:108676725-108676747 CCAGAAGCCAGAGGAGAGGCGTG 0: 1
1: 5
2: 25
3: 123
4: 475
Right 1113271215 13:108676750-108676772 TTGTTACTCTGGTAGTCCCAGGG 0: 1
1: 0
2: 1
3: 4
4: 103
1113271210_1113271214 1 Left 1113271210 13:108676725-108676747 CCAGAAGCCAGAGGAGAGGCGTG 0: 1
1: 5
2: 25
3: 123
4: 475
Right 1113271214 13:108676749-108676771 TTTGTTACTCTGGTAGTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 150
1113271210_1113271218 21 Left 1113271210 13:108676725-108676747 CCAGAAGCCAGAGGAGAGGCGTG 0: 1
1: 5
2: 25
3: 123
4: 475
Right 1113271218 13:108676769-108676791 AGGGTCAGCAGTTCCCAGAATGG 0: 1
1: 0
2: 1
3: 18
4: 192
1113271210_1113271219 22 Left 1113271210 13:108676725-108676747 CCAGAAGCCAGAGGAGAGGCGTG 0: 1
1: 5
2: 25
3: 123
4: 475
Right 1113271219 13:108676770-108676792 GGGTCAGCAGTTCCCAGAATGGG 0: 1
1: 0
2: 2
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113271210 Original CRISPR CACGCCTCTCCTCTGGCTTC TGG (reversed) Intronic
900089871 1:915454-915476 CCCACCTGCCCTCTGGCTTCGGG - Intergenic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
900681307 1:3918241-3918263 CCCTCCTTTCCTCTGGCTTATGG + Intergenic
900727848 1:4230054-4230076 CAGGCCTGTCCCCTGGTTTCTGG + Intergenic
900758516 1:4454522-4454544 CAGCCCTCTGCTCTGCCTTCGGG + Intergenic
901552066 1:10002922-10002944 CAAGCCCCGCTTCTGGCTTCTGG - Intronic
902097801 1:13960835-13960857 CTCCCCTCTCCTGGGGCTTCAGG + Intergenic
902328220 1:15716712-15716734 AAGACCTCTCCTCTGGCTACTGG + Exonic
902747745 1:18484501-18484523 CTCCCATCTCCCCTGGCTTCTGG - Exonic
904869693 1:33608734-33608756 CGGGCCCCTCCCCTGGCTTCTGG - Intronic
905119523 1:35671097-35671119 CATGCCTCTCTTGTGGCTTCTGG - Intergenic
905367520 1:37461791-37461813 CATGCCTCTCCCACGGCTTCTGG - Intergenic
905773199 1:40651377-40651399 CGTGCCCCTCCCCTGGCTTCTGG - Intronic
906115795 1:43356274-43356296 CATGCCTCTCTCCTGGCTTCTGG - Intergenic
906199402 1:43949346-43949368 CACGCCTCTGTTCTGGGCTCTGG + Intronic
906656728 1:47553716-47553738 CATGCCTCTCCCCTAGCTTCTGG - Intergenic
907732810 1:57084328-57084350 CATGCCTGTCCCCTAGCTTCTGG - Intronic
907965347 1:59323467-59323489 CATGCTTATCCTGTGGCTTCTGG - Intronic
908010629 1:59773580-59773602 CCAGCCTCTGCTCTGGCCTCTGG + Intergenic
908452458 1:64269497-64269519 CAGTCCTCACCACTGGCTTCAGG + Intergenic
910914043 1:92270125-92270147 CATGCCTCTCTCCTGGCTTCTGG - Intronic
912379528 1:109239892-109239914 ACTTCCTCTCCTCTGGCTTCTGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912663780 1:111560871-111560893 CAGGCCTTTCCTCTTGCTTCAGG + Intronic
912749181 1:112271429-112271451 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
912940625 1:114041667-114041689 CATGCCTTTCCTCTGTCCTCCGG - Intergenic
914456877 1:147844606-147844628 CATGCCTCACTTCTAGCTTCTGG - Intergenic
914924666 1:151873819-151873841 CACGCCTCCCTCCTGGCTTCTGG - Exonic
914969427 1:152293644-152293666 CCCCTCTCTCTTCTGGCTTCTGG - Intergenic
915922451 1:159986757-159986779 CAGGCCTCCCCTGTGGGTTCTGG - Intergenic
916590394 1:166184560-166184582 CACATCTCTCCCCTAGCTTCTGG + Intergenic
916743059 1:167663048-167663070 CACGCCGCTCCTCTGACTGCTGG + Intronic
917301434 1:173578692-173578714 CAGGCCTCTCTCCTAGCTTCTGG + Intronic
918195864 1:182220588-182220610 CCCCACTCTCTTCTGGCTTCTGG - Intergenic
918421465 1:184368191-184368213 CATGCCTCTCCCTTAGCTTCTGG - Intergenic
918770015 1:188545186-188545208 CATGCCTCTCTTCTAGCTTATGG + Intergenic
919156108 1:193767679-193767701 CATGCCCCTCTTCTAGCTTCTGG - Intergenic
919592919 1:199526927-199526949 CAAGCCTCTCTCCTAGCTTCTGG - Intergenic
921152081 1:212410863-212410885 CATGCCTCTCTCCTGGCTTCTGG + Intronic
921216874 1:212945199-212945221 CAGGCCTCTCTCCTGGATTCTGG + Intergenic
921260202 1:213379465-213379487 CAGGCCTCTCCCCAAGCTTCTGG - Intergenic
921265971 1:213420867-213420889 CACGCCTCTCTCCTGGCTTCTGG + Intergenic
921410619 1:214832608-214832630 CATGCTTCTCCCCTGGCTTCCGG + Intergenic
921670675 1:217920673-217920695 CAAGCCTCTCTCCTGGCTTCTGG - Intergenic
922078279 1:222269214-222269236 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
922163342 1:223094542-223094564 CTGGCCTCTCCCTTGGCTTCTGG + Intergenic
922444416 1:225684464-225684486 CAGGCCTCTCTTCTCACTTCTGG + Intergenic
922543052 1:226433580-226433602 CCCCCTTCTCCTCCGGCTTCTGG + Intergenic
922877631 1:228952520-228952542 CTCCCCTCTACTCTGGCCTCCGG + Intergenic
922916303 1:229260389-229260411 CAGGCCTGTCTCCTGGCTTCTGG - Intergenic
923066076 1:230518512-230518534 TACGCCTTTCCCCTTGCTTCTGG - Intergenic
923205439 1:231754335-231754357 CTGGCATCTGCTCTGGCTTCTGG + Intronic
1063574653 10:7250936-7250958 GGCGCCTCACCTGTGGCTTCTGG - Intronic
1064984989 10:21200700-21200722 CTCGCCTCTGCTCTGACTCCAGG - Intergenic
1065518082 10:26544617-26544639 GACACCCCTGCTCTGGCTTCTGG - Intronic
1066586973 10:36946163-36946185 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1067567423 10:47349176-47349198 CACGCCCCTGGTCTGGCTGCTGG - Exonic
1067839729 10:49666144-49666166 CAGGGCTCTCTTCTGGCCTCAGG + Intergenic
1068301199 10:55142947-55142969 CAGGCCTCTCCTCTGTCATGTGG - Intronic
1068508008 10:57927483-57927505 CAGGCCTCACCTCTGGCTCTGGG + Intergenic
1068739344 10:60451160-60451182 CATGCCTCTCCTCTAGCTTCCGG - Intronic
1069081861 10:64097093-64097115 CATGCCTCTCCTCAGGCCTTTGG - Intergenic
1069576948 10:69537515-69537537 CAGCCCTCTCTCCTGGCTTCTGG + Intergenic
1069635263 10:69921169-69921191 CAAGCCTCTCTCCCGGCTTCTGG + Intronic
1069793845 10:71040143-71040165 CACCTCTCTCCTCTGGCTAAGGG + Intergenic
1069907948 10:71743040-71743062 CACGCCTCTGCTGTCTCTTCTGG - Intronic
1070120954 10:73576311-73576333 CAAGTCTCTCCTCTTTCTTCTGG + Intronic
1070390021 10:75961890-75961912 CAGGTCTCTCTCCTGGCTTCTGG + Intronic
1070644723 10:78193902-78193924 CATGCCTCTCCCCTGACTTCTGG + Intergenic
1070697403 10:78573241-78573263 CAGGCCTCTCTCCTGGCTTCTGG - Intergenic
1070710077 10:78674789-78674811 CACCCCTCTCTTCTGTCTCCTGG - Intergenic
1070963441 10:80515316-80515338 CAGGCCTCTCTCCTGGCTGCAGG + Intronic
1071093356 10:81945935-81945957 CATGCCTCTCTCCTAGCTTCCGG - Intronic
1073292597 10:102420747-102420769 CCGGCCTCTCCTCTGCCCTCTGG - Exonic
1073450905 10:103608243-103608265 CCCGCCTCTCTCCCGGCTTCCGG - Intronic
1073479356 10:103776630-103776652 CATGCCTGTCCCCTAGCTTCAGG + Intronic
1073589152 10:104739664-104739686 AAGTCCTCTCCTCAGGCTTCTGG + Intronic
1074107114 10:110396641-110396663 TCTGCCTCTCCTCTAGCTTCTGG - Intergenic
1074431695 10:113400246-113400268 CATGCCTTTCTTCTGGCTGCTGG + Intergenic
1075052553 10:119193579-119193601 CATTCCTCTCCTCTGGGTACAGG - Intergenic
1075473563 10:122712662-122712684 CATGCCTCTCCCCTAGATTCTGG - Intergenic
1075519317 10:123134757-123134779 CACCCCTCTGCTCTGGCCGCCGG - Intergenic
1076052953 10:127349739-127349761 CCTGCCTCTCTCCTGGCTTCCGG + Intronic
1076480812 10:130784203-130784225 CATGCCTCTCCCCTAGTTTCTGG + Intergenic
1077328624 11:1974291-1974313 CACCCATCTCCTCTGGGTTGAGG + Intronic
1077525441 11:3061472-3061494 CTTGCCTCTCTCCTGGCTTCTGG - Intergenic
1077652725 11:3988249-3988271 CCACCCTCTGCTCTGGCTTCAGG - Intronic
1078025316 11:7689548-7689570 CAAGCCTCTCCTCTAGCTTCTGG + Exonic
1078428564 11:11270212-11270234 CAGGCCTCTCTTCTGGCTCCTGG - Intergenic
1078581205 11:12540982-12541004 CAGGGCTGTCCTCTGGCTGCTGG - Intergenic
1078731491 11:13979158-13979180 CATGCCTCTCGCCTGGCTTCTGG + Intronic
1078767586 11:14313731-14313753 CATGCCTCTGTCCTGGCTTCTGG - Intronic
1078933087 11:15928253-15928275 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1079034975 11:17013673-17013695 CACGCCTCCCCTCTAGGGTCTGG - Intronic
1080430350 11:32192318-32192340 CAGGCCTGTTCTCTGGATTCTGG - Intergenic
1080710570 11:34743317-34743339 CATGCCTCTCTCCTAGCTTCTGG - Intergenic
1080743495 11:35086925-35086947 CATGACTCTTCCCTGGCTTCTGG + Intergenic
1080855161 11:36105697-36105719 CGAGCCTCTCTCCTGGCTTCTGG - Intronic
1081535909 11:43996097-43996119 CAGGCCTTTCCCCTGGCTTCTGG - Intergenic
1081741422 11:45443640-45443662 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
1083651839 11:64208639-64208661 CAGCCCCCTCCTCTGGCTCCAGG - Intronic
1083858124 11:65404020-65404042 CAGGCCTCTGCTCTTCCTTCTGG + Intronic
1084073717 11:66755760-66755782 CATGCCTCTCTCCTAGCTTCTGG + Intronic
1085727359 11:78965710-78965732 CTGGTCTCTCCTCTGGCCTCTGG + Intronic
1085752126 11:79170666-79170688 CATGCCTCTCCATTAGCTTCTGG - Intronic
1085901293 11:80702951-80702973 CATGCCTCTCTCCTAGCTTCTGG - Intergenic
1086184267 11:83994848-83994870 CATGCCCCTCTTCTGGATTCTGG + Intronic
1087199261 11:95329311-95329333 CACGCCTCTCCCTTGGCTTGTGG + Intergenic
1087791194 11:102407731-102407753 CATGCCTCTCCTCTGGCTTCTGG - Intronic
1087847199 11:102986959-102986981 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1088724538 11:112622491-112622513 CAGGCCTCTCCCCTAGCTGCTGG - Intergenic
1202811603 11_KI270721v1_random:29470-29492 CACCCATCTCCTCTGGGTTGAGG + Intergenic
1091724588 12:2836855-2836877 CACGCCTCTCCCCTGGCTTCTGG - Intronic
1092590107 12:9945594-9945616 CACACCTCTCTTCCAGCTTCTGG + Intergenic
1093044062 12:14421460-14421482 CAGGCCTCTCTCCTAGCTTCTGG + Intronic
1093731636 12:22572007-22572029 CATGCCTCTACCCTAGCTTCTGG + Intergenic
1094033694 12:26043440-26043462 AACGGCTCTCCACTGCCTTCAGG - Intronic
1094415601 12:30211935-30211957 CACGGCTCTCCAGGGGCTTCTGG - Intergenic
1095384141 12:41630334-41630356 CATGCCTCTCTTCTAGCTTCTGG - Intergenic
1095476761 12:42593508-42593530 CGTGCCTCTCTCCTGGCTTCTGG - Intergenic
1096393894 12:51250778-51250800 CATGCCTCTCCTCTGGTATATGG + Intronic
1096759981 12:53833189-53833211 CGTGCCTCTCCCCTAGCTTCTGG - Intergenic
1098435817 12:70467492-70467514 CATGCCTCTACCCTAGCTTCTGG + Intergenic
1098576055 12:72043469-72043491 GATGCTTCTCCTCAGGCTTCTGG - Intronic
1098879979 12:75907223-75907245 CACACATCTCTTCTAGCTTCTGG + Intergenic
1099507445 12:83497162-83497184 CAGGCCTCTTTTCTAGCTTCTGG + Intergenic
1099863108 12:88244263-88244285 CATGCCTCTCTCCTTGCTTCTGG + Intergenic
1099904710 12:88758515-88758537 CATGCCTCTCTTGTAGCTTCTGG + Intergenic
1099909953 12:88817952-88817974 CATGTCTCTCATCTAGCTTCTGG + Intergenic
1100277597 12:93085553-93085575 CATGCCTCTCTCCTGGATTCTGG - Intergenic
1101039179 12:100736850-100736872 CATGCCTCTCTCCAGGCTTCTGG - Intronic
1101405670 12:104426471-104426493 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1101653418 12:106697633-106697655 CATGCCTGTCTTCTGGCTCCCGG + Intronic
1101860705 12:108480200-108480222 CTCCCCAGTCCTCTGGCTTCAGG + Intergenic
1102188644 12:110969108-110969130 CAGGCCGCTTCCCTGGCTTCTGG - Intergenic
1102233646 12:111280647-111280669 CACGCCTCTCTCCCAGCTTCTGG + Intronic
1102722806 12:115032698-115032720 CATGCCTCCCCTCTAGCTTCTGG - Intergenic
1102773653 12:115500146-115500168 CAGGCCTCTCTTCTAGCTTCTGG - Intergenic
1102875389 12:116444917-116444939 CAGGCCTCTCTTCTGGCTCCTGG - Intergenic
1103173937 12:118845279-118845301 CATGCCTCTCCCCTAGCTCCTGG - Intergenic
1103553920 12:121754511-121754533 CATGCCGCTCCACAGGCTTCGGG + Intronic
1103881194 12:124167153-124167175 GGCGCCCCTCCTCTGGTTTCTGG + Intronic
1104484223 12:129135750-129135772 CATGCATCTCTTCTGTCTTCGGG + Intronic
1105426490 13:20299259-20299281 TCCGCCTCTCTTTTGGCTTCAGG - Intergenic
1106189917 13:27442635-27442657 CACACCCCTCCTCTGGGTCCTGG + Intronic
1106528859 13:30568719-30568741 CATGCATCTCTCCTGGCTTCTGG - Intronic
1106695405 13:32167357-32167379 CAAGCCTCTCACATGGCTTCTGG + Intronic
1106863483 13:33936660-33936682 CAGGGCTCTCTCCTGGCTTCTGG - Intronic
1107042344 13:35962426-35962448 CAGGCCTCTCCCCTAGCTTCTGG - Intronic
1107651243 13:42547347-42547369 CACACCTCGCCTCTGGCTCTAGG + Intergenic
1108432401 13:50367442-50367464 CAGGTCTCTCTCCTGGCTTCTGG - Intronic
1108459717 13:50653091-50653113 CTCTCCCCTCCCCTGGCTTCTGG + Intronic
1108505368 13:51108057-51108079 CAGGCCTTTCTCCTGGCTTCTGG + Intergenic
1110292544 13:73824025-73824047 AACTCTCCTCCTCTGGCTTCAGG + Intronic
1110509181 13:76328832-76328854 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1110550368 13:76805183-76805205 CAGGCCTCCCTTCTAGCTTCTGG + Intergenic
1111885870 13:94019499-94019521 CATGCCTCTCTCCCGGCTTCTGG + Intronic
1111963082 13:94833165-94833187 CATGCCTCTCCCCTTGCTTTTGG - Intergenic
1112239323 13:97665313-97665335 CCTGCTTCTCCTCTAGCTTCTGG - Intergenic
1112306538 13:98279887-98279909 GACGCCCCCCCTCTGTCTTCCGG + Intronic
1112598678 13:100833398-100833420 CACGCCTCTCCCCTGGCTTCTGG - Intergenic
1112622222 13:101064669-101064691 CTAGCCTCTCCCCTGGCTGCTGG - Intronic
1112951276 13:104999604-104999626 TGTGCCTCTCCTCTAGCTTCTGG + Intergenic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113731436 13:112644433-112644455 CATCCCTGTCCTCTGGCTTCAGG + Intergenic
1113819679 13:113204189-113204211 CACTCCTCTTCTCAGGCTCCTGG - Intronic
1114692827 14:24600943-24600965 CAGGCCTGTCCTCTGGCTCCTGG + Intergenic
1115774926 14:36704774-36704796 CACCCCTGTCATATGGCTTCAGG + Intronic
1115815705 14:37162103-37162125 CACACCTCTCTCCTAGCTTCTGG - Intronic
1116052996 14:39827415-39827437 CAGGCCCCTCTTCTAGCTTCTGG + Intergenic
1116764565 14:49054195-49054217 CATGCCTATCCTTTGGATTCTGG - Intergenic
1117292173 14:54344641-54344663 CAAACCCCTCCACTGGCTTCCGG + Intergenic
1119113169 14:71994747-71994769 CAGGCCTCTCTTCTAGCTTCTGG - Intronic
1119208357 14:72811404-72811426 CAGGCCTCTCTGCTGGCTTCTGG - Intronic
1119381644 14:74233073-74233095 GAAGCCTCTCTTCTGGCTCCTGG - Intergenic
1119648443 14:76366072-76366094 CAAGCCTCTCCCCTACCTTCAGG + Intronic
1120095830 14:80386578-80386600 CATGCCTCTCTCCTAGCTTCTGG - Intronic
1120307447 14:82788768-82788790 CATGCCTCTCTCCTAGCTTCTGG - Intergenic
1120483548 14:85082688-85082710 CATGCCTCTCCTCTAGCTTCTGG + Intergenic
1120872152 14:89347406-89347428 CACCCCTCTCTCCTAGCTTCTGG - Intronic
1121811800 14:96897886-96897908 CATGCCTCTCTTCTGGCGTCTGG + Intronic
1121840866 14:97132675-97132697 CAGGCCTCACTCCTGGCTTCTGG + Intergenic
1121857812 14:97286365-97286387 CATGCCTCTCTCCTAGCTTCTGG - Intergenic
1121904844 14:97730290-97730312 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
1121974461 14:98390087-98390109 CCTGCCTCTCTCCTGGCTTCTGG + Intergenic
1122714716 14:103688687-103688709 CACGTCACTCCTCTTGCCTCAGG - Intergenic
1124136024 15:27037095-27037117 CAGGGCTCTGCCCTGGCTTCTGG - Intronic
1124204416 15:27704777-27704799 CCAGCCTCTTCTCGGGCTTCTGG - Intergenic
1124926405 15:34074524-34074546 CAGGCCTCTCTCCTAGCTTCTGG + Intergenic
1126385973 15:48093779-48093801 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1128230266 15:66029788-66029810 AACGCCCCTCCTGGGGCTTCCGG + Intronic
1128396390 15:67230521-67230543 CAGGCCTCTCTTCTAGCTTCTGG - Intronic
1128838573 15:70831274-70831296 CAGGGCTCTCCTTGGGCTTCTGG - Exonic
1129538454 15:76332918-76332940 CAGGCTTCTCCTCTTGCTCCAGG - Intergenic
1129861165 15:78862837-78862859 CATTCCTCTCCCCTAGCTTCTGG - Intronic
1131505879 15:93018684-93018706 CATGCCTCTCTTCTGCCTTCTGG + Intronic
1131547722 15:93329829-93329851 CATGCCTCTCTTCTAACTTCTGG + Intergenic
1131553292 15:93376101-93376123 CACGCCTCTCTCCTGGGTTTTGG - Intergenic
1131916285 15:97269906-97269928 CCCCACTCTCTTCTGGCTTCTGG + Intergenic
1132128379 15:99251210-99251232 CGCGGCTCTACTCTTGCTTCCGG - Intronic
1132975314 16:2708178-2708200 GAGGCCTGTCCACTGGCTTCTGG + Exonic
1133026469 16:2990927-2990949 GCGGCCTCGCCTCTGGCTTCTGG - Intergenic
1133882873 16:9799363-9799385 CAGGCCTCTCTCCTGACTTCTGG - Intronic
1134334872 16:13289179-13289201 CCCTCCTCTCCTCTTTCTTCTGG + Intergenic
1134840589 16:17398682-17398704 CATGCCCCTCTCCTGGCTTCTGG + Intronic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1137253625 16:46757925-46757947 CCGGCCTCTCCTCTGTCCTCAGG - Intronic
1137726516 16:50660354-50660376 CACGCCTCTCACCTGGCCTCTGG - Intergenic
1138121110 16:54401771-54401793 GATGCCTCTGCTCTGCCTTCAGG + Intergenic
1140622028 16:76746494-76746516 CACGCCTGGCCCCTGACTTCTGG + Intergenic
1140703665 16:77606067-77606089 CATGCCTCTCTCCTGGCTACTGG - Intergenic
1141713363 16:85713146-85713168 CAAGCCCCTCCCCTGGCTTCTGG + Intronic
1143347929 17:6263551-6263573 CATGCCTCTTCCCTAGCTTCTGG - Intergenic
1143392199 17:6566030-6566052 CACTCTTCTCCCCTGCCTTCTGG - Intergenic
1144132911 17:12265488-12265510 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1144295782 17:13873670-13873692 CTGGTCTCTCTTCTGGCTTCTGG - Intergenic
1144673107 17:17143973-17143995 CCCTCCGCTCCTCTGGCTTTGGG + Intronic
1145178935 17:20727934-20727956 CATGCCTCTCCCCTGGCTTCTGG + Intergenic
1145785678 17:27592435-27592457 CCTTCCTCTCCTCTGCCTTCTGG + Intronic
1146428239 17:32764254-32764276 CACCCCGCTCCTCTAGCCTCTGG - Intronic
1146522912 17:33540149-33540171 CAGGCCTCTCTTCTAGCTTTTGG + Intronic
1146852786 17:36237784-36237806 CATGCCTCTCCCCTGGCTTCTGG - Intronic
1146868697 17:36361676-36361698 CATGCCTCTCCCCTGGCTTCTGG - Intronic
1146891500 17:36509266-36509288 AAATCCTCTCCTCTTGCTTCCGG + Intronic
1147071571 17:37962300-37962322 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1147083097 17:38041824-38041846 CATGCCTCTCCCCTGGCTTCTGG - Intronic
1147099040 17:38165797-38165819 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1147322719 17:39656047-39656069 GCCACCTCTCCTCTGGCTGCCGG - Intronic
1147672161 17:42182819-42182841 CATGCCTCTCCCCTATCTTCTGG + Intergenic
1148183794 17:45626736-45626758 CAAGCCTCTCTTCTAGCTTCTGG + Intergenic
1148264941 17:46218086-46218108 CAAGCCTCTCTTCTAGCTTCTGG - Intronic
1148688062 17:49511870-49511892 CTGGCCTGTCCTCTGGCTCCAGG + Exonic
1148889760 17:50799220-50799242 CTTGCCTCTTTTCTGGCTTCCGG + Intergenic
1149385990 17:56143843-56143865 CATGCCTCTCTCCTGGCTTCTGG - Intronic
1149540072 17:57462081-57462103 CAGGCCTCTCCCCTTGCCTCTGG + Intronic
1149789725 17:59466479-59466501 CATGCCTCTCCCCTCGCTTCTGG - Intergenic
1149838591 17:59937517-59937539 CATGCCTCTCCCCTGGCTTCTGG + Intronic
1150080576 17:62234840-62234862 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
1150846725 17:68666104-68666126 CCTGCCTCTCCCCTCGCTTCTGG - Intergenic
1150898179 17:69238190-69238212 CATGCCTCTTTTCTAGCTTCTGG - Intronic
1151152449 17:72099525-72099547 CCTGCCTCTCTCCTGGCTTCTGG + Intergenic
1151306448 17:73265678-73265700 CACATCTCTCTCCTGGCTTCTGG - Intergenic
1151572001 17:74931086-74931108 CTGGCGTCTCCACTGGCTTCTGG - Exonic
1151884293 17:76914523-76914545 CCAGCCTCTCCCCTGTCTTCTGG + Intronic
1152466541 17:80469825-80469847 CACCCCTCTCCTTTGGCCTCCGG - Exonic
1152876643 17:82790210-82790232 CCCGCCTCTCCTGTGGCTGTCGG + Intronic
1154139105 18:11807649-11807671 TAGGCCTCTCCTCTGAATTCTGG - Intronic
1155157580 18:23170397-23170419 CACACCTGCCCTCTGGCTTCTGG + Intronic
1155350204 18:24898805-24898827 CATGCTTCTCCTCTTGCTTTTGG + Intergenic
1155454646 18:25998157-25998179 CACTCTTCTCCACTGGCTTCTGG - Intergenic
1155664390 18:28290670-28290692 CATGCCTTTCTTCTAGCTTCTGG + Intergenic
1156488202 18:37479984-37480006 CAGGCCTCTCTCCTCGCTTCTGG - Intronic
1157174885 18:45442397-45442419 CATGTCTCTCCTCTTGCTTCTGG + Intronic
1158334668 18:56402864-56402886 CAGGCCTTTCTCCTGGCTTCTGG - Intergenic
1158467686 18:57705648-57705670 CCTGCCTCTCCCCTGGCTTCTGG - Intronic
1158557503 18:58487351-58487373 CATGCCTCTCCTCTGGCTTCCGG - Intronic
1158629018 18:59096001-59096023 CTTGCCTCTCCCCTGGCTTCTGG - Intergenic
1158827129 18:61235274-61235296 CACACCTCTTCCCTCGCTTCTGG + Intergenic
1158841659 18:61394529-61394551 CAGGCCTCTCCTTTGGCTTCTGG - Intronic
1158859208 18:61575658-61575680 GATGCCTCTCTTTTGGCTTCTGG - Intergenic
1158926117 18:62262921-62262943 CTGGGCTCTCCCCTGGCTTCTGG + Intronic
1159758980 18:72401403-72401425 CATGCCTCTCTCCTCGCTTCTGG + Intergenic
1160387914 18:78508123-78508145 CACACCAGTCCTCTGCCTTCAGG - Intergenic
1161225390 19:3142344-3142366 CACGCAGCTCTTCAGGCTTCGGG + Intronic
1162393293 19:10402646-10402668 CCAGCCTCTCCTTTGGCCTCCGG - Intronic
1162868007 19:13563532-13563554 CAGGTCTCTCTCCTGGCTTCAGG + Intronic
1163630470 19:18415687-18415709 AACGCTTTTTCTCTGGCTTCTGG - Intergenic
1164789959 19:30968397-30968419 CATGCCTCTCGCCTGGCCTCTGG - Intergenic
1164952515 19:32349253-32349275 CTCCCCTGTCCTCTGCCTTCTGG - Intronic
1165637006 19:37349034-37349056 CATGCCTCTCCTCTAGCTTCTGG + Intronic
1166107856 19:40606211-40606233 CACCCCTCTCCTCTCGCCACAGG + Exonic
1166678003 19:44751039-44751061 CACGTCCCTCCTCTGGGCTCTGG - Intronic
1167533349 19:50032776-50032798 CAGGCCTCTCCCCTGTGTTCTGG + Intronic
1167896435 19:52585780-52585802 CACCCATCTGCTCTGGCCTCAGG - Exonic
1167998667 19:53426947-53426969 CTGGCCTCTCCTCTTCCTTCCGG + Intronic
1168008792 19:53513058-53513080 CTGGCCTCTCCTCTTCCTTCTGG + Intergenic
1168095649 19:54113378-54113400 CAGGCCTCTCCCCTGGCTTCTGG - Intronic
1168497834 19:56869158-56869180 CAGGCCTCTCCCCTAGCTGCTGG + Intergenic
925368295 2:3325843-3325865 CACCCTTATCCTGTGGCTTCAGG + Intronic
926355021 2:12033836-12033858 CCTGCCTCTCTCCTGGCTTCTGG - Intergenic
927726246 2:25425646-25425668 CACTCCTGTCATCTGGCTTTGGG + Intronic
927943594 2:27121207-27121229 CATGCCTCTCCCCTGGCTTCTGG - Intergenic
928386446 2:30872475-30872497 GAGCCCTCACCTCTGGCTTCAGG - Intergenic
928425768 2:31176577-31176599 CAAGTCTTACCTCTGGCTTCTGG + Exonic
928458483 2:31447562-31447584 AAAGCTTTTCCTCTGGCTTCTGG + Intergenic
928809547 2:35205956-35205978 CATGCCTCTCCTCTTTCTTAAGG + Intergenic
930198719 2:48532699-48532721 CCAGCCTCTCCTCGGGCTGCTGG - Intronic
930737614 2:54795417-54795439 CAGGCCCCTCCTCTGGCGTATGG + Intronic
930776913 2:55182000-55182022 CATGCCTCTCTCCTAGCTTCTGG - Intronic
930936834 2:56963451-56963473 CATGCCTCTCTCCTAGCTTCCGG + Intergenic
930999463 2:57762867-57762889 CACGCGTCTCTCCTAGCTTCTGG + Intergenic
931259799 2:60607422-60607444 CATGCCTCTCCCCTGACTTCTGG + Intergenic
931289664 2:60861558-60861580 CATGACAGTCCTCTGGCTTCTGG + Intergenic
931669021 2:64630326-64630348 CATGCCTCTCTCCTGCCTTCTGG + Intergenic
932016931 2:68038096-68038118 CAGGCCTCTCACCTAGCTTCTGG + Intergenic
932260999 2:70327340-70327362 CCCGCCTCTCTCCTGGCTGCAGG - Intergenic
932385777 2:71331675-71331697 CCCGGCTCTTCTCGGGCTTCGGG + Intronic
932412222 2:71554303-71554325 CACCTCTCGCCTCTAGCTTCTGG - Intronic
933650729 2:84847892-84847914 CAGGCCTCTCTCCTAGCTTCTGG + Intronic
933683312 2:85122634-85122656 CATGCCTCTCTTGTGGCTTCCGG + Intergenic
933823081 2:86132498-86132520 CATACCTCACCTCTGGTTTCAGG + Intronic
934995069 2:98950203-98950225 CAGGCCTGTCCTTTGGCGTCTGG - Intergenic
935359528 2:102235730-102235752 CACGCCTGTCCAGTGTCTTCAGG + Intronic
935600666 2:104918633-104918655 CAGGCCTCTCTCCTGGCTTCTGG - Intergenic
936464546 2:112735421-112735443 CATGCCTCTCCTCTGTCTTCTGG + Intronic
936671290 2:114659921-114659943 CATGCCTCTTTGCTGGCTTCAGG - Intronic
936973711 2:118198736-118198758 CACGCCTCCCTCCTAGCTTCTGG + Intergenic
937035567 2:118778771-118778793 CATGCCACTCCTGTAGCTTCTGG - Intergenic
937280409 2:120713691-120713713 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
937340783 2:121089145-121089167 CACGGCTCTGCCCGGGCTTCAGG - Intergenic
937345001 2:121119963-121119985 CATGCCACTCTTCTGGCTTCTGG - Intergenic
937936011 2:127245951-127245973 CCAGCCTCTCCACTGGCTTTTGG - Intergenic
938113204 2:128583764-128583786 CACACCTCTCTCCTGGTTTCTGG + Intergenic
938635986 2:133226726-133226748 CATGCCTCTCTCCTGGCTTCTGG - Intronic
939038782 2:137163561-137163583 CATGCCTCTCTCCTAGCTTCTGG - Intronic
939962648 2:148579040-148579062 CGTGCCTCTCCCCTGGTTTCTGG - Intergenic
940013563 2:149080188-149080210 CAGGCCTCTCTCCTGGCTTCTGG + Intronic
940071399 2:149692263-149692285 CATGCCTCTTGCCTGGCTTCTGG - Intergenic
941767316 2:169312530-169312552 CCCCCCTCTCTTCTGGCTTGTGG + Intronic
942548308 2:177088431-177088453 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
945742923 2:213685403-213685425 CAGGCCTCTTTCCTGGCTTCTGG - Intronic
945892774 2:215447770-215447792 CATGCCTCTCCTCCAGCTTCTGG - Intergenic
946048397 2:216840385-216840407 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
946496681 2:220202520-220202542 CTGGCATCTCCTCTGGCCTCAGG + Intergenic
946701287 2:222416805-222416827 CATGCCTCTCTCCTAGCTTCTGG - Intergenic
947389268 2:229622823-229622845 CAAGCCTCTCTCCTGGCTTCTGG - Intronic
947932200 2:233973372-233973394 CTAGCCTCTCCTCTAGCTTTTGG + Intronic
948002844 2:234582334-234582356 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
948180655 2:235977348-235977370 CCAGCCCCTCTTCTGGCTTCAGG - Intronic
948188555 2:236041017-236041039 CAAGCCTCACCCCTGGCTGCAGG + Intronic
948309892 2:236977173-236977195 CACAACTCTCCTCTGACTGCAGG + Intergenic
948385087 2:237576051-237576073 CAGGCCCCTCCCCTGGCCTCCGG + Intronic
948390003 2:237605141-237605163 CTGGCCTCTTCTCGGGCTTCTGG - Intergenic
948890483 2:240904903-240904925 CAAGCATGACCTCTGGCTTCAGG - Intergenic
948943600 2:241208347-241208369 CAGGCCTCTCTCCTGGTTTCTGG + Intronic
1168798235 20:626563-626585 CACCCCTCTCCCCTGACATCTGG - Intergenic
1169292182 20:4362155-4362177 CATGTTTCTCCCCTGGCTTCTGG - Intergenic
1169512022 20:6274773-6274795 TGGGCTTCTCCTCTGGCTTCTGG + Intergenic
1170649195 20:18224490-18224512 CAGGCCTCTCTCCCGGCTTCTGG + Intergenic
1170971592 20:21122054-21122076 CATGCCTCTCTCCTGGCTGCTGG - Intergenic
1172652358 20:36512857-36512879 CATCCCTCTCCTCTGGCTCATGG - Intronic
1173038848 20:39440961-39440983 CAGGCCTCTCCTCTGACATATGG - Intergenic
1173076965 20:39828443-39828465 CGTGCCTCTCCCCTAGCTTCTGG - Intergenic
1173191977 20:40883653-40883675 TGTGCCTCTCCCCTGGCTTCTGG + Intergenic
1173368829 20:42416273-42416295 CATGCCTTTCTTCTAGCTTCTGG - Intronic
1173388915 20:42614106-42614128 CATGCCTCTCTCCTAGCTTCTGG + Intronic
1173422328 20:42913330-42913352 CATGTCTCTCCCCTGGCTTTGGG + Intronic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1173747579 20:45449620-45449642 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1173758990 20:45543271-45543293 CATTGCTCTCCCCTGGCTTCTGG - Intronic
1173956191 20:47034828-47034850 CATGCCTCTCTCCTGGCTTCTGG + Intronic
1174055927 20:47798476-47798498 CTTGCCTCTCCTCTGAGTTCCGG + Intergenic
1174282456 20:49449081-49449103 CTGGCCTCACCTCTGGCTCCAGG + Intronic
1174696710 20:52567111-52567133 AAGGGCTTTCCTCTGGCTTCTGG - Intergenic
1175084568 20:56447644-56447666 AATGCATCTCCTCTGGCTGCTGG + Intronic
1175299521 20:57933077-57933099 GGCGCCACTCCTCTGGCTTAAGG + Intergenic
1175310293 20:58007033-58007055 CACCCCTGTGCACTGGCTTCAGG + Intergenic
1175393745 20:58644313-58644335 AAACCCACTCCTCTGGCTTCTGG - Intergenic
1175607658 20:60324022-60324044 TTGGCCTCTCTTCTGGCTTCTGG + Intergenic
1175890496 20:62313802-62313824 CACCCCTCGCCTCTGCCCTCAGG - Exonic
1175973360 20:62698408-62698430 GGCGCCTCTCCTCAGGCTGCGGG - Intergenic
1176201773 20:63864167-63864189 CGCGCCTCTCCTCTGAAGTCAGG + Intergenic
1176229218 20:64023137-64023159 CAGGCCACTCCTCAGGCTACAGG - Intronic
1176259369 20:64171574-64171596 GACCCCTATCCTCTGGCATCTGG + Intronic
1178777854 21:35569253-35569275 CAGGCCTCTCCCCCAGCTTCTGG - Intronic
1178940493 21:36901312-36901334 CAGACCTCTCCCCTGGATTCTGG - Intronic
1179085756 21:38216172-38216194 CTGGCCTCTTTTCTGGCTTCTGG + Intronic
1180167456 21:46037394-46037416 CAGGCTTCTCCTCTGTCCTCGGG + Intergenic
1180195186 21:46189826-46189848 CACTGCTCTCCCCTGGCTACTGG - Exonic
1180955520 22:19739620-19739642 CTCGCCTGTCCCCTGGCTACCGG - Intergenic
1181100376 22:20534924-20534946 CTCGCCTCCCTTCAGGCTTCAGG + Intronic
1181393310 22:22599680-22599702 CATGCCTCTCCCCTGGCTTTTGG + Intergenic
1182011230 22:27002321-27002343 CACGTCTCTCTCCTAGCTTCTGG - Intergenic
1182153374 22:28047212-28047234 CATGTCTCTCCCCTGACTTCAGG - Intronic
1182245162 22:28951491-28951513 CACACCTCTCCCCTAGCTTCTGG - Intronic
1182275880 22:29188337-29188359 CAGGCCCCTCTCCTGGCTTCGGG + Intergenic
1184343056 22:43896588-43896610 CAAGCCTTTCCTCTGCCTCCTGG + Intergenic
1184416787 22:44356612-44356634 CAGGCCTCTCTCCTGGTTTCTGG - Intergenic
1184688477 22:46106921-46106943 CTGACCTCTCCTCTGGCCTCAGG - Intronic
1185325801 22:50225330-50225352 CACGCCTCTCCTGTGTCTTCTGG - Intronic
949905727 3:8856809-8856831 CAAGCCTCTCCTCTAACTCCTGG - Intronic
949935598 3:9113299-9113321 CAGGCCTCTCTCCTGGCTCCTGG + Intronic
950798989 3:15534091-15534113 CTCTCCTCAGCTCTGGCTTCAGG + Intergenic
951063572 3:18238137-18238159 CCTGCCTCTCTTCTAGCTTCTGG + Intronic
951092244 3:18587787-18587809 CCTGCCTCTCTTCTAGCTTCTGG + Intergenic
951435487 3:22657697-22657719 CATGCCTCTCTTCTATCTTCTGG - Intergenic
952478106 3:33732057-33732079 CATGCCTCTCTCTTGGCTTCTGG - Intergenic
952766200 3:36956401-36956423 CACACCTCTCTCCTGGCTTCTGG - Intergenic
953193336 3:40710183-40710205 CAAGCCTTTCCTCTGGGTTAGGG - Intergenic
953382992 3:42488209-42488231 CATGCCTCTCATCCAGCTTCTGG - Intergenic
955081906 3:55665615-55665637 CATGCCTCTCCTTTAGTTTCTGG - Intronic
955817820 3:62864509-62864531 CATGCCTCTCCCCTAGTTTCTGG + Intronic
957555961 3:81764734-81764756 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
957565197 3:81876531-81876553 TATGCCTCTCTCCTGGCTTCTGG - Intergenic
957622179 3:82607794-82607816 CAAGCATCTCCTTTGCCTTCAGG + Intergenic
958748134 3:98162537-98162559 CAGGCCTGGCTTCTGGCTTCTGG + Intergenic
959712754 3:109401312-109401334 CATGCCTCTCTTCTAGCTTCTGG + Intergenic
959830298 3:110853631-110853653 TATGCCTCTCTTCTAGCTTCTGG - Intergenic
961565902 3:127763209-127763231 CACACCTGTCCCCTGGCTGCTGG - Intronic
961626642 3:128268752-128268774 CATGCCTCTCTCCTGGCTTCTGG - Intronic
961926812 3:130490019-130490041 CACGTCTCTTCTCTGTCCTCAGG - Intergenic
962486266 3:135845568-135845590 CATGCCTCTCTTCTAGCTTCTGG - Intergenic
963009484 3:140755822-140755844 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
963045562 3:141100472-141100494 CATGCTTCTCCCCTAGCTTCCGG - Intronic
963268201 3:143259981-143260003 CATGCCTCTCTTCTAGCTTCTGG + Intergenic
963970342 3:151422400-151422422 CATGCCTCTCCTCCAGCTTCTGG + Intronic
964210463 3:154221020-154221042 CAGGCCTCTCCCCCAGCTTCTGG - Intronic
964485491 3:157181383-157181405 CATGCCTCTCTGCTAGCTTCGGG + Intergenic
964738700 3:159943243-159943265 CCAGCATCTTCTCTGGCTTCTGG - Intergenic
965437854 3:168674702-168674724 CAGGCCTCTTCCCTAGCTTCTGG + Intergenic
967192072 3:186993046-186993068 CACTCCCCTCCTCTGTCTCCTGG + Intronic
967704388 3:192632902-192632924 CATGCCTCTCTCCTAGCTTCCGG + Intronic
967821216 3:193841170-193841192 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
967988113 3:195111113-195111135 CAGGCCGCTCCCCTAGCTTCTGG + Intronic
969432918 4:7166485-7166507 CAGGCCTCTCCCCTGGCTTCAGG - Intergenic
969839637 4:9871444-9871466 CACGCCTCTCTCCTGGCTTCTGG + Intronic
970171243 4:13292507-13292529 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
970207833 4:13673337-13673359 CATGCCTCTCTCCTGGCTTCTGG - Intergenic
970232273 4:13922988-13923010 CGTGCCTCCCTTCTGGCTTCTGG + Intergenic
970478156 4:16445656-16445678 CAGGCCTCTCTCATGGCTTCTGG + Intergenic
970784699 4:19782312-19782334 CATGCCTCCCTTCTAGCTTCTGG + Intergenic
971058872 4:22944348-22944370 CATGCCTCTCTACTAGCTTCTGG + Intergenic
972134198 4:35871811-35871833 CAAGCCTCTCCCCCAGCTTCTGG - Intergenic
972286648 4:37655528-37655550 CATGCCTCTCTCCTGGGTTCTGG - Intronic
972769725 4:42186055-42186077 CAGGCCTCTCTCCTGGCTCCTGG - Intergenic
972834797 4:42856908-42856930 CATGCCTCTCCCCTAGTTTCTGG - Intergenic
972849552 4:43032129-43032151 CACACCTTTCCTCTGACCTCGGG - Intergenic
973604577 4:52573709-52573731 CATGCCACTCTCCTGGCTTCTGG + Intergenic
973716882 4:53685631-53685653 CATGACTCTCCTCTAGCCTCTGG + Intronic
973923869 4:55717246-55717268 CAGGCCTCTCCCCTGGCTTCTGG + Intergenic
973943260 4:55932002-55932024 CATGCCTTTCTCCTGGCTTCTGG + Intergenic
973951221 4:56016180-56016202 CATGCCTCTCTCCTAGCTTCTGG - Intronic
974237536 4:59201016-59201038 AACCCCTCTTCTCTTGCTTCTGG + Intergenic
975210620 4:71695910-71695932 CATGCCTCTCCCCTAGCTTCTGG + Intergenic
975319333 4:72992924-72992946 CAAGCCTCTCTTCTAGCTTCTGG + Intergenic
975351623 4:73353471-73353493 CAGGCCTCTCTCCTGGCTTCTGG - Intergenic
976334436 4:83869282-83869304 CATGCCTCTCTCCTGGCTTCTGG - Intergenic
976678801 4:87732632-87732654 CGCGCCTCTCTCCTAGCTTCTGG - Intergenic
977450783 4:97194056-97194078 CATGCCTCTCTCCTGGCTTCTGG + Intronic
977648882 4:99446377-99446399 CATGCCTTTCCCCTAGCTTCTGG - Intergenic
977716303 4:100187764-100187786 GTCGCTTCTCCTCTGGTTTCAGG - Exonic
977910234 4:102525954-102525976 CATGCCTCTCCCCTAGCTTCTGG + Intronic
978368692 4:108008792-108008814 CATGCCTGTCCTCTTGCTTCTGG + Intronic
978589804 4:110312887-110312909 CATGCCTCTCTTCTAGCTTCTGG + Intergenic
978690066 4:111497295-111497317 CATGCCTCTCTTCTAGCTTCTGG + Intergenic
978991932 4:115094799-115094821 CAGATCTCTCTTCTGGCTTCTGG - Intronic
979351668 4:119650702-119650724 CAAGCCTCTGCTCTGGCTTCAGG - Intergenic
979514179 4:121588075-121588097 CTCACCACTCTTCTGGCTTCTGG + Intergenic
979885487 4:126022900-126022922 CATGCCTCTCCTCTAGTTCCTGG + Intergenic
983106622 4:163694272-163694294 TACACATCTCCTTTGGCTTCTGG + Intronic
984589498 4:181601256-181601278 CATACCTCTCTTCTAGCTTCTGG + Intergenic
984707935 4:182861481-182861503 CGTGCCTCTCCCCAGGCTTCTGG - Intergenic
985241162 4:187932259-187932281 CAAGCCTCTCTCCTGGCCTCTGG - Intergenic
985481460 5:113547-113569 CAGTTCTTTCCTCTGGCTTCTGG + Intergenic
985505977 5:280553-280575 CACCCCTCTGCCCTGGCTTATGG - Intronic
986290851 5:6397659-6397681 CACGGGTCTCCACTGGCCTCGGG - Intergenic
986712311 5:10496936-10496958 CAGGCCTCTCCTCTAACTTCTGG - Intergenic
986964600 5:13255184-13255206 CTCGCCTTACCTGTGGCTTCAGG + Intergenic
987092937 5:14523478-14523500 CTCTCCTGTCCTCTGGCTTTTGG - Intronic
987120329 5:14761145-14761167 TAGGCCTCTCCCCTAGCTTCTGG - Intronic
987606712 5:20144960-20144982 GACGCCTCTCCCCTGGTTTCTGG - Intronic
988692029 5:33581954-33581976 CACGCCTTTCCCCCAGCTTCTGG - Intronic
989262630 5:39435483-39435505 CACGCTTCTCTCCTAGCTTCTGG - Intronic
989263996 5:39451181-39451203 CATGCCTCTCTTCTAACTTCCGG - Intronic
989313944 5:40054786-40054808 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
991246518 5:64514049-64514071 CATGCTTCTCCTCTAGCTTCTGG + Intronic
992131623 5:73698734-73698756 TTTGCCTCTCCTGTGGCTTCAGG - Intronic
992636706 5:78731544-78731566 CAAGCCTCTTCCCTGGCTTGTGG + Intronic
993445603 5:88008625-88008647 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
993871205 5:93256503-93256525 CATGCCTCTTTCCTGGCTTCTGG - Intergenic
995364819 5:111346696-111346718 CATGCCTCTCTCCTAGCTTCTGG + Intronic
996293007 5:121876392-121876414 CAGGCTTTTCCTTTGGCTTCAGG - Intergenic
996590622 5:125143154-125143176 CATGCCTCTCTCCTGGCTTCTGG - Intergenic
996915448 5:128706989-128707011 CATGCCTCTCTCCTAGCTTCAGG + Intronic
998534756 5:142919328-142919350 CATGCCTCTCCTCTAGCTTCTGG - Intronic
998868265 5:146527623-146527645 CATGCCTCTCGTCTAGCTTCTGG + Intergenic
999319355 5:150603810-150603832 CCCACCTCTCCTCTGGCCCCAGG + Intronic
999585706 5:153087580-153087602 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
999954429 5:156685189-156685211 GACGCATCTCCCCTGGATTCTGG - Intronic
1001873613 5:175180130-175180152 CAAGAGTCTCCTGTGGCTTCAGG + Intergenic
1002086273 5:176777564-176777586 CACGCCTCTGCTCTTGATTCTGG - Intergenic
1002449304 5:179309960-179309982 CACCCCTGCCCTCTGGCTTCTGG + Intronic
1002458325 5:179358823-179358845 CATGTGTCTCTTCTGGCTTCTGG - Intergenic
1002477796 5:179478633-179478655 CATGCCTCTCTCCTGGCTTCTGG - Intergenic
1002787469 6:414516-414538 CAGGCCTCTCCTCTGGCATTGGG - Intergenic
1002885489 6:1290099-1290121 CACGCCCCTCCTTTGGCCTTGGG + Intergenic
1002959248 6:1898236-1898258 GAGGCCTTTCCCCTGGCTTCAGG + Intronic
1003000751 6:2330393-2330415 CATGCCTTTCTTCTAGCTTCTGG + Intergenic
1003797758 6:9624148-9624170 CATGCCTCTCTCCTAGCTTCTGG - Intronic
1004589093 6:17031463-17031485 CAGGCTTCGCCCCTGGCTTCTGG - Intergenic
1005016890 6:21383089-21383111 CAGGCTTCTCCCCTGGCTTCCGG + Intergenic
1005154490 6:22788943-22788965 CAGGCCTCTCCCCTAGCTTCTGG + Intergenic
1005726229 6:28651374-28651396 CAGGCCTCTCCTCTAGTTTCTGG - Intergenic
1007113903 6:39329806-39329828 CCTGTCTCTCCTCTGGTTTCTGG - Intergenic
1007115975 6:39343583-39343605 CAGGCCAGTCCTGTGGCTTCAGG + Intronic
1007132110 6:39484930-39484952 CTGCCCTCTCCTCTGGATTCTGG + Intronic
1007400444 6:41599731-41599753 CAGGCCCCGCCTCTGGCCTCAGG - Exonic
1008030463 6:46688392-46688414 CACGGCTCTCCTGTGCCTGCCGG - Exonic
1008201003 6:48590797-48590819 CATGCCTCTCTTCTAGTTTCTGG + Intergenic
1008972350 6:57384274-57384296 CACATCTGTCTTCTGGCTTCTGG + Intronic
1009161260 6:60285798-60285820 CACATCTGTCTTCTGGCTTCTGG + Intergenic
1010453953 6:76033301-76033323 CATCCCTTGCCTCTGGCTTCTGG - Intronic
1010722596 6:79300826-79300848 CAAGCCTCTCCTTTGTTTTCCGG + Intergenic
1011113570 6:83865455-83865477 CATGCCTCTCACCTAGCTTCTGG + Intronic
1012147538 6:95704221-95704243 CACGCCCCTCCTCTGACATGCGG + Intergenic
1012894815 6:104936578-104936600 CAAGCCTCTCTCCTGGCTTCTGG - Intergenic
1013706619 6:112842680-112842702 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1013764629 6:113560552-113560574 CATGCCACTTCCCTGGCTTCTGG + Intergenic
1014609302 6:123521507-123521529 CATGCCTCTCTCCTGGCCTCTGG - Intronic
1014724265 6:124956153-124956175 CAGGCCTGTCCTCAGGCCTCTGG - Intergenic
1014974047 6:127856493-127856515 CTCGCTTGTCCTCTGGCTTCTGG - Intronic
1015300745 6:131650708-131650730 CATGCCTCTCTCCTAGCTTCTGG + Intronic
1015839343 6:137460201-137460223 CATGCCTCTCCTCTAGCTTTTGG + Intergenic
1016062836 6:139648092-139648114 CATGCCTCTCTCCTTGCTTCCGG - Intergenic
1016131544 6:140478780-140478802 TTTGCCTCTCCCCTGGCTTCTGG + Intergenic
1016303523 6:142657977-142657999 CTTGCCTCTCCCCTGGTTTCTGG + Intergenic
1017292883 6:152761841-152761863 CATGCCTCTCCTCTCGTTTCAGG + Intergenic
1017878515 6:158543569-158543591 CAGGCCTTTTCTCCGGCTTCTGG + Intronic
1018435344 6:163753946-163753968 CAGGCCTCTCCTCTGGCTTCTGG + Intergenic
1019191007 6:170250780-170250802 CGTGACTCTCCTCTGGGTTCCGG - Intergenic
1019570865 7:1711404-1711426 CCCTCCCCTCCTCTGGCCTCTGG - Intronic
1020886238 7:13822285-13822307 CATGTCTCTCCCCTGGCTTCTGG + Intergenic
1020958158 7:14769742-14769764 CACACCTCTCCTCTAGTTTCTGG + Intronic
1021197597 7:17690379-17690401 CTCTTCTCTCCTCTGGGTTCAGG + Intergenic
1021684974 7:23176262-23176284 CATGCCTCTCCCCTAGCTTCTGG + Exonic
1021887704 7:25156240-25156262 CGTGCCTCTCCCCTGGCTTCTGG - Intronic
1022976923 7:35567251-35567273 CTGGCCTCTATTCTGGCTTCAGG - Intergenic
1023088553 7:36596654-36596676 CATGCCTCTCTTCCAGCTTCTGG - Intronic
1024410202 7:49031693-49031715 TATGCCTCTCTCCTGGCTTCTGG - Intergenic
1024654589 7:51439902-51439924 CACACCTCTCTCCTAGCTTCTGG - Intergenic
1025949392 7:66131834-66131856 CTCGGCTCACCTCTGGCTCCCGG + Intronic
1026139841 7:67696405-67696427 AACACCTCTCCTCTTGTTTCGGG + Intergenic
1026187282 7:68091776-68091798 CATGCTTCTCTCCTGGCTTCTGG + Intergenic
1028323924 7:89498156-89498178 CGTGCCTCTCATCTAGCTTCTGG - Intergenic
1029518739 7:101046246-101046268 CCTGCCTCACCTCTGCCTTCCGG - Intronic
1029857259 7:103529911-103529933 ATCTCCTCTCATCTGGCTTCTGG + Intronic
1029969349 7:104773802-104773824 CAGGCCTCTCCCCTACCTTCTGG - Intronic
1030076559 7:105741905-105741927 CCTGCCTCTCTCCTGGCTTCTGG - Intronic
1030318057 7:108136630-108136652 CAGGCCTCTCTCCTAGCTTCTGG - Intergenic
1031357477 7:120804922-120804944 CATGCTTCTCCCCTAGCTTCTGG - Intronic
1032444513 7:131970395-131970417 CATGACTCTCCCCTTGCTTCTGG - Intergenic
1032461505 7:132114739-132114761 CAAACCTCTCCTCTGGCCACGGG - Intergenic
1032836062 7:135675222-135675244 CACCCCTGTTCTCTGGCTCCTGG + Exonic
1033123872 7:138690049-138690071 CATGCCTCTCCCCTAGCTGCTGG - Intronic
1033331135 7:140417775-140417797 CCCTCGCCTCCTCTGGCTTCTGG + Intronic
1033879898 7:145868705-145868727 CATGCCTGTCCTTTGGTTTCAGG + Intergenic
1034032526 7:147783998-147784020 CATGCCTCTCTCCTGGCTCCTGG + Intronic
1035420473 7:158725377-158725399 CATCCCTCTGCTCTGCCTTCAGG + Intergenic
1036162967 8:6406451-6406473 CTCGCCGCGCCTCTGGCTGCTGG - Intergenic
1036475884 8:9092915-9092937 CAGGCCTGTCTCCTGGCTTCTGG + Intronic
1036730956 8:11264405-11264427 CATGCCTCTTCCCTGGCTTCTGG - Intergenic
1036990372 8:13585668-13585690 CATGCCTCTCTTCTAGTTTCTGG + Intergenic
1037587627 8:20288795-20288817 CAACCCTCCCCTCTGGGTTCAGG + Intronic
1037732101 8:21534690-21534712 TATGCCTCTCCCCTAGCTTCTGG + Intergenic
1037835108 8:22211035-22211057 CCCGCCTCTCCTCTGGCACCTGG - Intronic
1037850650 8:22324890-22324912 CATGCCTCTCTCCTAGCTTCTGG - Intronic
1037972028 8:23178961-23178983 CATGCCTCTCTTCTGGTTTCTGG - Intergenic
1038158885 8:25017788-25017810 CATGCCTCTCCCCTAGCTTCTGG + Intergenic
1038741157 8:30218316-30218338 CATGCCTCTCTTCCGGCTTCTGG - Intergenic
1039485862 8:37909302-37909324 CACTCGTGTCCTCTGGCTTCTGG - Intergenic
1040418690 8:47219348-47219370 CACCCCTCTGCTCAGGCTGCTGG - Intergenic
1040596412 8:48841699-48841721 CATGCCTCTCCCCTGTATTCTGG - Intergenic
1041126298 8:54643720-54643742 CTCACCTCTTCTCTGGCTTTTGG + Intergenic
1041214431 8:55585753-55585775 CCCACCTCTCCCCTGGCTTCTGG + Intergenic
1041391825 8:57353721-57353743 CAGGCCTCTCTCCTGGCTTCTGG + Intergenic
1042156769 8:65852270-65852292 CATGCCTCTCTCCTTGCTTCTGG - Intergenic
1042350707 8:67774542-67774564 CATGACTCTCCTCTTGCCTCTGG - Intergenic
1042749047 8:72138257-72138279 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1042931160 8:74015393-74015415 CAGGCCTCTCTCCTAGCTTCTGG + Intronic
1043182472 8:77103495-77103517 CATGCCTCTCACCTGGCTTCTGG + Intergenic
1043365610 8:79530044-79530066 CAGGCCTCTCTCCTGGATTCTGG + Intergenic
1043515478 8:80991096-80991118 TAGGCCTCTCCTGGGGCTTCTGG - Intronic
1043547935 8:81336127-81336149 CATGCCTCTCTCCTGGCTTCTGG + Intergenic
1043565062 8:81538613-81538635 CATGCCTCTCTTCTGGCTTCTGG - Intergenic
1044361118 8:91285103-91285125 CATGCCTCTTCTCTAGCTTCTGG + Intronic
1044774128 8:95669943-95669965 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1045036866 8:98182634-98182656 CATGCCTCTCTGCTGGCTTCAGG + Intergenic
1045499344 8:102732938-102732960 CATGCCTCTCCCCTAGCTTCTGG - Intergenic
1046112457 8:109741818-109741840 CTCACCTCTCCTCTGGCCACTGG + Intergenic
1047033329 8:120907731-120907753 CACGCCTCCCTCCTGGCTTCTGG - Intergenic
1047345774 8:124026980-124027002 CAGGCCTCTCTTCTAGCTTCTGG + Intronic
1048929104 8:139296845-139296867 CACACCTCTCTCCTAGCTTCTGG - Intergenic
1048940746 8:139398520-139398542 CAATCCTCTCTTCTGGCTCCTGG - Intergenic
1048992753 8:139770920-139770942 CACGCCTCTCCTGATGCGTCTGG + Intronic
1049683397 8:143929799-143929821 GGCGCTGCTCCTCTGGCTTCAGG + Exonic
1050062971 9:1729762-1729784 CAGGTCTCTCCCCTGGCTTCTGG - Intergenic
1050692420 9:8242790-8242812 CATGCCTCTCCCCTTGCTTCTGG + Intergenic
1051337542 9:16079586-16079608 CAGGCCTCTCTCCCGGCTTCTGG - Intergenic
1051387827 9:16529007-16529029 CATGCCTCTCTCCTAGCTTCCGG + Intronic
1051796781 9:20880485-20880507 CTCCCATGTCCTCTGGCTTCTGG - Intronic
1052134946 9:24898041-24898063 CACGGCTCTCCTATGACTACCGG - Intergenic
1052556784 9:30028874-30028896 CATGCCTCGCTTTTGGCTTCTGG + Intergenic
1053071147 9:35102804-35102826 CAGGGCTCTCTACTGGCTTCTGG - Exonic
1053290453 9:36876202-36876224 CCCACCTCTCCTCTGGCCTCAGG + Intronic
1055968648 9:81889609-81889631 CATGCCTCTCTTCTAGCTTCTGG - Intergenic
1057520966 9:95760096-95760118 TACTCCTCTCCTCTGGGTACAGG + Intergenic
1058082768 9:100716943-100716965 CAGGCCTCTCCGCTAGCTTCTGG + Intergenic
1058680180 9:107434022-107434044 CATGCCTCTCCCCTTGCTCCTGG + Intergenic
1058782878 9:108356245-108356267 CATGCGTCTCTCCTGGCTTCTGG + Intergenic
1059119206 9:111627033-111627055 CACGCCTCTCCCCAGGCTCCTGG + Intergenic
1060115948 9:120940816-120940838 CGTGCCTCTCTCCTGGCTTCAGG + Intergenic
1060881348 9:127120407-127120429 CCCCCCTCTCCTCAGGCTCCTGG + Intronic
1061993933 9:134174694-134174716 CATGTCTCTCCTCTGCCTGCAGG + Intergenic
1062320389 9:135988001-135988023 CCCGCCCATCCTCTGGCCTCTGG + Intergenic
1062483605 9:136763568-136763590 CCCGCCCCTCCTCTGTCTTCGGG - Intronic
1062627529 9:137450019-137450041 CACCCCTCTCCACCAGCTTCTGG - Exonic
1186037994 X:5445546-5445568 CAGGCCTCTCCTGGGCCTTCAGG + Intergenic
1186403035 X:9277186-9277208 CGGGCCTCTCTTCTTGCTTCTGG + Intergenic
1186705762 X:12138283-12138305 CACGGCTCTCCTTCGGCTTGGGG + Intergenic
1186820636 X:13284649-13284671 AACCCCTCTCCTCTGCCTCCTGG + Intergenic
1188286775 X:28336043-28336065 CATGTCTCTCTTCTAGCTTCTGG - Intergenic
1189744037 X:44151467-44151489 CATGCCTCTCTCCTGGCTTCTGG + Intronic
1189862507 X:45288351-45288373 CATGCCTCTGCCCTAGCTTCTGG + Intergenic
1189876080 X:45437565-45437587 CACGCTTCACTCCTGGCTTCTGG - Intergenic
1190031651 X:46978724-46978746 CCAGCCTGTCCTCTGGCTTCTGG + Intronic
1190102098 X:47529650-47529672 CAGGCCTCTCCTCCAGCTGCTGG + Intergenic
1190335662 X:49260239-49260261 CAGGCCTCTCCCCCAGCTTCTGG - Intronic
1190407754 X:50104528-50104550 CACGCCTCTCCCCCAGCATCTGG - Intergenic
1190492619 X:50998046-50998068 CATGCCTCTCTCCTAGCTTCTGG - Intergenic
1192431249 X:71113451-71113473 CATGCCTCTCTTCTAGCTTCTGG + Intergenic
1193489454 X:82131750-82131772 CACCCCTGTCCTCTGGCTCTTGG - Intergenic
1196262757 X:113603962-113603984 CACACCCCTCCTCTTGCTACAGG - Intergenic
1198318371 X:135493405-135493427 CATGCCTGTCCTCAGGCTCCAGG - Intergenic
1198433999 X:136597471-136597493 CATGCCTCTCTCCTAGCTTCTGG + Intergenic
1198548520 X:137719733-137719755 CAGGCCTGTCCTCAGGCTCCTGG + Intergenic
1199694269 X:150332367-150332389 CATGTCTCTCCCCTAGCTTCTGG - Intergenic
1199764093 X:150928143-150928165 CAGGCCTCTCTCCTAGCTTCTGG + Intergenic
1199774463 X:150998648-150998670 CACCCCTCACCCCTGGCTTCTGG + Intergenic
1199778004 X:151032667-151032689 CAGGCCCCTCCCCTAGCTTCTGG + Intergenic