ID: 1113271797

View in Genome Browser
Species Human (GRCh38)
Location 13:108682694-108682716
Sequence GCATGGAAGGGTCAGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113271792_1113271797 -2 Left 1113271792 13:108682673-108682695 CCTGGGCAGACCATGAGTCGTGC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG 0: 1
1: 0
2: 2
3: 34
4: 279
1113271791_1113271797 8 Left 1113271791 13:108682663-108682685 CCTGGTCTGGCCTGGGCAGACCA 0: 1
1: 0
2: 2
3: 42
4: 330
Right 1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG 0: 1
1: 0
2: 2
3: 34
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113271797 Original CRISPR GCATGGAAGGGTCAGTGATG TGG Intronic
901919354 1:12525414-12525436 TCCAGGAAGGGTCAGTGATGGGG + Intergenic
902535673 1:17118306-17118328 GGTTGGAGGGGTCAGTGCTGGGG - Intronic
902733496 1:18384780-18384802 GGATGGAAGGGGCAGAGAAGGGG + Intergenic
903678806 1:25083402-25083424 GCAAGGATGGCCCAGTGATGGGG - Intergenic
904756117 1:32769859-32769881 GCCTGGAAGGGACAGGGAGGAGG - Exonic
904848228 1:33436962-33436984 GCAGGCCAGGGTCAGAGATGGGG + Intergenic
904946261 1:34200889-34200911 GGGCGGCAGGGTCAGTGATGCGG - Exonic
904947979 1:34213258-34213280 GCAGGGAAGGTTCTGTGATGGGG - Intronic
905170471 1:36106847-36106869 GGATGGAAGGGTCTGGGATGGGG - Intronic
905515184 1:38557622-38557644 GCAAGGCAGGGTCAGGGATGGGG - Intergenic
905576364 1:39047954-39047976 TCATGCAAGGATGAGTGATGCGG + Intergenic
905641136 1:39590842-39590864 GCACTGAAGGGCCAGTGAGGGGG + Intergenic
906720846 1:48003337-48003359 GCATGGAAGGGCCAGGGGAGTGG + Intergenic
906792812 1:48673747-48673769 GCAAGGAAGGGTCAGTCATGAGG + Intronic
907406124 1:54254522-54254544 GAAGCAAAGGGTCAGTGATGTGG - Intronic
909361490 1:74764864-74764886 GCATGGTATAGTCAGTGATGGGG + Exonic
909636820 1:77826390-77826412 GCATGACAAGGTCAGAGATGAGG - Intronic
911519275 1:98909120-98909142 GGAAGGAAGGGTCAGGAATGTGG + Intronic
912518994 1:110232666-110232688 GCATGGATGGGTCAGGGAATGGG - Exonic
912548325 1:110466927-110466949 GCAGGGAAGGGTCAGGGAGAGGG - Intergenic
913317317 1:117564022-117564044 GCATGCCAGGGTATGTGATGAGG + Intergenic
914424039 1:147558211-147558233 GCATGTAAGTGTCAGAGCTGCGG + Intronic
915321988 1:155061330-155061352 GCAGGGAAGGGTCAGTGCCCAGG - Intronic
915585735 1:156842923-156842945 GAAAGAAAGGGTCAGAGATGAGG - Intronic
915732574 1:158064690-158064712 GTATGGAAGGGGCAGTGATGGGG + Intronic
916457012 1:164981464-164981486 ACATGGCAGGCTTAGTGATGTGG + Intergenic
917113933 1:171582426-171582448 GCATCCAAGTATCAGTGATGGGG + Intronic
917443147 1:175084346-175084368 GCATGGAAGGGGTTGTGTTGGGG + Intronic
918088240 1:181263593-181263615 ACATGGAAAGTTAAGTGATGAGG + Intergenic
918380900 1:183954086-183954108 CCATGAGAGAGTCAGTGATGTGG + Intronic
919809243 1:201398797-201398819 TCTTGGAGGGGTCAGTGAAGAGG - Intronic
920162028 1:204005918-204005940 GCCTGGAATGAGCAGTGATGGGG + Intergenic
920352125 1:205344121-205344143 GCCTGGCAGCGTAAGTGATGCGG - Exonic
920910186 1:210209237-210209259 GTAAGGAAGGGTCTCTGATGTGG - Intergenic
921991953 1:221376453-221376475 GCCTGTAAGGGTCAGTAAGGAGG + Intergenic
922216948 1:223527423-223527445 ATATGGAGGGGGCAGTGATGGGG + Intergenic
922222232 1:223617489-223617511 GCATGGATGGGACTGTGATTTGG + Intronic
923218884 1:231875209-231875231 GGATGCTATGGTCAGTGATGGGG + Intronic
923385366 1:233460608-233460630 GCATGGAAGGCTAAAAGATGGGG + Intergenic
923595128 1:235355351-235355373 GCATGCCAGGATCAGTGCTGAGG - Intergenic
1063595167 10:7428390-7428412 GCATGGAAAAGTAAGTGATATGG + Intergenic
1065668466 10:28087794-28087816 GCACAGAAGGGACAGTGAGGTGG + Intronic
1066302152 10:34106732-34106754 TCATGGAAGAGTAAGTCATGAGG - Intergenic
1067213582 10:44281810-44281832 GGATGGAATGGTCAGTGAAGAGG + Intergenic
1068207364 10:53873219-53873241 GCATGGCAGGGGCAGAGATCTGG - Intronic
1068367940 10:56076688-56076710 TCATGGAAGATCCAGTGATGAGG - Intergenic
1068553804 10:58435483-58435505 GCATGCCAGGCTCACTGATGTGG - Intergenic
1068685208 10:59863551-59863573 GCAGGGAAGGGTGGGTGGTGGGG + Intronic
1069175489 10:65284495-65284517 GCAAGGAAGAGTCTTTGATGTGG - Intergenic
1069792483 10:71031838-71031860 GCATGGCAGGCTGAGTGATGGGG + Intergenic
1071487630 10:86113284-86113306 GCATGGTGGGGTCAGAGAGGTGG - Intronic
1072458126 10:95594418-95594440 AGATGGAAGGGACAGTGGTGGGG - Intergenic
1073764997 10:106672530-106672552 GCATGGTGGGGGCAGGGATGAGG - Intronic
1074293236 10:112157471-112157493 GCCAGGAAGGGTCAGAGAAGAGG - Intronic
1074314261 10:112347354-112347376 GGATGGAGTGGTCAGAGATGTGG - Intergenic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1076757364 10:132579456-132579478 GCAGGGAAGGGGCAGAGAGGGGG + Intronic
1076786513 10:132752418-132752440 GCATGGAGGGGCGTGTGATGTGG + Intronic
1076861458 10:133140111-133140133 GCAGGGCAGGGGCAGTGAAGGGG - Intergenic
1077170392 11:1163510-1163532 GCAAGGCAGGCTCAGTGCTGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077491763 11:2864251-2864273 GCAGGGCAGGCTCAGTGATGTGG - Intergenic
1077572524 11:3352489-3352511 TACTGGAAGGGTCAGTGAAGGGG + Intronic
1077954014 11:6993525-6993547 TCATGGAAGGGTAAGTGAGAGGG - Intergenic
1078474394 11:11619163-11619185 GTAGGGAAGGGTCAGTGACTTGG - Intronic
1079474993 11:20820830-20820852 GCATGGCAGGGGCAGAGAAGGGG - Intronic
1080868398 11:36215086-36215108 GAATGGAATTGTGAGTGATGCGG + Intronic
1081983644 11:47285937-47285959 TCATGGAAGAGTCCGTTATGAGG - Intronic
1083196690 11:61092461-61092483 TCATGGAAAGTGCAGTGATGGGG + Intergenic
1083431274 11:62614668-62614690 GCTTGGAGGGGTCATTGATGCGG + Exonic
1083880066 11:65543972-65543994 GCTTGGAGGGGTCTGGGATGTGG - Intronic
1085075656 11:73589313-73589335 GCATGAAAAGCTCAGTGATATGG + Intronic
1087208218 11:95418804-95418826 GAATGGAAGGGGCAGTTAGGAGG + Intergenic
1088433855 11:109789059-109789081 GCAGGGAAGTCTGAGTGATGGGG - Intergenic
1089094524 11:115907975-115907997 CCATGGAAGAGTCAGTGCTAAGG + Intergenic
1089491529 11:118887063-118887085 AGTTGGAAGGGTCAGAGATGAGG + Intronic
1091794361 12:3289102-3289124 GCATGGGAGGAGCACTGATGTGG + Intergenic
1091882492 12:3990872-3990894 GCACTGAAGGCTCAGTGGTGTGG - Intergenic
1092998504 12:13973593-13973615 GCAGGGGAGGCACAGTGATGAGG - Intronic
1096793262 12:54058306-54058328 GCTTGGGAGGGTCAGAGATGGGG - Intergenic
1097835326 12:64267218-64267240 GAATGGTAGGTTGAGTGATGGGG + Exonic
1102021071 12:109683356-109683378 GGATGGAAGGGTGAGTGAAAGGG + Intergenic
1102208617 12:111107642-111107664 GAATGGAAAGGTCTGGGATGGGG + Intronic
1103782778 12:123410314-123410336 GCATGGAGGGGACAGGGATCTGG - Intergenic
1104412123 12:128567730-128567752 GCTTGGAAAGGTCAGTGGGGTGG - Intronic
1104904207 12:132204864-132204886 GCATGGCAGGCTCAGGGCTGAGG - Intronic
1104975941 12:132552011-132552033 GCCTGGAAGGGGCAGGGCTGGGG + Intronic
1107403776 13:40094347-40094369 ACATGGATGGATCACTGATGTGG + Intergenic
1109561742 13:64058488-64058510 GCATGGAAGAGACTTTGATGTGG + Intergenic
1110659181 13:78038638-78038660 GCCAGGAAGAGTAAGTGATGGGG - Intergenic
1112157695 13:96835295-96835317 TCATTGATGGCTCAGTGATGTGG - Exonic
1113054165 13:106250316-106250338 GCATTGAAGGGGCAGTACTGGGG - Intergenic
1113116943 13:106884669-106884691 TGATGGGAGGGTCAGTGAAGAGG - Intergenic
1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG + Intronic
1113616109 13:111681659-111681681 GCAGGGCAGCGTCAGGGATGAGG - Intergenic
1113621577 13:111766552-111766574 GCAGGGCAGCGTCAGGGATGAGG - Intergenic
1114083700 14:19221397-19221419 GCCTGGAAGGGTCTGGGAAGTGG + Intergenic
1114495334 14:23127951-23127973 GAATGCAGTGGTCAGTGATGGGG - Intronic
1114591803 14:23872520-23872542 TAAAGGAAGGGTCACTGATGCGG - Intergenic
1114699299 14:24661354-24661376 AAATGGAAGGGTTAGTGATTTGG - Intergenic
1115501422 14:34053322-34053344 GCAAGGAAGGGTAAGTGTTATGG + Intronic
1117197147 14:53352156-53352178 GCATGGAAGAGATAATGATGGGG - Intergenic
1117641837 14:57808254-57808276 GCATGGAAAGATCAGTAATTTGG + Intronic
1119207691 14:72806944-72806966 GAATGGAGGGGGCAGAGATGAGG - Intronic
1119348145 14:73943159-73943181 ACACGGAGGAGTCAGTGATGTGG - Intronic
1120231294 14:81844205-81844227 TCATGGAAAGGGCAGTGATTTGG - Intergenic
1121014400 14:90539512-90539534 GCCTGGCAGGGTCAGTGCTGAGG + Exonic
1121729493 14:96176389-96176411 GCAAGGAAGGATGGGTGATGGGG + Intergenic
1122363847 14:101183015-101183037 GAATGGAAGAGTCAGGGGTGGGG + Intergenic
1123704981 15:22944782-22944804 GCATGGCAGGGGCAGGGGTGTGG + Intronic
1125463164 15:39925291-39925313 GCATGTGAGGGTGTGTGATGGGG - Intergenic
1125662329 15:41403937-41403959 GAATAGAAGAGTCAGTGATGGGG - Intergenic
1127921451 15:63497662-63497684 GGATGGAAGGCTGAGAGATGAGG - Intergenic
1128632690 15:69282004-69282026 GAATGGAAGGGCAAGGGATGCGG - Intergenic
1130012213 15:80160604-80160626 GCTGGGAAAGGTCAGTGATGAGG - Intronic
1130060193 15:80564101-80564123 GCATGCAAGGGTATGAGATGAGG + Intronic
1131122043 15:89828784-89828806 GCCTGGGAGAGTCAGAGATGAGG - Intergenic
1131608327 15:93933625-93933647 GCATGGAAATGGCACTGATGGGG - Intergenic
1134810981 16:17166831-17166853 GTATGGAATGGGCAGAGATGTGG - Intronic
1136020860 16:27438897-27438919 GCATGGAAGGGCCTGGGAGGTGG + Intronic
1137716020 16:50598762-50598784 GCATGGTGGGGCCAGTGGTGTGG + Intronic
1138412624 16:56851985-56852007 GTGTGGTAGGGTCAGTGGTGTGG - Intergenic
1139181306 16:64751727-64751749 GCGTGGAAGAGTCACTGCTGTGG - Intergenic
1140854016 16:78961570-78961592 GCATGGATGGGTGAGTAAGGGGG + Intronic
1142977807 17:3656054-3656076 GCATGGCAGGGCCAGGGGTGAGG - Intronic
1143258806 17:5583593-5583615 GCAGGGAGGGCTCAGTGGTGGGG + Intronic
1143444365 17:6998664-6998686 GGATGTCATGGTCAGTGATGGGG - Intronic
1144423249 17:15116887-15116909 GCATGAAAGGCTTGGTGATGAGG + Intergenic
1144572429 17:16407966-16407988 GGCTGGAGGGGTCAGTGGTGGGG + Intergenic
1144587170 17:16493926-16493948 GCAAGGAAGAGTCTTTGATGTGG - Intergenic
1144726344 17:17504450-17504472 GCCTGGAAGGCTCAGGAATGCGG + Intergenic
1145176741 17:20707301-20707323 GCAGAGAAGGGACAGTGACGAGG + Intergenic
1145904587 17:28509225-28509247 GGGTGGAAGGGTCAGGGATGAGG - Intronic
1145917080 17:28580835-28580857 GGATGGAAGAGTCATTCATGTGG - Intronic
1146355156 17:32127402-32127424 GCAGAGAAGGGACAGTGACGAGG - Intergenic
1146796565 17:35785247-35785269 GCAGGGCAGGACCAGTGATGAGG + Intronic
1147252409 17:39160857-39160879 GCCTGGATGGGGCAGAGATGGGG + Intronic
1148823308 17:50373464-50373486 CCAGCGAAGGGTCAGAGATGAGG + Intronic
1150137436 17:62703640-62703662 GCAGGGGAGGGTTGGTGATGGGG + Intronic
1151141369 17:71995660-71995682 GTGGGGAAGGGTCAGTGATGTGG - Intergenic
1151392264 17:73795427-73795449 AAATGGAAGGGGCAGTGAGGAGG + Intergenic
1151488898 17:74420334-74420356 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
1151786145 17:76275961-76275983 GGAGGGAAGGGTCAGTGCTGAGG + Intronic
1153591348 18:6676581-6676603 CCCTGGAAGAGTCAGGGATGTGG - Intergenic
1154170258 18:12046333-12046355 CCATGGCAGGGGCAGTGCTGCGG - Intergenic
1155600513 18:27540689-27540711 GCATGGAAGGGTCAGGGAGCTGG - Intergenic
1156140062 18:34098117-34098139 GCATGTAAGGGGCAGTGGGGAGG - Intronic
1157590123 18:48831481-48831503 TCATGGGAGGGGCAGTGAGGAGG - Intronic
1158250490 18:55482144-55482166 ACATGGAAGTGTCAGAGGTGAGG - Intronic
1158430610 18:57382923-57382945 GAATGGAAGGGTAGGTGAGGAGG + Intergenic
1158569513 18:58585627-58585649 GTATGGAAAGTTCACTGATGTGG - Intronic
1160142333 18:76336671-76336693 GCATGAAAGGGTCTCTGACGTGG - Intergenic
1160892950 19:1388684-1388706 GCATGGATGGGGCAGGGAGGGGG + Intronic
1161503652 19:4632202-4632224 GCCTGGAAGGCCCAGTGATCTGG - Intergenic
1161949595 19:7460414-7460436 GCTTGGGAGGGTGAGTGCTGTGG - Intronic
1162321580 19:9973879-9973901 GCCAGGAAGGCTCAGAGATGGGG - Intronic
1164086556 19:21907894-21907916 GGATGTAAGGTCCAGTGATGTGG - Intergenic
1165019177 19:32909008-32909030 GCATGGAAGGAACAATGATGCGG + Intronic
1165255764 19:34576593-34576615 GCAGGGAAGGGGCAGTGGGGTGG + Intergenic
1165838033 19:38771142-38771164 GCAGGGGAGGGTCGGTGGTGAGG + Intronic
1165841532 19:38791555-38791577 GCAGGGGAGGGTCGGTGGTGAGG - Intronic
1166062634 19:40336227-40336249 GCAGGGAAAGGTCAGTGGTGAGG + Intronic
1166302360 19:41918619-41918641 GTATGTGAGGGTTAGTGATGTGG - Intronic
1167560381 19:50223386-50223408 AGATGGAAGGGGCAGTGCTGTGG - Intronic
1167587404 19:50382811-50382833 GCCGGGAAGGGTCAGTGGTCGGG - Exonic
1167643544 19:50694603-50694625 GCCTGGAAGGGCCTGTGAGGGGG + Intronic
1167780815 19:51597800-51597822 GAGGGGAGGGGTCAGTGATGGGG - Intergenic
1167956331 19:53067490-53067512 GGATGGAAGGATCATTGATTGGG - Exonic
1168346422 19:55652263-55652285 GCAAGGAAGGGGCAGAGAGGAGG - Intronic
925145248 2:1578392-1578414 AAAAGGGAGGGTCAGTGATGAGG - Intergenic
925898248 2:8489450-8489472 GGATGGCAGGGCCAGTCATGGGG + Intergenic
926174765 2:10580802-10580824 GCATGGAAGGGGCGGTGTGGGGG + Intronic
926241845 2:11094585-11094607 TCATGAAAGGTTCAGAGATGAGG + Intergenic
927296565 2:21461588-21461610 GGGTGGAAGAGTGAGTGATGCGG - Intergenic
927759539 2:25740255-25740277 GCATCGAAGAGTGTGTGATGTGG + Intronic
928084484 2:28337303-28337325 GCAGGGAAGGGGCAGTGGAGGGG - Intronic
928126435 2:28619860-28619882 TCATTGAAGGGTCAGGGCTGGGG + Intronic
928319710 2:30273427-30273449 GCAAGGGAGGGTACGTGATGAGG - Intronic
929999147 2:46849327-46849349 GCCTGGAAGAGCCAGTGATTTGG + Intronic
930182969 2:48383257-48383279 GTGTGGAAGGGACAGTGATGCGG + Intergenic
931750844 2:65328596-65328618 GAAGGAAAGGGACAGTGATGTGG - Intronic
931836907 2:66108738-66108760 CCGTGGAAGGGTCAGTGATATGG + Intergenic
934160577 2:89245462-89245484 GCATGGAACGGTGAGTTCTGGGG - Intergenic
934206700 2:89936976-89936998 GCATGGAACGGTGAGTTCTGGGG + Intergenic
937288930 2:120770308-120770330 GCATGGAAGGGTAGGAGATGGGG - Intronic
937731826 2:125241816-125241838 GCATTTAATGGTCAGAGATGAGG + Intergenic
938210862 2:129464783-129464805 GGATGGAAGTTTCATTGATGTGG + Intergenic
941704464 2:168643152-168643174 GGATGGAAGGGGCTGTGATTAGG - Intronic
942705738 2:178769841-178769863 ACATGGAAGGGACATTGAAGTGG + Exonic
944915310 2:204354436-204354458 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
946428362 2:219611872-219611894 GAAGGGAAGGGGCACTGATGGGG + Intronic
947543999 2:230998036-230998058 GAATGGAAAGGTCAGTGCTGTGG - Intronic
1169109573 20:3023323-3023345 GAAGGGAAGGGTCTGTGCTGAGG + Intronic
1170631861 20:18072916-18072938 GCATTGAAAGGCCAGTGATTTGG + Intergenic
1172216500 20:33239401-33239423 GGATGGAAGAGTAAGTGATTAGG - Intronic
1172839287 20:37892513-37892535 GCAGAGAAGGGTAAGTGTTGAGG + Intergenic
1173120927 20:40288195-40288217 TCATGGAAGGGTCTGTCCTGGGG - Intergenic
1173242860 20:41313189-41313211 GTAAGGAAGGGTCAGGAATGAGG + Intronic
1175119506 20:56707429-56707451 GCATGGCAGGGAGAGGGATGGGG - Intergenic
1176244083 20:64089109-64089131 GCATGCCAGGGTCTGTGCTGGGG + Intronic
1176591971 21:8656204-8656226 GCATGGCTGGGTCAGTACTGGGG - Intergenic
1176741937 21:10612829-10612851 ACATGGATGGGGCAGTGTTGAGG + Intergenic
1178344102 21:31810393-31810415 GCAGGGAGGGGCCAGTGGTGGGG + Intergenic
1179785603 21:43728127-43728149 GCAGGGGTGGGTCAGGGATGAGG + Intronic
1180274820 22:10633333-10633355 GCATGGCCGGGTCAGTACTGGGG - Intergenic
1180294275 22:10871870-10871892 GCCTGGAAGGGTCTGGGAAGTGG - Intergenic
1180497081 22:15901284-15901306 GCCTGGAAGGGTCTGGGAAGTGG - Intergenic
1181033003 22:20157268-20157290 GCAGGGAAGGGGCAGTGCTAGGG + Intergenic
1181044180 22:20206859-20206881 GCCTGGAAGGGACAGTGAGGGGG - Intergenic
1181373700 22:22439569-22439591 GCTTGGAAGAGGCAGTGTTGGGG + Intergenic
1181504312 22:23341317-23341339 GAATGGGAGGGTCAGGAATGAGG - Intergenic
1181655421 22:24293928-24293950 GAATGGGAGGGTCAGGGATGAGG - Intronic
1181709300 22:24671551-24671573 GAATGGGAGGGTCAGGGATGAGG - Intergenic
1182348946 22:29687730-29687752 GCAGGGAAGGTTCAGGGCTGGGG - Intronic
1182942410 22:34289324-34289346 GCATGGAGGGGTCACAGATTAGG + Intergenic
1183299655 22:37052562-37052584 GCATCGGAGGGTCACGGATGGGG - Intronic
1183409173 22:37644984-37645006 GCAGGGCAGGGTCAGGGGTGTGG - Intronic
1184658028 22:45951988-45952010 CCATGGAAGGGGCAGTGAGCTGG + Intronic
1184905679 22:47484399-47484421 GCAAGGAAGAGTCTTTGATGTGG + Intronic
1185242966 22:49756255-49756277 ACAAGGAAGGGGCAGTGAAGTGG - Intergenic
950899663 3:16486254-16486276 GGATGGAAGGGGCAATGCTGGGG - Intronic
951590612 3:24260667-24260689 GAATGGAAGAGTCAGTGACCTGG - Intronic
952163998 3:30725724-30725746 GCATGGAAGGGAGAGTGTGGTGG - Intergenic
952532728 3:34279068-34279090 GGAAGGAAGGGTCAGCAATGTGG - Intergenic
953005305 3:38972198-38972220 GCCTGGATGGGGGAGTGATGGGG + Intergenic
956768636 3:72505936-72505958 GCATGGGAGGGGCAGAGATGTGG + Intergenic
959939521 3:112066243-112066265 TCATGGAAGTGTCAGTTTTGAGG + Intronic
962477040 3:135764028-135764050 GCCTGGGTGGGACAGTGATGTGG - Intergenic
962640423 3:137379704-137379726 GCATAGAAGTGGCAGTAATGGGG + Intergenic
963072045 3:141312425-141312447 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
963122272 3:141786350-141786372 GCAAGCAAGGGTCATTGATGGGG - Intronic
963685302 3:148426080-148426102 GCTTTCAAGGGTCAGTTATGTGG - Intergenic
965557854 3:170036287-170036309 GCAAGGAAGAGTCTTTGATGTGG - Intergenic
966861815 3:184234725-184234747 ACAGCGAAGGGACAGTGATGGGG + Exonic
967025207 3:185558670-185558692 AAATGGCAGGGTCACTGATGTGG - Intergenic
968017119 3:195346964-195346986 GGATGGAAGGGTTAATAATGGGG + Intronic
969014686 4:4096057-4096079 GAGTGGCAGGGTCAGAGATGGGG - Intergenic
969139395 4:5055455-5055477 GCATTGAGGGGACAGTGACGGGG - Intronic
969501023 4:7553066-7553088 GCAGGAAAGAGTCAGTGATGTGG + Intronic
970345962 4:15152376-15152398 TCATGTAAGAGTCAGAGATGAGG + Intergenic
972056444 4:34808432-34808454 GCATGGAAATGTCTGAGATGAGG - Intergenic
974794589 4:66732058-66732080 GCAAGGAACGGTCTTTGATGTGG + Intergenic
979598451 4:122559679-122559701 GCATGGAAGGCTGAGAAATGTGG - Intergenic
979669734 4:123349497-123349519 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
984453829 4:179939475-179939497 GCATTAAAGGGTAAGTGAAGTGG + Intergenic
985256691 4:188077032-188077054 GCAAGGAAGAGTCTTTGATGTGG + Intergenic
985564749 5:609842-609864 GCATATCAGGGGCAGTGATGGGG + Intergenic
985630747 5:1012769-1012791 GCAGGGAAGGGGCAGGGAAGGGG - Intronic
985658833 5:1145528-1145550 TCCTGGAAAGGTCAGTGAAGGGG - Intergenic
986509258 5:8486130-8486152 GGAAGGAAGTGTCAATGATGTGG + Intergenic
993782471 5:92084803-92084825 GCATGGAAAGGTGATTGCTGGGG - Intergenic
997291053 5:132735941-132735963 ACATGGAAAGGCCAGTGGTGAGG - Intronic
998491275 5:142548988-142549010 GCCAGGAGGGGGCAGTGATGGGG - Intergenic
999319341 5:150603752-150603774 GCATGTCAGGGTCAGGGATCAGG - Intronic
1000044263 5:157508737-157508759 GCCTGGGAGAGACAGTGATGGGG - Intronic
1001126086 5:169020862-169020884 GCATCTACTGGTCAGTGATGGGG - Intronic
1001948950 5:175802674-175802696 GCTAGGAAGGGTCAGGGCTGAGG - Intronic
1004964083 6:20827630-20827652 GCATGGAAGACTAAGTTATGTGG + Intronic
1005419554 6:25634782-25634804 GGATGCAAGGGTCAGAGCTGTGG + Intergenic
1005981236 6:30838555-30838577 GCATGGCAGGGGCAGTGGAGAGG + Intergenic
1006369455 6:33634847-33634869 GCGTGGAGGGGTCAGGGATGAGG + Intronic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1011277061 6:85642331-85642353 GCACGGAAGGGTAAGGGGTGGGG - Intronic
1011804406 6:91054914-91054936 GCTGGGAAGGGACGGTGATGGGG - Intergenic
1014129429 6:117813675-117813697 ACATGGAAGAGGGAGTGATGAGG + Intergenic
1014130086 6:117821007-117821029 ACATAGAATGGTCAGAGATGGGG - Intergenic
1016088012 6:139939406-139939428 GCATGCTAGAGCCAGTGATGTGG + Intergenic
1016663727 6:146610914-146610936 GCATGGACAGGCCAGTGGTGGGG + Intronic
1017134932 6:151139868-151139890 GCATTGAAGGGTCAACAATGAGG + Intergenic
1017497243 6:154993696-154993718 GCATGGAAGAGTGAGTGGAGTGG + Intronic
1018470582 6:164093753-164093775 GCATTGAAAGATAAGTGATGAGG - Intergenic
1019650180 7:2152652-2152674 GCCTGGAGGGGTCAGGGCTGGGG - Intronic
1021200396 7:17722704-17722726 GAGTGGGAGGGTGAGTGATGGGG + Intergenic
1021364606 7:19761098-19761120 GCAAGGAAGGCTCAGGGATCTGG - Intronic
1021690157 7:23223293-23223315 GCAGGGCCGGGTCAGTGATGAGG + Intergenic
1021789710 7:24192443-24192465 GGATTGAAGGATCAGTGATTTGG + Intergenic
1022141874 7:27499870-27499892 CCATGCAAGGGCCAGAGATGTGG - Intergenic
1023149566 7:37188836-37188858 TCATGGAAGGCTCAGTCATGGGG - Intronic
1024788637 7:52937012-52937034 GCGAGGAAGAGTCTGTGATGTGG - Intergenic
1028012769 7:85669880-85669902 GCATGTAAAAGTCAGTGATGCGG - Intergenic
1031658983 7:124396977-124396999 GAATGGAAGGGTGAGTGAGAAGG + Intergenic
1032518340 7:132523505-132523527 GCACGGAAGGATGGGTGATGGGG + Intronic
1035758193 8:2049926-2049948 GCATGAAAGCCTCAGGGATGTGG - Intronic
1035846926 8:2875191-2875213 GGATGGAGAGGACAGTGATGGGG + Intergenic
1037692621 8:21195042-21195064 GCATGGAGGGGGCTGTGAGGTGG + Intergenic
1037788353 8:21916318-21916340 GGGTGGAAGGGGCAGGGATGGGG - Intergenic
1040537192 8:48320712-48320734 GCATGGAGAGGACAGTGAGGAGG + Intergenic
1041431919 8:57791675-57791697 ACTTGGAAGGGTGTGTGATGGGG + Intergenic
1042961581 8:74309179-74309201 ACCAGGAAGTGTCAGTGATGGGG - Intronic
1044900191 8:96935687-96935709 CCATGGAAAGGCCAGTGAGGGGG + Intronic
1045121393 8:99040722-99040744 GAATGGTAGGTTCAGTGAAGGGG + Intronic
1047223660 8:122938912-122938934 GCACTGCAGAGTCAGTGATGGGG + Intronic
1048871934 8:138806384-138806406 GCAGGGAAGGGTGTGAGATGAGG + Intronic
1049264248 8:141658832-141658854 ACGTGGATGGGTCAGTGATGGGG - Intergenic
1049411373 8:142475403-142475425 GCCTGGACGGGTAAGTCATGGGG - Intronic
1049830962 8:144700469-144700491 ACACGGAAGGGTCAGTGTGGCGG + Intergenic
1051436472 9:17038442-17038464 GGAAGGAAGGGTATGTGATGCGG + Intergenic
1056478928 9:86981297-86981319 GCAGGTCAGGGTCAGTGCTGTGG - Intergenic
1056721007 9:89071885-89071907 GCAAGGAAGAGTCTTTGATGTGG - Intronic
1057199018 9:93130571-93130593 GCATAGAGTGGTCAGTGTTGAGG - Intronic
1058484490 9:105429972-105429994 GCCTGGAAGGGTCAAAGCTGTGG - Intronic
1059747278 9:117215087-117215109 GGCAGGAAGGGTCAGTGCTGCGG + Intronic
1061419115 9:130463741-130463763 GCAGGGCAGGGTCAGCAATGTGG + Intronic
1061559417 9:131393678-131393700 GGATGGAGGGGGCAGTGACGGGG - Intergenic
1062684808 9:137806312-137806334 GCGTGGCAGGGACAGGGATGGGG - Intronic
1185683394 X:1907347-1907369 GCAAGAAAGGGTCTTTGATGTGG + Intergenic
1186652033 X:11571503-11571525 CCATGTAAGGGTAAGTGATTTGG - Intronic
1187567600 X:20467347-20467369 GAATGAAAGGGTCAGTCAAGTGG + Intergenic
1189232937 X:39466184-39466206 GCATGGAAGGGGCTGTGAGTAGG - Intergenic
1190165623 X:48071052-48071074 GTCTGTAAGGGTGAGTGATGGGG - Intronic
1192712882 X:73610035-73610057 GCTTGGAAGGGTGTGTGATTGGG - Intronic
1194885298 X:99307956-99307978 AGATGGAGGGGTCAGGGATGAGG + Intergenic
1196425934 X:115569693-115569715 CCATGGAAGGGTCTGTGAAATGG - Intronic