ID: 1113272761

View in Genome Browser
Species Human (GRCh38)
Location 13:108692853-108692875
Sequence GCTGATGTCCACACTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113272761 Original CRISPR GCTGATGTCCACACTGTGGA TGG Intronic
901144077 1:7053556-7053578 GCTGAAGTCCTCACTGTGACAGG + Intronic
902887890 1:19419738-19419760 GCTGCTGATCACTCTGTGGAGGG + Exonic
902892919 1:19457676-19457698 CCTGATGCTCACACTGCGGACGG + Intronic
903397771 1:23015131-23015153 GCTGATGTCTTCACTGGGCACGG - Intronic
904493743 1:30875523-30875545 GCAGCTGGCCTCACTGTGGAAGG - Intronic
905268809 1:36773256-36773278 TCTCATGTCCACATTGTGGAAGG + Intergenic
908537645 1:65092943-65092965 GCTGCTTTCAACATTGTGGAAGG + Intergenic
911266408 1:95749927-95749949 CCTTTTGTACACACTGTGGATGG + Intergenic
915142139 1:153774508-153774530 GCAAGTGGCCACACTGTGGAAGG - Intronic
915916403 1:159943410-159943432 GCTGATGACCAGGCTGAGGACGG + Exonic
917034215 1:170729286-170729308 GCTGAAGTCCACACTCTGTGGGG + Intronic
919805374 1:201378206-201378228 GCAGATGTCCTCACTGGGGCTGG - Intronic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
924323596 1:242873412-242873434 GCTGAGATCCACCCTGGGGAAGG - Intergenic
924519041 1:244789803-244789825 GCTGATATCCTCACTCTGGTAGG + Intergenic
1063312699 10:4969532-4969554 GATGAAATCCACACTGAGGAAGG + Intronic
1063315240 10:4998015-4998037 GATGAAATCCACACTGAGGAAGG - Intronic
1063577856 10:7278265-7278287 TCTGATGTCCACAGTGAGAAGGG + Intronic
1065830530 10:29610087-29610109 TCTCATTTCCACACTGTGGCGGG + Intronic
1069799306 10:71072390-71072412 GCTGCTGTCCAGACAGTGGAAGG + Intergenic
1071985729 10:91048361-91048383 ACTGATCTCCACACCATGGAAGG + Intergenic
1072518496 10:96209954-96209976 GCTGATGCTCACACTGAGGCTGG + Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1076825945 10:132968264-132968286 CATGATGCCCACACTGGGGAGGG - Intergenic
1077213016 11:1382251-1382273 GCTAATGTCCCCACTGTGACAGG + Intergenic
1077439154 11:2560166-2560188 GGTGATGTCCATCCTGGGGAGGG + Intronic
1077826202 11:5810604-5810626 GCTGGTGTTAACATTGTGGAAGG + Intronic
1079125189 11:17714018-17714040 ACAGGAGTCCACACTGTGGAGGG - Intergenic
1081608046 11:44539648-44539670 ACTGATTTCCACACTGGGGTCGG - Intergenic
1088825579 11:113491082-113491104 TCAGATGTCTACACTGTGCATGG - Intergenic
1090631093 11:128648883-128648905 GCTGCTGCCAACACTGGGGAGGG - Intergenic
1091331846 11:134736786-134736808 GCTGGAGTCCACACAGGGGAGGG - Intergenic
1092138679 12:6167691-6167713 CCTGATGTCTACACTGGGGATGG - Intergenic
1092641219 12:10512684-10512706 GGTGATATCCACACTAGGGATGG - Intronic
1092977924 12:13763711-13763733 GCTGACCTCCACCCTGTGGCAGG + Intronic
1095542220 12:43323718-43323740 GCTAATGTCCATACTGATGAAGG - Intergenic
1101771090 12:107751656-107751678 GCTCATGGCCACAGTGTGAATGG + Exonic
1102628407 12:114255102-114255124 GCTGATGTTCACTCAGGGGAAGG + Intergenic
1103718444 12:122960179-122960201 GCAGATGTCCACACTCATGAAGG + Exonic
1104248100 12:127062165-127062187 GCTGACATCCCCACTGTGTAAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108133536 13:47330187-47330209 GTTGATATCCACTCTGTGGTTGG + Intergenic
1111046851 13:82824876-82824898 TCTGAGGTGCACACAGTGGATGG - Intergenic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113813310 13:113154763-113154785 TCTGATGTCCACATTGTGGATGG - Intergenic
1114263655 14:21058113-21058135 GGTGATGGCCACACTGGAGAAGG - Exonic
1115693901 14:35876063-35876085 GCTCATGCCCACTCTGTGCAAGG + Intronic
1118141892 14:63093059-63093081 GCCGATCTCCTCTCTGTGGAGGG - Intronic
1121274478 14:92658155-92658177 TCTGATGCCCACTCTGAGGATGG - Intronic
1123697916 15:22892339-22892361 GATGATGTCCACGCTGGGGGTGG - Intronic
1125815605 15:42581414-42581436 GCTGATGGCCACGGTGTGGGTGG + Intronic
1130126318 15:81096969-81096991 ACTGATGTCATCCCTGTGGAGGG + Intronic
1131120962 15:89823316-89823338 GTTGTTGTCCAGGCTGTGGAAGG + Intergenic
1132652026 16:1025535-1025557 GCTGAGGTCCCCGGTGTGGAGGG + Intergenic
1132652042 16:1025583-1025605 GCTGAGGTCCCCGGTGTGGAGGG + Intergenic
1132652050 16:1025607-1025629 GCTGAGGTCCCCGGTGTGGAGGG + Intergenic
1134678419 16:16106755-16106777 GCTGATGTCCCCACTATAGGAGG - Exonic
1135729778 16:24884190-24884212 TCTGCTCTCCACACTGTGAACGG + Intronic
1137595532 16:49721055-49721077 GCTGATGTACACACGGTGATGGG + Intronic
1139444517 16:66988707-66988729 GTGGATGGCAACACTGTGGATGG - Exonic
1139444519 16:66988722-66988744 AGTGATGGCAACACTGTGGATGG - Exonic
1140283064 16:73573260-73573282 GGTGAGGTTCACACTGGGGAGGG - Intergenic
1141341966 16:83211833-83211855 CCTGGTGTCAACACTCTGGAAGG - Intronic
1141481317 16:84308654-84308676 GCTGGTGTCTACACTCAGGATGG - Intronic
1142104760 16:88296265-88296287 GCTTCTGTCCCCACTGGGGATGG + Intergenic
1142535643 17:616000-616022 GCTGATGTTCACACTGAGCCTGG - Intronic
1142766182 17:2065477-2065499 AGTGATGTCCTCACTGCGGAAGG + Exonic
1143140783 17:4740736-4740758 GCTGATGCCCACACTATGGTTGG - Exonic
1144435921 17:15240643-15240665 CCTGAGTTCCACACTGTAGAGGG + Intronic
1144889723 17:18487693-18487715 GATGGTGTCCACACGGTGGAAGG - Exonic
1145142488 17:20456603-20456625 GATGGTGTCCACACGGTGGAAGG + Exonic
1145763821 17:27444231-27444253 GCTCATGCCTACACTTTGGAAGG - Intergenic
1145793417 17:27642284-27642306 GATGGTGTCCACACGGTGGAAGG - Exonic
1145808222 17:27749830-27749852 GATGGTGTCCACACGGTGGAAGG - Intergenic
1147691893 17:42320885-42320907 GCAGCTGTCCTCAGTGTGGAGGG - Intronic
1148816438 17:50331317-50331339 GTTGAAGACCACTCTGTGGAGGG + Intergenic
1151146153 17:72043272-72043294 GAGGAAGTCCACACTGTGGTGGG - Intergenic
1152945816 17:83196847-83196869 GGGGATGGCCTCACTGTGGAAGG + Intergenic
1153585949 18:6620495-6620517 GTAGATGTACACATTGTGGAAGG - Intergenic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158146395 18:54318717-54318739 GATGAGTTCCACAGTGTGGAAGG - Intronic
1158935353 18:62359794-62359816 GCTGTTCTCCTCCCTGTGGAAGG + Intronic
1161679038 19:5669842-5669864 GATGATGCCCACACTGTGGGTGG - Intergenic
1163366600 19:16879102-16879124 CCTGAGGCCCACACTTTGGAGGG + Exonic
1163606630 19:18279528-18279550 GCTGATGTCCAGGTTGGGGAGGG - Intergenic
1164940940 19:32251933-32251955 GCTGATGTCGGCACTGAGGGAGG - Intergenic
1166095676 19:40537555-40537577 GCTGATGTACACAATGTGCTGGG + Intronic
1166281344 19:41796346-41796368 GCAGAGGTCCACGCTGGGGAGGG + Intergenic
1168606304 19:57762787-57762809 GCTGAAGTCTCCACTCTGGAAGG + Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
932111947 2:69010013-69010035 GGTGATGTTCAGCCTGTGGATGG - Intergenic
936094049 2:109518274-109518296 GCTGATGCCCTCACCCTGGAGGG - Intergenic
936459453 2:112702073-112702095 GGGGATGTCCACAGTGTGGGAGG - Intergenic
938488130 2:131735951-131735973 GCTGAATTCCTCAATGTGGAGGG + Intronic
942444989 2:176071820-176071842 GCTGGTGTCCACGCTCTGCAGGG - Intergenic
944280055 2:197885476-197885498 GCTGATGCCCACAGTGGGGAGGG + Intronic
946337301 2:219046617-219046639 GCTGACTTCCACACTGAGGAAGG - Intergenic
948823815 2:240564672-240564694 CCTGATGTCCTGGCTGTGGAGGG + Intronic
1168756578 20:322655-322677 CCTGGTGTCTACACTGGGGAAGG + Intergenic
1169745138 20:8935712-8935734 GCTGATGGCCCACCTGTGGATGG - Intronic
1171163475 20:22950036-22950058 TCAGATGTTCACACTGTGGGTGG - Intergenic
1173483603 20:43423470-43423492 GCTGATGGGCACAGTGTGGGTGG + Intergenic
1175117193 20:56690938-56690960 GCCCATGACTACACTGTGGAGGG + Intergenic
1175409648 20:58758472-58758494 GCTGCAGTCCCCACTGTGTAAGG + Intergenic
1175860884 20:62149419-62149441 GCTGCTGTGCACAATGGGGACGG + Intronic
1175904829 20:62374661-62374683 ACTGATGTCTACTGTGTGGATGG - Intergenic
1178419545 21:32432588-32432610 GCTGAGGGCTACACTGTGGTAGG + Intronic
1180306318 22:11128816-11128838 GCTCATGACAACACTCTGGAGGG - Intergenic
1180544838 22:16490999-16491021 GCTCATGACAACACTCTGGAGGG - Intergenic
1180686913 22:17675951-17675973 CCTGCTTTCCACACTGTGAAAGG - Intronic
1180979162 22:19870646-19870668 GCTGCTGTCAACACCCTGGATGG - Intergenic
1182289155 22:29265536-29265558 GCTGATGAGCACCCTGTGGCTGG - Exonic
1185111023 22:48900278-48900300 GCTGCTGCCCACACCGGGGAGGG + Intergenic
949520595 3:4849963-4849985 ACTGATATCCCCACTCTGGAAGG - Intronic
949669826 3:6387034-6387056 GGTGATGTCTACTCTGTGCATGG + Intergenic
950019827 3:9779457-9779479 GCAGAGGTCGACACTGTGGAGGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952500949 3:33961477-33961499 TCTGATTTCCACACTGCAGATGG + Intergenic
955791973 3:62597530-62597552 GCTACTGTCCTCAGTGTGGATGG + Intronic
961212971 3:125140054-125140076 GCTGCTGTCCACTCTGAGGCAGG - Intronic
961581635 3:127888021-127888043 GGTGATGTCCAATCTGGGGAGGG + Intergenic
969306333 4:6328126-6328148 GGGGCTGTCCACCCTGTGGATGG - Intronic
972361607 4:38330799-38330821 CCTGGTGTCCACATTTTGGAGGG + Intergenic
975040071 4:69735521-69735543 TCTGATGTCATCACTGTGAATGG - Intronic
975682583 4:76891166-76891188 GATGATGTTCAGACTGTGCAAGG + Intergenic
977718125 4:100207150-100207172 GCTGAAGTGCATAATGTGGATGG + Intergenic
982750828 4:159159175-159159197 GCTGAGGGAGACACTGTGGACGG - Intronic
990514447 5:56518748-56518770 TCTGTGCTCCACACTGTGGAGGG + Intronic
995525098 5:113044418-113044440 GCTGCTGTCCTCTCTGTGCATGG - Intronic
996088713 5:119329749-119329771 GGAGATGTCCACAGTGTGCATGG - Intronic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
1001040019 5:168327776-168327798 GCTGCTGTCTCCACTCTGGAAGG + Intronic
1005893665 6:30160579-30160601 GCTGGTGTCCACACTGGGTTTGG - Exonic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006838789 6:37015056-37015078 GCTCCTCTCCACACTGGGGAGGG + Intronic
1007679709 6:43625710-43625732 TCTCATGTCCACACTGTGGAAGG - Intronic
1010808719 6:80271438-80271460 GCAGATGGCCACAGAGTGGATGG - Intronic
1013581701 6:111541437-111541459 GCTAATGTCCACACAGGGAAAGG + Intergenic
1014705315 6:124739507-124739529 CTTGATGATCACACTGTGGAAGG - Intronic
1015750889 6:136557790-136557812 GATGCTGTGCACACTGTGGAAGG - Exonic
1016741555 6:147534078-147534100 GGTCATGTCCACACTGTGGGAGG - Intronic
1017643000 6:156512556-156512578 GCTGAAGTCTACACTGGGTAAGG - Intergenic
1019381991 7:728633-728655 GCTGATGTACAGACTGGGTAGGG - Intronic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1022718136 7:32916976-32916998 GTTCAAGTCTACACTGTGGAGGG + Intergenic
1025528962 7:61852279-61852301 GCTTTTGTCCACTCTGTGAATGG - Intergenic
1026116576 7:67500927-67500949 TCTGATGTCCACTCTTTGCAAGG + Intergenic
1029898879 7:104019140-104019162 GAAAATGTCCACACTATGGAAGG - Intergenic
1029979131 7:104861895-104861917 GCTGCTGTCCACGCTGCTGATGG + Intronic
1033310166 7:140255447-140255469 GCTCATGTCCTTACTGAGGAAGG - Intergenic
1035605132 8:925550-925572 TTGGATGTCCACATTGTGGACGG + Intergenic
1040940323 8:52826215-52826237 GATGAAGCCCCCACTGTGGAAGG - Intergenic
1041251024 8:55935005-55935027 GGTGATGCCCACACCATGGACGG + Intronic
1045646617 8:104305632-104305654 GCTGATGTCCAGACCAGGGATGG + Intergenic
1045702827 8:104886607-104886629 GCATATGCCCACACTGGGGAGGG - Intronic
1046473751 8:114713543-114713565 ACTGATGTCCATACTCTGCATGG + Intergenic
1048365604 8:133735733-133735755 GCGGATGACCACACGGAGGATGG + Intergenic
1049036134 8:140077673-140077695 CCTGATGTCCACAGTGGGAAGGG - Intronic
1049541239 8:143210149-143210171 GCTGGTGTCAACACGGGGGAGGG + Intergenic
1051700385 9:19816461-19816483 GGTCATCTCAACACTGTGGAAGG + Intergenic
1055414963 9:76071830-76071852 GATGATGGCAAGACTGTGGACGG + Exonic
1056994852 9:91446157-91446179 GCAGATGTCCACAGTGGTGATGG + Intergenic
1057015525 9:91647585-91647607 GCTGATGTTCACTCAGTGTAGGG - Intronic
1059983994 9:119803875-119803897 GGTGATGTCTGCACTGGGGATGG - Intergenic
1061079748 9:128362777-128362799 GCTGGTGTCCACTCAGTGCATGG + Intergenic
1061821428 9:133228961-133228983 GCTGATGTGCACACCGTCAAGGG + Intergenic
1061931304 9:133834452-133834474 GCTCTTGTCCACTCTCTGGAAGG + Intronic
1062237815 9:135521103-135521125 GCTGACGTGCACACTGTCAAGGG - Intergenic
1189855022 X:45215063-45215085 GCTCATGCCCACACTTTGGGAGG - Intergenic
1191262420 X:58340031-58340053 GTTGATGTCCACGCTGCGAATGG + Intergenic
1193374181 X:80738605-80738627 GTTGCTGTGCACACAGTGGAGGG + Intronic
1194642362 X:96417627-96417649 CCTGGTGTCCAGACTGTAGATGG + Intergenic
1196821413 X:119704032-119704054 GATGATGCCCACATTGGGGAAGG + Intergenic
1198741626 X:139849123-139849145 GCTGATGTGCACACAGTGTGAGG - Intronic
1199116987 X:144004459-144004481 GCTAATTTCCTCACTGTGGTGGG + Intergenic
1199810681 X:151345545-151345567 GCTGATGGCTGCACTTTGGAAGG - Intergenic