ID: 1113274425

View in Genome Browser
Species Human (GRCh38)
Location 13:108712718-108712740
Sequence GGTTCTTACCAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113274425_1113274429 1 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274429 13:108712742-108712764 CGACAGTCAGTGCCAGTGCATGG 0: 1
1: 0
2: 0
3: 5
4: 158
1113274425_1113274431 3 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274431 13:108712744-108712766 ACAGTCAGTGCCAGTGCATGGGG 0: 1
1: 1
2: 1
3: 17
4: 167
1113274425_1113274438 29 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274438 13:108712770-108712792 CCCGGGGGAGAGTACATTACAGG 0: 1
1: 0
2: 0
3: 2
4: 32
1113274425_1113274435 13 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274435 13:108712754-108712776 CCAGTGCATGGGGACACCCGGGG 0: 1
1: 0
2: 1
3: 12
4: 111
1113274425_1113274433 12 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274433 13:108712753-108712775 GCCAGTGCATGGGGACACCCGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1113274425_1113274436 14 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274436 13:108712755-108712777 CAGTGCATGGGGACACCCGGGGG 0: 1
1: 0
2: 1
3: 16
4: 123
1113274425_1113274432 11 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274432 13:108712752-108712774 TGCCAGTGCATGGGGACACCCGG 0: 1
1: 0
2: 1
3: 14
4: 189
1113274425_1113274430 2 Left 1113274425 13:108712718-108712740 CCCTGCTCCATCTGGTAAGAACC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1113274430 13:108712743-108712765 GACAGTCAGTGCCAGTGCATGGG 0: 1
1: 0
2: 1
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113274425 Original CRISPR GGTTCTTACCAGATGGAGCA GGG (reversed) Exonic
901809916 1:11761811-11761833 GGTTCCTACCAGTGGGAGCCGGG + Exonic
906169477 1:43712223-43712245 GCTTCTAACCAGCTGCAGCAAGG + Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
909830261 1:80180009-80180031 CCTTCTTAACTGATGGAGCAAGG - Intergenic
912170986 1:107098822-107098844 GACTCTTACCAGATGCAGCCTGG + Intergenic
914692457 1:150042665-150042687 GACTCTTACAAGAAGGAGCAGGG - Intergenic
915314225 1:155018831-155018853 GGATCTGAACAGATGGGGCAGGG - Intronic
916405951 1:164498212-164498234 GGTTCTTATCAGAGGAAGGAAGG - Intergenic
916610211 1:166384416-166384438 GGTTCTTACTTGCTGCAGCAAGG - Intergenic
918410517 1:184253737-184253759 GGACCTTCCCAGATGGAGCCAGG - Intergenic
918705979 1:187662746-187662768 TGTACTTGCCAAATGGAGCATGG + Intergenic
922886361 1:229023930-229023952 GGGTCCTGCCAGATGGAGCATGG + Intergenic
1063230014 10:4056455-4056477 GTTTCTTCCCAGATGCAACAAGG + Intergenic
1069753081 10:70757297-70757319 TCTTCTTCCCTGATGGAGCAGGG - Intronic
1069850987 10:71404851-71404873 GGTCCTCTCCAAATGGAGCATGG - Intronic
1071470730 10:85982491-85982513 GGTTCTCACCTGATGGACAATGG - Intronic
1072783954 10:98268123-98268145 GGGGCTCACCAGATGGAGCGCGG + Exonic
1072914088 10:99526614-99526636 AGGTCTTACCAGTTGGAACAGGG + Intergenic
1080719070 11:34831666-34831688 GGTTCTTGTCAGAAGTAGCAAGG + Intergenic
1085445691 11:76599283-76599305 GGTTCTTAGCAGCTGGGGGAGGG - Intergenic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1088433464 11:109783909-109783931 TGTTCTTCCCAGAAGAAGCAGGG + Intergenic
1091525807 12:1299735-1299757 GGTCCCTACCAAATGGATCAAGG + Intronic
1101450223 12:104769480-104769502 TATTCTTTCCTGATGGAGCAGGG - Intergenic
1102097050 12:110249277-110249299 GCTTCTTTCCACATGGAGGACGG - Intergenic
1104341505 12:127954144-127954166 GGGTCCTACCAGAGGGTGCAGGG - Intergenic
1107237574 13:38191362-38191384 AGTTCTTACAAGAGGGAGCAGGG - Intergenic
1109326058 13:60869583-60869605 GGTGTTTACCAAATGGAACATGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1111864878 13:93756192-93756214 TGTTCTTAGCATTTGGAGCAAGG + Intronic
1113274425 13:108712718-108712740 GGTTCTTACCAGATGGAGCAGGG - Exonic
1115762553 14:36589961-36589983 GGCTTTTACCAGTTGGAGGATGG + Intergenic
1119888345 14:78163512-78163534 GGGCCTTAGGAGATGGAGCAGGG + Intergenic
1122473053 14:101985101-101985123 GGTCCTTCCAAGATGGAGGAAGG - Intronic
1125504871 15:40261879-40261901 AGTTCTTCCCAGAGGCAGCAGGG - Intronic
1127257941 15:57307191-57307213 GGTTCTTAGTAGGTGGGGCAGGG - Intergenic
1127826918 15:62712137-62712159 GGTACTTTCCAGATGGGGCATGG + Intronic
1128133158 15:65244075-65244097 AGATCTTACCAGATGGAGAAAGG - Intronic
1130210147 15:81914997-81915019 GGATCTTACTGGATGGAGGAGGG - Intergenic
1132710065 16:1262554-1262576 GGGGCTCACCAGCTGGAGCAGGG + Intergenic
1133934277 16:10256150-10256172 GGTTTTTACCAGAGGGAGGGAGG - Intergenic
1138614945 16:58157804-58157826 GGTTCTAACCAGACGAAGCAGGG - Intergenic
1142866436 17:2794347-2794369 GGTTCTTCTCAGATGGAGGCAGG + Intronic
1146540048 17:33686130-33686152 AGTTCTTAACAGCTGCAGCAGGG + Intronic
1147726464 17:42568751-42568773 GGTTCTTCCCAGCTGGGGAAAGG + Intronic
1153293187 18:3521349-3521371 GGGGCTTATCATATGGAGCAGGG - Intronic
1155437691 18:25830321-25830343 GGTTCTCACCATATCTAGCAAGG + Intergenic
1168582466 19:57566948-57566970 TGCTGTTAACAGATGGAGCATGG + Intergenic
925896537 2:8476606-8476628 GGATTTTGCCAGATGCAGCAGGG + Intergenic
926372583 2:12194971-12194993 GGGATTTCCCAGATGGAGCAGGG + Intergenic
929939820 2:46325057-46325079 TGACCTTTCCAGATGGAGCAGGG + Intronic
937068247 2:119037106-119037128 GGTGGTTACCAGAGGCAGCAAGG + Intergenic
937904544 2:127046435-127046457 GCTTCTTGCCAGAGGGAGCAGGG - Intergenic
941254391 2:163210150-163210172 TTTTCTTACCACATGTAGCAAGG + Intergenic
944301819 2:198132294-198132316 GGTTCTTACCTTTTAGAGCAGGG + Intronic
946347811 2:219125376-219125398 GGCCCTTACCACATGAAGCAGGG - Intronic
1168929483 20:1609555-1609577 GGTCCTTACAAGAAGGAGGAAGG - Intronic
1170590220 20:17765861-17765883 GGCTGTGACCAGATGGAGCATGG + Intergenic
1171183475 20:23108315-23108337 GGTTCCCTCCAGCTGGAGCATGG - Intergenic
1173003545 20:39122952-39122974 TGTTCTTTCCAGATGGAGGCAGG + Intergenic
1174073853 20:47918262-47918284 GGATCTTAACAGAAGCAGCACGG - Intergenic
1174145970 20:48452825-48452847 GCTTCTTTTCAGAAGGAGCAGGG - Intergenic
1176011045 20:62895776-62895798 AGTTCTCACCACTTGGAGCAGGG - Intronic
1177080616 21:16634509-16634531 GGTTCTTACCATCTTTAGCATGG + Intergenic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1184858302 22:47158514-47158536 GGTTCTTCACACATGGATCACGG + Intronic
949179981 3:1117271-1117293 GGTGTTTACCAGGTGGACCAAGG + Intronic
950437265 3:12987357-12987379 GGTTCTCACCAAATGGTGCCGGG + Intronic
952844403 3:37674919-37674941 GGTCCTTTCCAGAAGGAGCTTGG + Intronic
952975224 3:38688176-38688198 GGTTAATACCTGATGCAGCAGGG + Intergenic
953134544 3:40171352-40171374 GGATCCTACTGGATGGAGCAGGG + Intronic
958853155 3:99353191-99353213 AGTTTTTACCAGATGGAACCTGG - Intergenic
961167618 3:124774368-124774390 GGTTCTTCTGAGAGGGAGCAAGG + Intronic
961767772 3:129225398-129225420 GGTTCAAATCAGCTGGAGCAGGG + Intergenic
963453171 3:145510497-145510519 GATTATTAACAAATGGAGCATGG + Intergenic
966266723 3:178054960-178054982 GGTTCTTAGCAGAGGTAGGAAGG - Intergenic
966887224 3:184383405-184383427 GGCTCTTACCTGATAGATCAGGG - Exonic
971294847 4:25378962-25378984 GGTTCTAACCTGATGAAGGAGGG + Intronic
979211064 4:118103652-118103674 GGTCCTTACAAGGTGGGGCACGG - Intronic
984904123 4:184611088-184611110 GCTTCTTACCAGGTTGAGTATGG + Intergenic
991354122 5:65749857-65749879 AGTTCTTTCCATAGGGAGCAGGG - Intronic
995995899 5:118299069-118299091 GTTTCTAACCAAATGGAGAAAGG + Intergenic
999595709 5:153201955-153201977 GGTTGTTACAACTTGGAGCAAGG - Intergenic
1000765349 5:165282676-165282698 GGGTCTAACCAGATGTAGCCTGG - Intergenic
1004111179 6:12720475-12720497 GGTTTTCAGCAGATGGAGCTGGG + Intronic
1012860510 6:104553730-104553752 GGTTGTTACCAGAGGCAGGAGGG + Intergenic
1013963965 6:115933451-115933473 TGTTTTTACCTGATGGATCATGG - Exonic
1016399182 6:143659712-143659734 GCTTCTTACCATTGGGAGCATGG - Intronic
1016900524 6:149096717-149096739 TGGGCTTACCAGAAGGAGCAGGG - Intergenic
1019917522 7:4143327-4143349 GGGTCTTGCCAGCTGGAGGAGGG + Intronic
1019990809 7:4689335-4689357 GCCTCTCAGCAGATGGAGCATGG - Intronic
1020690277 7:11346484-11346506 CTTTCTTACCAGCTGGGGCAAGG - Intergenic
1022470391 7:30678510-30678532 AGTTATTTCCAGATGCAGCAGGG - Intronic
1026839510 7:73661797-73661819 GGTTCTTATAAGAGGGAGGAAGG - Intergenic
1028854942 7:95580271-95580293 GCTTGTTTCCAGATGGATCATGG - Intergenic
1032382068 7:131495626-131495648 GTTTTTTACCACATGGAGAAAGG + Exonic
1035845695 8:2861873-2861895 GTTTCTTACCATATGGACTATGG + Intergenic
1036015214 8:4775521-4775543 GGTTCCTATCAGAAGGACCAAGG + Intronic
1036402531 8:8423005-8423027 CCTTCTTAGCTGATGGAGCAAGG + Intergenic
1036724011 8:11202238-11202260 GGGTCTTACATGTTGGAGCAAGG + Intergenic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1039872600 8:41559460-41559482 GGTTCCTACCCGATAGAGGATGG - Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1043543980 8:81294780-81294802 GATTCTAGCCTGATGGAGCATGG + Intergenic
1044792228 8:95859166-95859188 GTTTCTTACCACATGCAGCCTGG + Intergenic
1047411742 8:124629794-124629816 GGTTCTTCCCAGATGGAGGGGGG - Intronic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1050140432 9:2511349-2511371 GGTTGTTGCCAAATGGACCATGG - Intergenic
1051246914 9:15121230-15121252 GGCTCTTTCCAGATGGAAAAGGG - Intergenic
1051856856 9:21577440-21577462 GGGTCTTCCCAGATGAAGCTGGG + Intergenic
1056182964 9:84103296-84103318 GTTTCTTACCAAATGGAAAAAGG - Intergenic
1056220704 9:84448282-84448304 GGTCCTTACCAGAGGGAGGCAGG + Intergenic
1059020907 9:110575389-110575411 GGTTTTTCCCTGATGCAGCAGGG + Intronic
1060779771 9:126402878-126402900 GGTTCTTTACACAAGGAGCACGG + Intronic
1061923986 9:133797105-133797127 TGTACTAACCAGATGGAGCCTGG + Intronic
1062244010 9:135554065-135554087 GGTTCACAGCAGATGGAGCAAGG - Intergenic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1062469858 9:136697604-136697626 GGTTCCTACCAGATGGGGCTTGG + Intergenic
1186094245 X:6082687-6082709 GGATCTTCCCAGATGGAGAGTGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1192288147 X:69760771-69760793 GCTTCTTAGCAGACGGATCAAGG + Intronic
1193418782 X:81257860-81257882 AGCTCTTACTAGATGCAGCATGG - Intronic
1196296722 X:114006137-114006159 GGTTTTTTCCAGAGAGAGCATGG + Intergenic
1199691037 X:150309132-150309154 AGTTCTCCCCAGATGGTGCAGGG - Intergenic