ID: 1113275526

View in Genome Browser
Species Human (GRCh38)
Location 13:108725184-108725206
Sequence TCCCTATGTTCAGAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113275526_1113275530 26 Left 1113275526 13:108725184-108725206 CCCTCACTTTCTGAACATAGGGA 0: 1
1: 0
2: 0
3: 22
4: 179
Right 1113275530 13:108725233-108725255 CCTGATTTGCTCATTCTAACAGG 0: 1
1: 0
2: 0
3: 15
4: 111
1113275526_1113275528 -5 Left 1113275526 13:108725184-108725206 CCCTCACTTTCTGAACATAGGGA 0: 1
1: 0
2: 0
3: 22
4: 179
Right 1113275528 13:108725202-108725224 AGGGAATATAGTTATAAATACGG 0: 1
1: 0
2: 3
3: 36
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113275526 Original CRISPR TCCCTATGTTCAGAAAGTGA GGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903273720 1:22207980-22208002 TCCCCATGGCCTGAAAGTGAGGG - Intergenic
903762769 1:25710755-25710777 GCCCTTTGTTCAGAACCTGAAGG + Intronic
904018844 1:27446027-27446049 TTCCTATATGCAGAAAGAGATGG - Intronic
904886119 1:33739732-33739754 TCCCTAACTTCAGACAGTTATGG + Intronic
905029964 1:34875599-34875621 TCCCTATGGTTAGAAAGAGTTGG + Intronic
906041912 1:42794093-42794115 TGCCTAAGGTCACAAAGTGAGGG + Intronic
911041153 1:93592041-93592063 TCCACATGTTCAGGAAGTGAAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914589096 1:149090426-149090448 TTCCTATGTACATAAAGGGAGGG + Intronic
915737999 1:158096697-158096719 TCTCTTTGGTCAGAAAGTGGTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916215393 1:162389187-162389209 TCCCTAGATACAGAAAGTGGAGG - Intergenic
917047650 1:170879967-170879989 TCCCTCTGATTAGAAAATGAAGG + Intergenic
917265490 1:173216557-173216579 TCCTTATGATCAGAGACTGAGGG + Intergenic
917730804 1:177872622-177872644 TACCTAAGTTCAGAATCTGAAGG + Intergenic
920224939 1:204431636-204431658 TCCCTCTGTGCAGATAGTAAAGG + Intronic
921554196 1:216577211-216577233 TCCCTATGTTCAGCAAATGCAGG - Intronic
921685148 1:218081636-218081658 TCCTTAACTTCAGGAAGTGAAGG + Intergenic
923074520 1:230597917-230597939 TTCCTATATTCAAAAGGTGAAGG - Intergenic
924567933 1:245213426-245213448 TCCCTCTTCTCAGAAAGAGAGGG - Intronic
924780207 1:247140865-247140887 TCTCAATGTTCTGAAAGTGTGGG + Intronic
1062795597 10:342622-342644 TCTTAATGATCAGAAAGTGAAGG + Intronic
1062803267 10:395763-395785 TCCCTATGTCCTGGAGGTGAGGG + Intronic
1063589638 10:7383732-7383754 GCCCTGTGCTGAGAAAGTGAGGG - Intronic
1065307020 10:24378846-24378868 TAGCTATGTTTAGGAAGTGAGGG + Intronic
1066034450 10:31467733-31467755 TCCCTGTGTTCTGACAGTGGGGG - Intronic
1066485336 10:35837772-35837794 TCTCTGTGTTTAGAAAGTGAAGG + Intergenic
1067306031 10:45064934-45064956 TCTTTGTGTTTAGAAAGTGAAGG + Intergenic
1067815221 10:49469649-49469671 TCACTGTGTTCACAATGTGATGG - Intronic
1075414642 10:122253350-122253372 TCCATCTTCTCAGAAAGTGAGGG - Intronic
1077055124 11:587978-588000 TCACAATATTCAGAAAGGGAGGG - Intronic
1079197172 11:18339412-18339434 TGCCTCTGTGCAAAAAGTGAAGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082894171 11:58172596-58172618 TCCCTGGCTCCAGAAAGTGATGG + Intronic
1083202808 11:61130726-61130748 TCCCTGTCTTCAGAATGTAAAGG - Exonic
1088132037 11:106504380-106504402 TTACTATGTTCAAACAGTGAAGG + Intergenic
1092071413 12:5634425-5634447 TCCCTACATTCAGAGAGGGAAGG + Intronic
1095536055 12:43248984-43249006 TCCATTTGTTAAGAGAGTGATGG - Intergenic
1095772135 12:45971673-45971695 TCCTAATGTTCAGAAAGAGAGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096924106 12:55123110-55123132 TCCCTAAGTTCAGGCAGTGATGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097148428 12:56957967-56957989 TTTCTATGTTCAGAAGGTCATGG - Exonic
1099300953 12:80893760-80893782 TCCCTCTGCTCAGACAGAGAGGG - Intronic
1099467495 12:83005535-83005557 TCCCCATGCTCTGAGAGTGACGG + Intronic
1102037281 12:109778823-109778845 TCCCAATGTTCTCAAAGTGTGGG - Intergenic
1103548574 12:121719500-121719522 TACCTAAGTTCAGGAAGTGGAGG + Intronic
1104548427 12:129733077-129733099 TCCCTATGATCAAAATGTTATGG - Intronic
1106611562 13:31287767-31287789 TCCATATGTTCAAAAAGACATGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1112132541 13:96539789-96539811 CCCCTAGGTTCAGAAAGCCACGG + Intronic
1113275526 13:108725184-108725206 TCCCTATGTTCAGAAAGTGAGGG - Intronic
1115760078 14:36571655-36571677 TAGCTATGTTCATAAAGTTAAGG + Intergenic
1115955275 14:38771555-38771577 TCCATATGTGGACAAAGTGAAGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120501765 14:85306374-85306396 TAACTATGTACAGATAGTGACGG + Intergenic
1124007538 15:25806907-25806929 TCCCTTTCTCCAGAAACTGAAGG + Intronic
1125211405 15:37219560-37219582 TGGCTATGTTCAGAAAGGAAAGG + Intergenic
1127827694 15:62719369-62719391 GCCCCATGTTCAGAAGGTGAGGG - Intronic
1127961846 15:63895970-63895992 TCCTTGTATTCAGACAGTGAAGG - Intergenic
1131574139 15:93569425-93569447 TCCATTTGTTCTGAAAGTAAGGG - Intergenic
1133478146 16:6143449-6143471 TCCCAATGCTCACAAAATGAAGG + Intronic
1134589082 16:15437334-15437356 TCTCTATTTTCAGAAAATGAAGG - Intronic
1134772354 16:16820741-16820763 TCTGTATGTTCAGAGAGTGATGG + Intergenic
1135965881 16:27034574-27034596 TCACTATGTTGAGAAGGTCAGGG - Intergenic
1137317538 16:47342429-47342451 CCCCTAAGTTCAGGAAGTTAAGG + Intronic
1143048320 17:4100897-4100919 TCCAAATCTTCAGCAAGTGAAGG + Intronic
1144404067 17:14935413-14935435 TCTCTATGTTCAGAAGGCGGAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1147497368 17:40929597-40929619 GCCCAATGTTCAGCAAGTTAGGG - Intronic
1150121646 17:62608391-62608413 TCCCTAGAGTCAGAAAGGGAGGG + Intronic
1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG + Intronic
1151931063 17:77231674-77231696 TCCCTGTGCTCAGATGGTGACGG + Intergenic
1153912986 18:9720426-9720448 GCCAGATGTTCAGAAGGTGAGGG + Intronic
1154486448 18:14875416-14875438 AGGCCATGTTCAGAAAGTGAAGG + Intergenic
1155064311 18:22255448-22255470 TCCCTAAATTTAGAAAGTAACGG + Intergenic
1155182733 18:23362192-23362214 TCACCATGTTCAGAAACTGGTGG + Intronic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1157088685 18:44609068-44609090 TATCTTGGTTCAGAAAGTGAAGG - Intergenic
1158057111 18:53294511-53294533 TGCCTAAGTTCAGAAAGGGTGGG + Intronic
1158546198 18:58399411-58399433 TCCCTAAATTCAGACAATGAGGG + Intronic
1159750747 18:72299152-72299174 TTATTATGTGCAGAAAGTGAAGG + Intergenic
1159821234 18:73147342-73147364 TCCTTATATTAAAAAAGTGAAGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163981476 19:20904475-20904497 TCCCAATGTTCTGAATGTGTGGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164549257 19:29194656-29194678 TTACTATTTTCAGGAAGTGAGGG - Intergenic
1166100423 19:40568294-40568316 GCCTTATGACCAGAAAGTGAGGG + Intronic
1168403010 19:56096939-56096961 TCCCGATGTTGAGAGGGTGAGGG - Intronic
1168404219 19:56102577-56102599 TGCCAATGTCCAAAAAGTGAAGG + Intronic
925131017 2:1494064-1494086 TGCCTCTGTGCAGAACGTGAAGG - Intronic
930304744 2:49664824-49664846 TCTCTATGCTCTGAAAGTGTGGG + Intergenic
930584400 2:53252451-53252473 TCACAATGTTCAGGAAGGGAGGG - Intergenic
931282589 2:60807375-60807397 TCCCTAAGCACAGGAAGTGAAGG + Intergenic
932345258 2:70991251-70991273 TCCCCAGGGTCAGAAAGTGGTGG + Intronic
932774548 2:74519820-74519842 TCTCTATGCTCAGAAAGAGGAGG - Intronic
932819256 2:74885645-74885667 TCTGTGTGTTCAGAAAGTGAAGG + Intronic
935651391 2:105385261-105385283 TCCCTGGGAACAGAAAGTGATGG + Intronic
935821275 2:106895337-106895359 TGACTATTTTCAGACAGTGATGG - Intergenic
936111597 2:109670174-109670196 TGCATATTTTCAGAATGTGAAGG - Intergenic
936881905 2:117263045-117263067 TACATATGTACTGAAAGTGACGG - Intergenic
939218532 2:139272176-139272198 TCCATGTGTTGAGAAAGTAAAGG - Intergenic
940385711 2:153068979-153069001 TCTCTCTGTTCAGCCAGTGAAGG + Intergenic
941847326 2:170146460-170146482 TCCATTATTTCAGAAAGTGATGG - Intergenic
943913363 2:193596338-193596360 TCCCTATACACAGAAAATGAAGG + Intergenic
944749232 2:202691017-202691039 TCCATTTGTTCAGACAGTAAGGG - Intronic
948352746 2:237354346-237354368 TCCCTGTGGGCAGAATGTGAGGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168937371 20:1677278-1677300 TCCATATGGCCAGAAAGTGAAGG - Intergenic
1168939680 20:1698075-1698097 TCCATATGGCCAGAAAGTGGAGG - Intergenic
1169466136 20:5841148-5841170 TCGCTATTTTCAGTAAGTTATGG - Intronic
1170786209 20:19469809-19469831 TGCCAATATTCATAAAGTGATGG - Intronic
1170788726 20:19490433-19490455 TCCCTCTCTCCAGAAAGTCAGGG - Intronic
1170860294 20:20096675-20096697 ACCATATGTGCAGAAAGAGACGG - Intronic
1171287309 20:23951833-23951855 TACCTGTGTTCCAAAAGTGAGGG + Intergenic
1172267755 20:33631365-33631387 TGCAAATGTTCAGAAAGTGAGGG - Intronic
1177147583 21:17423142-17423164 TCCATATGGTAAGGAAGTGAGGG + Intergenic
1179023209 21:37657664-37657686 TCACTGAGTCCAGAAAGTGAGGG - Intronic
1183143233 22:35964205-35964227 TTCCTATTTTCAGATAGTGAGGG + Intronic
951267336 3:20584422-20584444 GACATATGTTCAGAAATTGAAGG + Intergenic
956518226 3:70074657-70074679 TCCCCATGTACAAAAGGTGAAGG + Intergenic
956645805 3:71454721-71454743 TACATATGTTCTGAAAGTTAGGG - Intronic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960342995 3:116497737-116497759 TCTAAATGGTCAGAAAGTGAGGG - Intronic
962701380 3:138002988-138003010 TCCCTATGTGCAGACAGTCTGGG - Intronic
964416390 3:156452527-156452549 GCCACATGTTCTGAAAGTGAAGG - Intronic
965422903 3:168484388-168484410 TCAATATGTTCAGAAGATGATGG - Intergenic
968326311 3:197820091-197820113 TCCCTCTGTTCATATAATGATGG + Intronic
970990894 4:22211834-22211856 TACCTCTGTTCAAAAAGTGAGGG - Intergenic
971418032 4:26451481-26451503 TTCCTAAGCTCAGAAGGTGAGGG - Intergenic
973077392 4:45946586-45946608 TCGTTATGAGCAGAAAGTGAAGG + Intergenic
973553749 4:52060919-52060941 TCTCACTGTTCAGAAAGTCAAGG - Intronic
975304620 4:72835234-72835256 ACCCTATGTTCAGCAAGACAAGG + Intergenic
975544496 4:75547358-75547380 TCCCAACGTTCAGAGAGGGAGGG + Intronic
975941839 4:79657278-79657300 TCCCTATGTTTAGAAATTCCAGG + Intergenic
979843615 4:125478964-125478986 TAGATATGTTCAGGAAGTGAAGG - Intronic
981976002 4:150729068-150729090 TCCTTATCTTCACAAAGTGCTGG - Intronic
987677863 5:21098397-21098419 TCCATGTGATCAGGAAGTGAAGG + Intergenic
989402844 5:41027102-41027124 TGCCTATGTTCTGAATGTTATGG - Intronic
990438811 5:55822602-55822624 TTCCTATGTTCAGAAGGAGAGGG - Intergenic
996302148 5:122001117-122001139 TCACTATTCTCAAAAAGTGATGG + Intronic
1000031762 5:157407574-157407596 TCTCAATGTTCTGAAAGTGTGGG - Intronic
1000944739 5:167407300-167407322 TATCTATGTTCTGCAAGTGATGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003814805 6:9827035-9827057 TCAGTGTGTTCAGAAAATGACGG + Intronic
1004932403 6:20475133-20475155 TCACTAAGTCTAGAAAGTGAAGG - Intronic
1006886975 6:37390076-37390098 TTCCTGTGTTCAGAGAGGGAGGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1009790862 6:68399953-68399975 TCTCTCTGTTCTGAAAGTGAGGG - Intergenic
1011138499 6:84126654-84126676 TCTCTATATCCAGAAAGTAAAGG + Intronic
1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG + Exonic
1016580698 6:145626905-145626927 TCACTATGGTCAAAAAGTGATGG - Exonic
1017588680 6:155954597-155954619 TCCCAATCATCAGAAAATGAGGG + Intergenic
1017783346 6:157733668-157733690 TCCATAGGCTCAGAAAGAGAGGG + Intronic
1020501932 7:8934245-8934267 TCAACATGTGCAGAAAGTGAAGG - Intergenic
1021774726 7:24041439-24041461 AACAGATGTTCAGAAAGTGAAGG + Intergenic
1022682670 7:32564909-32564931 TTCCTCTGGTTAGAAAGTGATGG - Intronic
1024722534 7:52153558-52153580 TCCCTGTTTCCAGAAAGTTAAGG + Intergenic
1027862457 7:83602200-83602222 TCCCTATGATTAGACAGGGATGG - Intronic
1031961985 7:127998451-127998473 AGACTATGTTCAGAGAGTGAAGG - Intronic
1037737660 8:21580357-21580379 TTCCTGTGTTCAGAGAGAGAGGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039942716 8:42104958-42104980 TCCATATGTTCAAAAAGTCAAGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041623112 8:59996486-59996508 TTCCTTTCTTCATAAAGTGAAGG - Intergenic
1042154970 8:65834707-65834729 TCTTCATTTTCAGAAAGTGATGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043589804 8:81816757-81816779 TGCCTATTGTCAGAAAGTGCAGG + Intronic
1044062639 8:87657833-87657855 TTCTGATGTTCAGAAAGTAAGGG - Intergenic
1044591042 8:93915027-93915049 TCTCTATGTCCACAAAGTAAGGG + Intronic
1044861764 8:96530715-96530737 TATCTATGCTCAGAAAGTTAAGG - Intronic
1045699149 8:104846694-104846716 TCCCTATGTCCACAAAGGGATGG + Intronic
1050251806 9:3752754-3752776 TTCATGTGTTCAGAAAATGAAGG + Intergenic
1050740514 9:8814213-8814235 TCCCTATAGCCAGAAAGTCAAGG + Intronic
1053887376 9:42654231-42654253 AGGCCATGTTCAGAAAGTGAAGG + Intergenic
1054226398 9:62461682-62461704 AGGCCATGTTCAGAAAGTGAAGG + Intergenic
1055431637 9:76250004-76250026 TTCCTCTTTTAAGAAAGTGAAGG + Intronic
1056263989 9:84877722-84877744 TTCCTATGTTCAGAAACTCCAGG + Intronic
1057248295 9:93478089-93478111 TCCTTATTTTTAGGAAGTGATGG - Intronic
1057676055 9:97137011-97137033 TCTCTATGATCAGAAAGAAACGG + Intergenic
1060138328 9:121180150-121180172 TCCCTGTGTTCACAGTGTGAGGG - Exonic
1185654464 X:1672930-1672952 TCCCTTTGGACACAAAGTGAGGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187761550 X:22591894-22591916 TCTCTATGCTCAGAAATTAAGGG + Intergenic
1188310220 X:28607881-28607903 TCCATCTGTACAGAAACTGAGGG + Intronic
1190581531 X:51895903-51895925 TCCGGATGTTCACAAACTGATGG + Intronic
1191223766 X:58017889-58017911 TCTCTATGCTCTGAAAGTGGGGG - Intergenic
1192632364 X:72787333-72787355 TCACTATGGTGAGACAGTGAAGG + Intronic
1192649345 X:72933468-72933490 TCACTATGGTGAGACAGTGAAGG - Intronic
1192696377 X:73420300-73420322 TCCCAATGCTCTGAAAGTGTGGG - Intergenic
1192833941 X:74779600-74779622 TGCCTATGTTGGGAAAGTAAGGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195432621 X:104806375-104806397 TTCCTCAGTTCAGAAAGGGATGG + Intronic
1195554466 X:106206021-106206043 TCATTATCTTCCGAAAGTGAAGG - Exonic
1196245024 X:113390804-113390826 TCCCAGTGTTCAGAAGGTGTGGG + Intergenic
1196245458 X:113393845-113393867 TCCCTTTGTTCTGAAACAGATGG + Intergenic
1196918426 X:120561816-120561838 TCCCTATGTTAAGATAGGAAAGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199793287 X:151174744-151174766 TCCGTAAGTGCAGACAGTGAAGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic