ID: 1113278211

View in Genome Browser
Species Human (GRCh38)
Location 13:108758609-108758631
Sequence GGTCATGTCTGTTCTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113278211 Original CRISPR GGTCATGTCTGTTCTTCTAA TGG (reversed) Intronic
900717426 1:4153845-4153867 TCTCATGCCTGTTCTTATAAGGG + Intergenic
902359390 1:15933981-15934003 GGTGCTGTTTTTTCTTCTAAAGG - Exonic
904849793 1:33448832-33448854 GGTTATCTCTGTTCTTCTGCTGG - Intergenic
904964425 1:34360626-34360648 GGTCTTGTGTGTTCTCCCAAAGG - Intergenic
907225723 1:52944410-52944432 GAGCATGTCTGTTCTCCAAAAGG + Intronic
908940678 1:69429745-69429767 GGTCATGTTTATTGTTTTAAAGG - Intergenic
909463814 1:75949852-75949874 AGTCATCTCTTTTCATCTAAAGG - Intergenic
909519886 1:76555526-76555548 GGTCATTAATGTTCTCCTAAAGG + Intronic
909981121 1:82102583-82102605 GGTTATTTCTGTTCTTCTGCTGG + Intergenic
910011934 1:82475140-82475162 TCTCATATCTGTTCTTATAAGGG + Intergenic
910359879 1:86404949-86404971 TGTCATGTCTCTTCTTATAAGGG + Intergenic
910373310 1:86541613-86541635 GGTCATGTCTTGCCTTCTAGAGG - Intergenic
911040174 1:93585042-93585064 GGTCTTGTCTTATCTTCGAAAGG - Intronic
914991082 1:152500155-152500177 CGTGATGTCAGTGCTTCTAAGGG - Intergenic
916325492 1:163554407-163554429 TGTCATTTTTCTTCTTCTAAAGG + Intergenic
916443888 1:164854212-164854234 AGTCATGTCTGTTTTTGAAATGG - Intronic
917150108 1:171933899-171933921 GGTTATGTCTGTACTTTTAGCGG + Intronic
917683200 1:177388807-177388829 GGATATGTATGTTCTTCTGATGG + Intergenic
917933955 1:179846280-179846302 GGTCCTGACTGTTCTGCTAGAGG - Exonic
922223187 1:223624391-223624413 TATCATGTCTGTTCTTTTAATGG + Intronic
922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG + Intergenic
922590845 1:226774848-226774870 GGACATGTCTGGTCTGCTGATGG + Intergenic
923344084 1:233034299-233034321 TCTCATGTCTGTTCTCCTGAGGG - Intronic
924729254 1:246696981-246697003 GGGCTTGTCTGTTCCTGTAAGGG - Intergenic
1062782972 10:233264-233286 GCCCTTGTCTGTTCTTCAAACGG - Intronic
1066302850 10:34111841-34111863 GGTTGTGTCTGTTCTGCTTAGGG + Intronic
1067747152 10:48944408-48944430 GGTGATTTCTGTGCTTCTATGGG + Intronic
1070645167 10:78196709-78196731 GTTCAGGTCTGTTCATCTAATGG + Intergenic
1074277465 10:112017684-112017706 TCTCAAGTCTGTTCTTATAAGGG - Intergenic
1075977738 10:126710605-126710627 TGTGGTATCTGTTCTTCTAAGGG - Intergenic
1077516152 11:3003223-3003245 GGGCATGTCTGTTCGTGCAATGG - Intronic
1078005240 11:7527537-7527559 GGACATGTCTGTTCATCTTGTGG - Intronic
1078083554 11:8220497-8220519 GGCCACGTTTGTTGTTCTAACGG - Intergenic
1079072128 11:17356435-17356457 CCTCATGTCTTTTCTTGTAAGGG + Intronic
1079688832 11:23397324-23397346 TGTTATGTTTGTTCTTATAAGGG - Intergenic
1079748104 11:24158517-24158539 AGTCATTTCTTTTCTTCTACTGG - Intergenic
1081117017 11:39215681-39215703 GGTCATGTCTGTTCTTACAAAGG + Intergenic
1084543029 11:69799096-69799118 GGTCAGGGCTGTGCTTCTGAGGG + Intergenic
1087590535 11:100182412-100182434 TTTCATGTCTCTTCTTATAAGGG + Intronic
1088926557 11:114308615-114308637 GGTCATTTCTTTAGTTCTAAAGG - Intronic
1089024174 11:115251139-115251161 GGAGATGTCTGTTCTGCCAAAGG + Intronic
1090511594 11:127381241-127381263 GGTCATGTGTATTTCTCTAACGG + Intergenic
1091685290 12:2557078-2557100 TGTAAGGGCTGTTCTTCTAAGGG + Intronic
1093132192 12:15405007-15405029 TCTCATGTCTCTTCTTATAAAGG + Intronic
1095926890 12:47587501-47587523 GGTAATTTGTGTTCTTGTAATGG - Intergenic
1099408703 12:82295866-82295888 AGTAATTTCTTTTCTTCTAATGG - Intronic
1100650003 12:96575675-96575697 GGTCATATATTTTCTTCTAAGGG + Intronic
1103083141 12:118041273-118041295 TTTCATGTCTCTTCTTCTAAGGG - Intronic
1104705295 12:130940831-130940853 CCTCATGTCTCTTCTTGTAAGGG + Intergenic
1105965542 13:25380816-25380838 GGACTTGTCTGGTCTTCCAAGGG + Intronic
1106774629 13:32996942-32996964 GGTCATGTCTGATTTGCTTAAGG + Intergenic
1112590482 13:100759712-100759734 TCTGATGTCTCTTCTTCTAAGGG + Intergenic
1113278211 13:108758609-108758631 GGTCATGTCTGTTCTTCTAATGG - Intronic
1114948175 14:27713434-27713456 GGTCATGACTTCTGTTCTAAAGG - Intergenic
1115435783 14:33371528-33371550 GGTCATGTCTGTGCTGAGAAAGG + Intronic
1115499928 14:34040340-34040362 TGTCATGTCTTTTCTTATAAGGG - Intronic
1115673652 14:35645173-35645195 GTTCATCTCTCTTCTTATAAGGG + Intronic
1116746073 14:48820953-48820975 GGTCATTTCTTTTCTTCTTCTGG - Intergenic
1119189791 14:72673240-72673262 GGTCATCTCAGTTCTTCTCTGGG + Intronic
1119882547 14:78112478-78112500 TCTCATGTCTCTTCTTATAAGGG - Intergenic
1120649164 14:87110466-87110488 TATCATTTCTGTTCTTCTTAGGG - Intergenic
1121810842 14:96888344-96888366 GGCCCTGTCTGTTCTTGTAGAGG + Intronic
1122368716 14:101215123-101215145 GGTCATAGCTCTTCTTATAAGGG - Intergenic
1123131524 14:105989647-105989669 GGTCATGTGTGTTCTGGTACTGG + Intergenic
1123581758 15:21720833-21720855 GGTCATGTGTGTTCTGGTACTGG + Intergenic
1123618407 15:22163433-22163455 GGTCATGTGTGTTCTGGTACTGG + Intergenic
1125487392 15:40121681-40121703 TGGGATGGCTGTTCTTCTAAAGG - Intergenic
1126642241 15:50840045-50840067 TTTCATGTCTTTTCTTATAAGGG + Intergenic
1127512937 15:59661036-59661058 GGCCATGTGTGTCCTTTTAAGGG - Exonic
1127532063 15:59853040-59853062 TCTCATGTCTCTTCTTATAAGGG + Intergenic
1129955486 15:79632856-79632878 TCTCATGCCTGTTCTTATAAGGG - Intergenic
1131560209 15:93433086-93433108 TGTCATGTCTGTTGTTATAAAGG + Intergenic
1133312219 16:4856109-4856131 GCTCCTGTCTCTTCCTCTAAAGG - Intronic
1137756821 16:50908959-50908981 GTTCATGGCTGGTCTTCTAGAGG + Intergenic
1139130571 16:64138333-64138355 TGTAATGTCTGTGCTTGTAAAGG - Intergenic
1146898705 17:36566160-36566182 GCTCCTGTCTGTTCTTCTGCAGG - Intronic
1148508256 17:48145783-48145805 GGTCATGTCTGTGCTACTCCAGG - Intronic
1152563280 17:81089259-81089281 GGTCCCATCTGTTCTTCTCATGG + Intronic
1152983873 18:304801-304823 GCTCATGTCTCTTCTTATAAGGG + Intergenic
1153408143 18:4763361-4763383 GGTCATGTCTGCTCTTCAGTTGG - Intergenic
1153711563 18:7804966-7804988 GGGCATCTCTTTTCTTTTAAGGG + Intronic
1156552563 18:38033165-38033187 TGAGATGTCTGTTCTTCTTAAGG - Intergenic
1156778092 18:40818379-40818401 GGTCAGGTGTGTTCCTCTAATGG - Intergenic
1157952345 18:52053707-52053729 ATTCATGTCTGTTCTGGTAATGG - Intergenic
1164402778 19:27913102-27913124 AGTCATGCCTGTTCTTTTACAGG + Intergenic
1165829374 19:38722917-38722939 GGTCCTGTCTTTTCTGCTGAGGG + Intronic
1166417706 19:42608697-42608719 GAGAATGTCTGTTCTTCAAAAGG - Intronic
1167878137 19:52431147-52431169 GGCCAAGTCTGTGCTTTTAAGGG + Intronic
1202705661 1_KI270713v1_random:21802-21824 GGTCATATCTTTTCTTGTATTGG - Intergenic
925159162 2:1671206-1671228 GCCCATTTCTGTTCTTTTAATGG - Intronic
926102147 2:10124983-10125005 GGTCATGTCTGCTCTTAGCAAGG + Intronic
929948037 2:46385004-46385026 GTGCATGTCTGTTCTTCTGTAGG + Exonic
932500963 2:72182365-72182387 GGTCATATGTGTCCTTCAAATGG - Intronic
933108144 2:78359750-78359772 GGCCATGTCTGGTATTTTAATGG + Intergenic
933507164 2:83192080-83192102 GCTCATGTCGGTTCTTCTGTTGG + Intergenic
934958290 2:98643621-98643643 GGTCATATCTGTTCTTGGCATGG - Intronic
936793699 2:116182833-116182855 GGTCAAGTCTCTTCTGCTTATGG + Intergenic
936795712 2:116201554-116201576 GGTTATTTCTTTTCTTCTACTGG + Intergenic
939078289 2:137628998-137629020 TTTCATGTCTGTCTTTCTAAGGG + Intronic
940651700 2:156447140-156447162 GGTCTTGTTTGTTTTTGTAATGG - Intronic
941709169 2:168693683-168693705 GCTCATGTCCCTTCTTCTAAGGG + Intronic
941738598 2:169008438-169008460 AGTCATGTGTGTTCTTAAAAGGG - Intronic
944427344 2:199597103-199597125 TCTCATGTCTCTTCTTATAAGGG - Intergenic
945938912 2:215928839-215928861 TCTCCTGTCTCTTCTTCTAACGG - Intergenic
946826032 2:223678896-223678918 GTTCATTATTGTTCTTCTAAAGG + Intergenic
947621076 2:231591560-231591582 GGTCGTGTCTGTGCTTCTCCAGG - Intergenic
948966853 2:241388978-241389000 CCTCATGTCTATTCTTATAAGGG - Intronic
1168896985 20:1330622-1330644 GTTCATGTCTTCTCTTCTATGGG + Intronic
1169281224 20:4268452-4268474 GCTCATGTCTCTTCTTATTAGGG + Intergenic
1170364043 20:15580784-15580806 GGTTATGGCTCTTCTTCTTAGGG + Intronic
1171337911 20:24403077-24403099 GGTCATGACTATTCTTTTCATGG - Intergenic
1173895694 20:46549103-46549125 GGAGATGTCTGTTTTTCTACAGG + Intronic
1174022303 20:47540658-47540680 GGTCTTATCTCTTCTTCTCAAGG + Intronic
1174549267 20:51349901-51349923 GGTCAGAGCTGTTCTCCTAAAGG - Intergenic
1175249782 20:57602258-57602280 GGACATCTCAGTTCTTCTAATGG + Intergenic
1175686386 20:61031465-61031487 GGTCCTCTCTGATATTCTAACGG + Intergenic
1178566556 21:33691792-33691814 TCTGATGTCTGTTCTTATAAGGG + Intronic
1180409008 22:12584803-12584825 GGGCACCTCTGTTCTTCTCAAGG + Intergenic
1182546915 22:31081827-31081849 CCCCATGTCTGTTCTTCTATGGG - Intronic
1182950879 22:34374564-34374586 CCACATTTCTGTTCTTCTAAGGG - Intergenic
1183015085 22:34979578-34979600 GGTCCTGTCTTTTGTTCTAGGGG - Intergenic
951184057 3:19691472-19691494 GGTAATTTCTTTTCTTCTATTGG - Intergenic
952111861 3:30133473-30133495 GCTCATGTCTTTTCGTATAAGGG + Intergenic
952338019 3:32421521-32421543 GGCCATGTCTGCTCTTCATACGG + Intronic
952814414 3:37434822-37434844 GCCCATGTCTGTTATTTTAAAGG + Exonic
958943075 3:100335704-100335726 GGCCATGTCTGTGCTTCCGAGGG - Intronic
964063853 3:152557978-152558000 TCTCATGTCTCTTCTTATAAGGG + Intergenic
966200327 3:177355043-177355065 GGCCATGTCTGTTCTTATAAAGG - Intergenic
966263078 3:178003171-178003193 TGTCATGTCTCTTCATGTAAGGG - Intergenic
968751600 4:2392383-2392405 TGTCATGTTTGTTCTGATAAAGG - Intronic
970490146 4:16563856-16563878 GTTCATGGCTGTTCTTTTAGAGG + Intronic
970506250 4:16733562-16733584 GTTCATGTCTGTGCCTCAAAGGG + Intronic
970689843 4:18610458-18610480 GGTCATGTTTGCTTTTCTATAGG - Intergenic
972114642 4:35616065-35616087 GGTCATGTCTGTGTGTCTGATGG - Intergenic
973021762 4:45211486-45211508 GGTCCTGTAAGTTCTTCTGAAGG + Intergenic
976397718 4:84574163-84574185 TCTCATGTCTGTTCTTCTAAGGG - Intergenic
979461029 4:120984184-120984206 GGTTATTTCTTTTCTTCTGATGG + Intergenic
979784658 4:124700892-124700914 GGTCATGTCTGTTAATCCACTGG + Intronic
980485689 4:133455182-133455204 GATCTTGTCTCTTGTTCTAAGGG + Intergenic
980648055 4:135671021-135671043 GGTGAGATCTGTTCTTCTAGTGG + Intergenic
981447301 4:144854816-144854838 TGTCTTTTCTGTTCTTCTATTGG + Intergenic
981795645 4:148592051-148592073 GGTCATTTCTTTTCTTCTGCTGG + Intergenic
981806780 4:148725110-148725132 CCTCATGTCTCTTCTTTTAAGGG + Intergenic
983013462 4:162579613-162579635 TGTCATTCCTGTTCTTCTAAAGG - Intergenic
983798793 4:171901348-171901370 GTTCATGTATGTTCTTCAGAAGG - Intronic
988792700 5:34623315-34623337 CCTCATGTCTCTTCTTATAAGGG - Intergenic
990139658 5:52688932-52688954 TCTCATGTCTCTTCTTATAAAGG - Intergenic
990718737 5:58669023-58669045 TCTCATGTCTCTTCTTATAAGGG + Intronic
991283832 5:64946859-64946881 TGTCATTACTGTTCTTCTAATGG + Intronic
994112729 5:96025343-96025365 TTTCATGTCTTTTCTTATAAAGG + Intergenic
996050516 5:118927128-118927150 TCTCATGTCTCTTCTTCTAAAGG + Intronic
998851104 5:146351529-146351551 TCTCATGTCTCTTCTTCAAAGGG + Intergenic
1000375069 5:160573177-160573199 TCTCATGTCTTTTCTTATAAGGG - Intronic
1003881519 6:10483615-10483637 TTTCATGTCTGTTTTTCTAATGG + Intergenic
1003930107 6:10916336-10916358 GGTTATTTCTTTTCTTCTACGGG + Intronic
1005430117 6:25747671-25747693 TCTCATGTCTTTTCTTATAAAGG - Intergenic
1005660650 6:27995745-27995767 TGTCATTTCTGTTCTTATAAAGG + Intergenic
1007113316 6:39326273-39326295 GGTAATGACGGTTGTTCTAAGGG + Intergenic
1009198686 6:60718301-60718323 TGTCGTATCTGATCTTCTAAGGG - Intergenic
1009508628 6:64519206-64519228 GGTCTTTTCTACTCTTCTAAAGG - Intronic
1010479621 6:76335384-76335406 GGTTATTTCTTTTCTTCTACTGG + Intergenic
1012510102 6:99992791-99992813 GGGCATGTCTGCTCTGCAAAAGG + Intronic
1014263783 6:119251275-119251297 GGTCAAATCTGCTCTACTAACGG + Intronic
1015387730 6:132644699-132644721 ACTCATGGCAGTTCTTCTAAGGG + Intergenic
1017125465 6:151060385-151060407 GTTGTTGTTTGTTCTTCTAATGG - Intronic
1018856877 6:167681192-167681214 GGTCATCTCTGTTCTTATCAGGG - Intergenic
1021530427 7:21638418-21638440 GGTCATTTCTGCTCTGCTAAGGG + Intronic
1022627845 7:32056418-32056440 TGTCGTTTCTGTTTTTCTAAGGG + Intronic
1023753409 7:43393268-43393290 GGACATGGCTGGTCTTCTCAGGG - Intronic
1024033649 7:45487148-45487170 TATCATGGCTGTTCTTCAAAGGG - Intergenic
1026502175 7:70952235-70952257 AGTCATCTCTGTCCTCCTAACGG - Intergenic
1027693413 7:81376681-81376703 GGTCATTTCTTTTCTTCTGCTGG + Intergenic
1029434366 7:100554045-100554067 GGGCATGTCTGGGATTCTAAGGG + Intronic
1030775116 7:113524951-113524973 GCTCATGACTGTTCTTGTTATGG + Intergenic
1031725681 7:125235269-125235291 TTTCTTGTCTGTTCTTATAAGGG + Intergenic
1032531086 7:132620993-132621015 TCTCATGTCTTTTCTTATAAGGG + Intronic
1035694891 8:1588231-1588253 GTTCATGTCTCTTAATCTAATGG + Intronic
1040670852 8:49688723-49688745 TGTCATTTCTTTTCTTCTGATGG + Intergenic
1041656015 8:60351321-60351343 AGTCATGTCTTTTCTTATAAGGG - Intergenic
1042733199 8:71960079-71960101 GGACATGGTTGGTCTTCTAATGG - Intronic
1042981601 8:74535495-74535517 GGTCCTGGCTGTTTGTCTAAAGG + Intergenic
1044206832 8:89500583-89500605 TCTCATGTCTCTTCTTATAAGGG + Intergenic
1045383688 8:101650974-101650996 GGTCATCTTTTTTCTTCTATAGG + Intronic
1045696187 8:104811145-104811167 TGTCTCTTCTGTTCTTCTAATGG - Intronic
1046366034 8:113234392-113234414 GGTTAAGTCTGGGCTTCTAAAGG - Intronic
1051625146 9:19092123-19092145 GATAATGTCTGTTTTCCTAAAGG - Intronic
1052537399 9:29764270-29764292 GGTTATTTCTGTTCTTCTGCTGG - Intergenic
1052778082 9:32753484-32753506 GGCCCTGTCTGTTCTGCTCATGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055045153 9:71916349-71916371 GGTCATGTATCTTCTTCATAGGG + Intronic
1055630600 9:78219790-78219812 AGTCCTGGCTTTTCTTCTAATGG + Intergenic
1056213137 9:84383710-84383732 GGTCATATCTGTCCCTCTGAAGG + Intergenic
1056776062 9:89513540-89513562 GGTCATCTCTGTCCTTCAGACGG - Intergenic
1056924730 9:90824063-90824085 GGTCATAACTGTTGATCTAATGG + Intronic
1059077371 9:111208167-111208189 GGTTATTTCAGTACTTCTAAGGG + Intergenic
1060315901 9:122510218-122510240 GGTGAAGTCAGATCTTCTAATGG + Intergenic
1187684090 X:21799169-21799191 GGTCAAATGTGTTATTCTAACGG + Intergenic
1188283103 X:28294866-28294888 GCTCATGTCTCTTCTTATAAGGG + Intergenic
1188293483 X:28417279-28417301 AGTCATGTCTGTGATTCCAAGGG - Intergenic
1190150803 X:47945979-47946001 GGTCATCTCTCTTGTTATAATGG - Intronic
1192390933 X:70727720-70727742 TCTCATGTCTTTTCTTATAAGGG - Intronic
1194979446 X:100425355-100425377 TCTCATGTCTCTTCTTATAAGGG - Intergenic
1195556625 X:106234198-106234220 GGTTATTTCTTTTCTTCTGATGG - Intergenic
1195968048 X:110447225-110447247 GGTCATGTCAATTCATCTCATGG + Intronic
1196263984 X:113619817-113619839 TGTCTTGTCTCTTCTTATAAGGG - Intergenic