ID: 1113280017

View in Genome Browser
Species Human (GRCh38)
Location 13:108778836-108778858
Sequence GAGAGGTTCTATGCCAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 671}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113280017_1113280023 20 Left 1113280017 13:108778836-108778858 CCAAGGCTGGCATAGAACCTCTC 0: 1
1: 0
2: 0
3: 34
4: 671
Right 1113280023 13:108778879-108778901 GAGCTTATGGTTAAAGGACTTGG 0: 1
1: 0
2: 0
3: 5
4: 103
1113280017_1113280024 26 Left 1113280017 13:108778836-108778858 CCAAGGCTGGCATAGAACCTCTC 0: 1
1: 0
2: 0
3: 34
4: 671
Right 1113280024 13:108778885-108778907 ATGGTTAAAGGACTTGGCCTTGG 0: 1
1: 0
2: 2
3: 15
4: 230
1113280017_1113280022 14 Left 1113280017 13:108778836-108778858 CCAAGGCTGGCATAGAACCTCTC 0: 1
1: 0
2: 0
3: 34
4: 671
Right 1113280022 13:108778873-108778895 TGACTTGAGCTTATGGTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 121
1113280017_1113280021 7 Left 1113280017 13:108778836-108778858 CCAAGGCTGGCATAGAACCTCTC 0: 1
1: 0
2: 0
3: 34
4: 671
Right 1113280021 13:108778866-108778888 CCTATTATGACTTGAGCTTATGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113280017 Original CRISPR GAGAGGTTCTATGCCAGCCT TGG (reversed) Intronic
900439522 1:2646592-2646614 CAGAAGTTCCATACCAGCCTGGG - Intronic
900555349 1:3277515-3277537 GAGAGGGTCGGGGCCAGCCTGGG - Intronic
901372349 1:8810395-8810417 GAGAAGTTCAAGACCAGCCTGGG + Intronic
902272852 1:15316975-15316997 CAGAGGTTCTAGACCAGCCTGGG + Intronic
902369981 1:15999954-15999976 CAGAAGTTCCTTGCCAGCCTGGG - Intergenic
902402359 1:16165278-16165300 GGCAGGTACTCTGCCAGCCTGGG - Intergenic
902962562 1:19975250-19975272 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
903085388 1:20852924-20852946 CAGGAGTTCAATGCCAGCCTGGG + Intronic
903657896 1:24960056-24960078 GAGGGGTACTAGCCCAGCCTTGG - Intronic
903665338 1:25003694-25003716 GAGGTGTGCTCTGCCAGCCTGGG + Intergenic
903977340 1:27159419-27159441 CAGAGGTTCAAGACCAGCCTGGG + Intronic
904046570 1:27612817-27612839 ATGGGGTTCTAAGCCAGCCTGGG + Exonic
904174607 1:28617799-28617821 CAGAGGTTCAAGACCAGCCTAGG - Intronic
904549732 1:31305648-31305670 CAGAAGTTCGAGGCCAGCCTGGG - Intronic
904572688 1:31478736-31478758 CAGAGGTTCAAGACCAGCCTAGG - Intergenic
904692337 1:32302961-32302983 TAGGAGTTCTAGGCCAGCCTGGG + Intronic
905097284 1:35484362-35484384 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
905140591 1:35840821-35840843 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
905831408 1:41071869-41071891 GAGAAGTTCGAGACCAGCCTTGG - Intronic
906219295 1:44066106-44066128 TAGAAGTTCCAGGCCAGCCTGGG + Intergenic
906222280 1:44090259-44090281 GAGGAGTTCTAGACCAGCCTGGG + Intergenic
906455007 1:45987518-45987540 CAGAGGTTCAAGACCAGCCTGGG - Intronic
906470579 1:46126725-46126747 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
907436746 1:54454555-54454577 GAGGAGTTCTAGACCAGCCTGGG - Intergenic
907775027 1:57505876-57505898 CAGAAGTTCCATACCAGCCTGGG - Intronic
908137009 1:61143597-61143619 CAGAAGTTCTAGACCAGCCTGGG - Intronic
908363014 1:63388373-63388395 AAGATGTTATTTGCCAGCCTGGG - Intronic
908978125 1:69922383-69922405 GAGAGGTACTTTTTCAGCCTTGG - Intronic
909280319 1:73742853-73742875 GAGAGGTTCAAGATCAGCCTGGG + Intergenic
910479504 1:87642936-87642958 GAGAGGTTCTGTAGCAGTCTTGG + Intergenic
911000827 1:93163765-93163787 GAGGGGTTCAAGACCAGCCTGGG + Intronic
911013267 1:93304146-93304168 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
911589375 1:99729019-99729041 GAGAAGTTCCAAGCCAGCCTTGG + Intronic
911630997 1:100183448-100183470 CAGGAGTTCAATGCCAGCCTGGG - Intergenic
911728168 1:101264203-101264225 CAGGGGTTCAATACCAGCCTGGG + Intergenic
912422708 1:109556250-109556272 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
912536286 1:110375038-110375060 GAGGGGTTCAAGACCAGCCTGGG - Intronic
912908093 1:113728698-113728720 GAGAAGTTCAAGACCAGCCTGGG + Intronic
912920091 1:113858264-113858286 TAGGGGTTCTAGACCAGCCTGGG - Intronic
914867957 1:151448651-151448673 CAGAGGTTCGAGACCAGCCTGGG + Intronic
915473994 1:156141794-156141816 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
915772464 1:158442241-158442263 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
917188424 1:172387941-172387963 GGGAGGTTGTATGCCAGGCGCGG + Intronic
917344190 1:174012000-174012022 GAGAAGTTCGAGACCAGCCTGGG + Intronic
917349522 1:174062563-174062585 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
918059515 1:181049192-181049214 GCGAGGTTCTCTGCCATCCATGG - Exonic
918193881 1:182202946-182202968 CAAAGGTTCTCTGCCAGCCTTGG - Intergenic
918246438 1:182663877-182663899 CAGGGGTTCAAGGCCAGCCTGGG - Intronic
918519241 1:185397126-185397148 GACAGGTTCAAGACCAGCCTGGG - Intergenic
918905400 1:190485646-190485668 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
919628236 1:199933730-199933752 GGGAGGTCCCATGCCAACCTAGG - Intergenic
920083766 1:203398582-203398604 CAGAGGTTCGAGACCAGCCTGGG + Intergenic
920337197 1:205252910-205252932 CAGAAGTTCGAGGCCAGCCTGGG + Intronic
921372029 1:214433878-214433900 GAGGGGTTCTAGACCAGCCTGGG + Intronic
921449649 1:215290068-215290090 GAGAGGTTCTTTGCCACCTCTGG + Intergenic
922313879 1:224423538-224423560 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
922444543 1:225685519-225685541 CAGGAGTTCTATACCAGCCTGGG + Intergenic
922513908 1:226192278-226192300 CAGAGGTTCGAGACCAGCCTGGG - Intergenic
922529460 1:226332789-226332811 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
922623765 1:227015767-227015789 GAGAGGTTCTATACCACATTTGG - Intronic
922665127 1:227462086-227462108 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
923215155 1:231842209-231842231 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
923389344 1:233498479-233498501 CAGAGCTTCCATGCCCGCCTTGG - Intergenic
924160566 1:241227522-241227544 CAGAAGTTCAAAGCCAGCCTGGG + Intronic
924713317 1:246549371-246549393 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
1063710584 10:8473954-8473976 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1064055450 10:12093392-12093414 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1064452434 10:15454651-15454673 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1064473710 10:15663776-15663798 CAGGAGTTCTATACCAGCCTGGG - Intronic
1064687893 10:17883335-17883357 CAGAAGTTTTAAGCCAGCCTGGG - Intronic
1065872501 10:29967484-29967506 CAGAAGTTCTAGGCCAGCCTGGG + Intergenic
1065922244 10:30403024-30403046 GAGGAGTTCAAGGCCAGCCTGGG - Intergenic
1066000997 10:31103897-31103919 CAGGAGTTCAATGCCAGCCTGGG + Intergenic
1066080091 10:31921979-31922001 TAGAAGTTCAATGCCACCCTGGG + Intronic
1066104417 10:32144390-32144412 CAGAGGTTTTAGACCAGCCTGGG + Intergenic
1066190556 10:33051714-33051736 CAGAGGTTCAAGACCAGCCTGGG - Intergenic
1066633772 10:37481197-37481219 TAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1067094106 10:43286969-43286991 CAGAGGTTCGAAACCAGCCTGGG + Intergenic
1067317888 10:45186336-45186358 CAGAAGTTCAATACCAGCCTGGG + Intergenic
1068446284 10:57127934-57127956 CAGAAGTTCCATACCAGCCTGGG - Intergenic
1070052207 10:72900246-72900268 CAGGGGTTCGAGGCCAGCCTGGG + Intronic
1070078737 10:73164677-73164699 CAGAAGTTCTAGGCCAGCCTGGG - Intronic
1070220792 10:74442077-74442099 CAGGGGTTCAAGGCCAGCCTAGG + Intronic
1070623592 10:78032858-78032880 CAGAAGTTCGATACCAGCCTGGG - Intergenic
1072112278 10:92333979-92334001 CAGAAGTTCTAGACCAGCCTGGG + Intronic
1072219530 10:93315910-93315932 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
1072445346 10:95494417-95494439 GAGAGGTGCTCAGCCAGGCTTGG - Intronic
1072663168 10:97375165-97375187 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1072669804 10:97420986-97421008 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1072742787 10:97920080-97920102 GAGAAGTTCTCAGCCATCCTAGG + Intronic
1073089024 10:100917783-100917805 CAGGGGTTCAAGGCCAGCCTGGG - Intronic
1073550645 10:104397804-104397826 GAGAGGTTCCATGCCCAACTGGG - Intronic
1073975825 10:109099648-109099670 CAGAGGTTCGAGACCAGCCTGGG + Intergenic
1074343378 10:112656429-112656451 CAAGGGTTCTAGGCCAGCCTGGG - Intronic
1074802905 10:117019631-117019653 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1075135581 10:119782605-119782627 GAGGGGTTCGAGACCAGCCTGGG + Intronic
1075704623 10:124492977-124492999 CAGAGGTTCGAGACCAGCCTGGG + Intronic
1076846131 10:133070347-133070369 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1077535980 11:3124423-3124445 GACACCTTCTCTGCCAGCCTGGG - Intronic
1077773798 11:5249543-5249565 CAGAGGTTCTTTGACAGCTTTGG - Exonic
1077774301 11:5254467-5254489 CAGAGGTTCTTTGACAGCTTTGG - Exonic
1078208843 11:9253692-9253714 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1078241235 11:9532335-9532357 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1079027539 11:16960872-16960894 GAGAGCTGCTTTCCCAGCCTAGG - Intronic
1082663959 11:55950432-55950454 CAGAAGTTCAAAGCCAGCCTGGG - Intergenic
1083905459 11:65666673-65666695 CAGAGGTTCGAGACCAGCCTTGG - Intergenic
1084283538 11:68116359-68116381 CAGGAGTTCTATACCAGCCTGGG + Intronic
1084391793 11:68882175-68882197 GAGGGGTTCAAGACCAGCCTGGG - Intergenic
1084643161 11:70437848-70437870 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
1085078314 11:73611687-73611709 CAGGGGTTCTAGACCAGCCTAGG - Intergenic
1085097306 11:73771821-73771843 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1085113547 11:73910129-73910151 CAGGAGTTCAATGCCAGCCTGGG - Intronic
1085212663 11:74795390-74795412 CAGAGGTTCAAGTCCAGCCTGGG - Intronic
1085226280 11:74924048-74924070 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1085581249 11:77652729-77652751 AAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1086402424 11:86471753-86471775 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1086553086 11:88075670-88075692 GAGGGGTTCAAGGCTAGCCTGGG + Intergenic
1088845866 11:113666488-113666510 CAGAGGTTCAAGACCAGCCTGGG - Intergenic
1089474380 11:118746660-118746682 CAGGGGTTCCAGGCCAGCCTGGG - Intergenic
1090668756 11:128931411-128931433 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1091481653 12:838622-838644 GAGGAGTTCTAGACCAGCCTGGG - Intronic
1091749975 12:3016234-3016256 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1091888669 12:4035046-4035068 GAGATGTTCTATGACTGCATCGG - Intergenic
1092131340 12:6115245-6115267 CAGGAGTTCGATGCCAGCCTGGG - Intronic
1092314873 12:7399811-7399833 CAGGGGTTCTAGACCAGCCTGGG - Intronic
1092392612 12:8094672-8094694 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1092523082 12:9293057-9293079 GAGGAGTTCCATACCAGCCTGGG + Intergenic
1092544209 12:9438840-9438862 GAGGAGTTCCATACCAGCCTGGG - Intergenic
1092829055 12:12426276-12426298 TAGAAGTTCAAAGCCAGCCTCGG - Intronic
1093061528 12:14612226-14612248 GAGTGGTGTTATGCCAGCTTGGG + Intergenic
1094472125 12:30812680-30812702 CAGAGGTTCGAGACCAGCCTGGG - Intergenic
1094577939 12:31705287-31705309 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1094598133 12:31884152-31884174 TAGAAGTTCGAGGCCAGCCTAGG + Intergenic
1095180160 12:39138032-39138054 CAGAGGTTCCATGCCAGTATAGG + Intergenic
1095431210 12:42136978-42137000 CAGAAGTTCTAGACCAGCCTTGG - Intronic
1095888313 12:47211747-47211769 CAGAAGTTCAAAGCCAGCCTGGG + Intronic
1096135707 12:49198586-49198608 CAGATGTTCGAGGCCAGCCTGGG - Intronic
1096734449 12:53641661-53641683 CAGAGGTTCGAGTCCAGCCTGGG + Intronic
1097019843 12:56012612-56012634 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1098259383 12:68652604-68652626 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1099371415 12:81835399-81835421 CAGACGCTCAATGCCAGCCTGGG + Intergenic
1099700360 12:86075414-86075436 CAGACATTCAATGCCAGCCTGGG - Intronic
1100459210 12:94782111-94782133 CAGGAGTTCAATGCCAGCCTGGG - Intergenic
1100473885 12:94917934-94917956 TAGGAGTTCTAGGCCAGCCTAGG + Intronic
1100590454 12:96023422-96023444 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1100764002 12:97843379-97843401 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
1100824648 12:98463145-98463167 CAGGGGTTCTAGGGCAGCCTGGG + Intergenic
1101139584 12:101781455-101781477 CAGAAGTTCTATATCAGCCTGGG + Intronic
1101145116 12:101833289-101833311 GACAGGTTCTAGGCAAGGCTAGG - Intergenic
1101433033 12:104642606-104642628 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1101496096 12:105255718-105255740 CAGGGGTTCTAGACCAGCCTGGG + Intronic
1101951498 12:109179697-109179719 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1101956237 12:109214887-109214909 CAGAGGTTCGAGACCAGCCTGGG + Intronic
1102179454 12:110901434-110901456 CAGGGGTTCGAGGCCAGCCTGGG - Intronic
1102206617 12:111095248-111095270 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
1102525243 12:113507941-113507963 CAGACGTTCTAGACCAGCCTGGG - Intergenic
1102642905 12:114382453-114382475 CAGGGGTTCTAGGCCAGCCTAGG + Intronic
1102996773 12:117357510-117357532 CTGAGGTTCTATCCCAGCTTTGG + Intronic
1103072544 12:117956716-117956738 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
1103436726 12:120932501-120932523 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1104268976 12:127264950-127264972 GAGAGCTTCCATGCCCTCCTTGG + Intergenic
1104483082 12:129125709-129125731 CAGATGTTCAAGGCCAGCCTAGG - Intronic
1104691789 12:130832053-130832075 AAGAAGTTCAAGGCCAGCCTGGG - Intronic
1105319390 13:19303761-19303783 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1105914672 13:24902067-24902089 GAGAGCCTCAGTGCCAGCCTAGG - Intronic
1106294435 13:28397593-28397615 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1106573404 13:30951138-30951160 TAGAGGTTCAAGACCAGCCTGGG + Intronic
1106988472 13:35385488-35385510 CAGAAGTTCTAAACCAGCCTGGG + Intronic
1107388154 13:39935239-39935261 AAGAGGATCTGTGCCAGCCAAGG - Intergenic
1107876768 13:44797714-44797736 AAGAGGTGCTATGCCAGGCATGG + Intergenic
1107911342 13:45108431-45108453 CAAAAGTTCTAGGCCAGCCTGGG - Intergenic
1108066491 13:46582707-46582729 GAGAAGTTCAAGACCAGCCTGGG - Intronic
1108416727 13:50205172-50205194 CAGGGGTTCAACGCCAGCCTGGG - Intronic
1108948442 13:56055275-56055297 CAGAGATTCTACACCAGCCTGGG + Intergenic
1112025674 13:95408840-95408862 TAGAGGTTCAAGACCAGCCTGGG + Intergenic
1112033909 13:95480386-95480408 GAGAGGTTTTCTGCCAGGATTGG - Intronic
1112321693 13:98413702-98413724 GAAAGGTTCTAGGTCAACCTGGG - Intronic
1112580068 13:100670738-100670760 CAGAGGTTCGAGACCAGCCTGGG + Intronic
1113280017 13:108778836-108778858 GAGAGGTTCTATGCCAGCCTTGG - Intronic
1114495981 14:23132506-23132528 CAGAAGTTCAAAGCCAGCCTAGG + Intronic
1114498574 14:23151546-23151568 CAGAAGTTCGAGGCCAGCCTGGG + Intronic
1115785102 14:36816710-36816732 CAGAAGTTCCATACCAGCCTGGG - Intronic
1115974633 14:38982844-38982866 GAGGGGTTCTATGCTATCTTTGG - Intergenic
1116343201 14:43753226-43753248 CAGAGGTTCAAGACCAGCCTAGG - Intergenic
1117184928 14:53230116-53230138 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1117457858 14:55915602-55915624 GAGAGTTTCTATGACAACCATGG + Intergenic
1117536370 14:56706914-56706936 CAGGGGTTCGAGGCCAGCCTAGG - Intronic
1119308409 14:73626617-73626639 CAGAGGTTCAAAACCAGCCTGGG + Intergenic
1120474183 14:84966844-84966866 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
1120659163 14:87231971-87231993 CAGAGGTTCAAGACCAGCCTGGG - Intergenic
1120680147 14:87471367-87471389 GAGGAGTTCAAGGCCAGCCTGGG - Intergenic
1120979881 14:90280152-90280174 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1121073811 14:91050167-91050189 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1121133276 14:91469770-91469792 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1121134305 14:91481122-91481144 CAGAGGTTTGAGGCCAGCCTGGG + Intronic
1121194245 14:92055750-92055772 CAGAAGTTCTAGACCAGCCTGGG + Exonic
1121553136 14:94817523-94817545 GTGAGGTTCCATTCCAGCATAGG - Intergenic
1122213844 14:100190702-100190724 CAGGGGTTCCATACCAGCCTGGG + Intergenic
1122567550 14:102671601-102671623 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1122604059 14:102936699-102936721 GAGGAGTTCAAGGCCAGCCTGGG - Intronic
1122897038 14:104763836-104763858 TAGGGGTTCAAAGCCAGCCTGGG + Intronic
1123022465 14:105407574-105407596 GAGAAGTTCGAGACCAGCCTGGG - Intronic
1123047136 14:105524041-105524063 CAGGAGTTCTATGCCAGCCTGGG - Intergenic
1123492459 15:20792974-20792996 CAGAAGTTCAATACCAGCCTAGG - Intergenic
1123548961 15:21362066-21362088 CAGAAGTTCAATACCAGCCTAGG - Intergenic
1124414073 15:29460036-29460058 GAGAAGTTCAAGACCAGCCTGGG + Intronic
1124586229 15:31011462-31011484 CAGGGGTTCAAGGCCAGCCTAGG - Intronic
1124685881 15:31781579-31781601 GAGAGGTGCTATCTGAGCCTGGG - Intronic
1125665964 15:41430529-41430551 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1125780335 15:42260162-42260184 TAGGAGTTCTATACCAGCCTGGG + Intronic
1125801743 15:42454673-42454695 CAGAAGTTCGAGGCCAGCCTGGG + Intronic
1126346538 15:47700714-47700736 CAGGGGTTCGAGGCCAGCCTGGG + Intronic
1126953437 15:53908528-53908550 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
1127139823 15:55963338-55963360 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1127945989 15:63753963-63753985 CAGAAGTTCGAGGCCAGCCTGGG + Intronic
1128045732 15:64616200-64616222 GAGGAGTTCTAGACCAGCCTGGG - Intronic
1128425256 15:67536579-67536601 TAGAGGTTCGAGACCAGCCTGGG - Intergenic
1129053149 15:72798958-72798980 CAGGAGTTCTAGGCCAGCCTAGG - Intergenic
1129133518 15:73523765-73523787 GAGAGAATCTTTGCCACCCTGGG - Intronic
1129310389 15:74704168-74704190 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1129746721 15:78027008-78027030 TAGAAGTTCAAGGCCAGCCTAGG + Intronic
1129812467 15:78521854-78521876 GAGAAGTTCTATGGCTGCGTGGG + Intronic
1130536283 15:84787201-84787223 GAAAGGTGCCATGCCAGCCTGGG - Intronic
1130561174 15:84960464-84960486 CAGGGGTTCGAGGCCAGCCTGGG - Intergenic
1130621940 15:85472543-85472565 GAGAAGTTTGAGGCCAGCCTGGG - Intronic
1131197302 15:90365855-90365877 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1131453274 15:92563669-92563691 GAAAGATCCTATGCCAGACTGGG + Intergenic
1131889388 15:96956192-96956214 GAGAGGGTTTATGCCATCGTTGG - Intergenic
1132071662 15:98783040-98783062 GAGAAGCTCTCTGCCTGCCTAGG + Intronic
1202957296 15_KI270727v1_random:89287-89309 CAGAAGTTCAATACCAGCCTAGG - Intergenic
1132801426 16:1756302-1756324 GAGAAGTTCAAGACCAGCCTGGG + Intronic
1133379057 16:5314707-5314729 TAGAAGTTCAAGGCCAGCCTAGG - Intergenic
1133509773 16:6446210-6446232 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1133626813 16:7577693-7577715 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1133867684 16:9659321-9659343 GGGAGGTTCGAGACCAGCCTTGG + Intergenic
1133941525 16:10313055-10313077 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1134150810 16:11803272-11803294 CAGGGGTTCGAGGCCAGCCTGGG + Intergenic
1134624286 16:15712918-15712940 GAGAGGTTGCAGTCCAGCCTGGG - Intronic
1134634505 16:15782087-15782109 CAGGGGTTCTAGACCAGCCTGGG - Intronic
1135515941 16:23133865-23133887 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1135594387 16:23730441-23730463 CAGAGGTTCGACACCAGCCTGGG + Intergenic
1135751862 16:25064753-25064775 CAGAGGTTCGAGACCAGCCTGGG - Intergenic
1135783623 16:25328171-25328193 GAGAGGTTCAAGACCAGCCTGGG - Intergenic
1136032964 16:27516839-27516861 CAGAAGTTCTAGACCAGCCTAGG - Intronic
1137350322 16:47708062-47708084 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1138123151 16:54416694-54416716 CAGAAGTTCGAGGCCAGCCTGGG - Intergenic
1139121788 16:64027746-64027768 GAGAGGTTGTGTGCATGCCTGGG - Intergenic
1139862000 16:70030282-70030304 CAGAAGTTCAATACCAGCCTGGG - Intergenic
1140069983 16:71640806-71640828 GAGAGGCTCTATGCCCGCAAGGG + Exonic
1140215222 16:73001602-73001624 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1140524510 16:75611588-75611610 CAGAAGTTCTAGACCAGCCTAGG - Intronic
1140942737 16:79737011-79737033 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1141632319 16:85294957-85294979 GAGACGTTCGAGACCAGCCTGGG - Intergenic
1142403849 16:89874820-89874842 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1142753299 17:2001093-2001115 CAGGAGTTCAATGCCAGCCTGGG - Intronic
1143000559 17:3792328-3792350 GAGGAGTTCAATACCAGCCTGGG - Intronic
1143264632 17:5627147-5627169 CAGGAGTTCTATACCAGCCTGGG - Intergenic
1143322245 17:6075763-6075785 GAGGGGTTCTATCCCTGCCTGGG - Intronic
1143604971 17:7978187-7978209 CAGAAGTTCCAGGCCAGCCTGGG + Intergenic
1143846386 17:9775434-9775456 GGGATGTCCAATGCCAGCCTGGG + Intronic
1143887408 17:10075584-10075606 GAGGAGTTCAATACCAGCCTGGG + Intronic
1144550786 17:16239124-16239146 CAGAAGTTCAAAGCCAGCCTAGG + Intronic
1145291507 17:21550309-21550331 TAGAAGTTCGAGGCCAGCCTGGG + Intronic
1145325259 17:21817276-21817298 GAGGAGTTCTAGACCAGCCTGGG - Intergenic
1146400971 17:32499748-32499770 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1146666170 17:34705403-34705425 CAGAAGTTCAAGGCCAGCCTAGG + Intergenic
1146975020 17:37103826-37103848 CAGGGGTTCAATACCAGCCTGGG + Intronic
1147019965 17:37523366-37523388 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1147592981 17:41697114-41697136 GAGAGGTTCGAGACCAGGCTAGG + Intergenic
1147941189 17:44049484-44049506 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1148072724 17:44917476-44917498 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
1148204942 17:45774312-45774334 CAGAGGTTCTGTTCCAGCCAGGG + Intergenic
1148658542 17:49308383-49308405 CAGAGGTTCGAGACCAGCCTGGG - Intronic
1148841066 17:50497577-50497599 CAGAGGTTCGAGACCAGCCTGGG + Intergenic
1149336065 17:55637450-55637472 CAGAAGTTCGATACCAGCCTGGG + Intergenic
1149395812 17:56241933-56241955 GAGAGGATTCATGCCAGGCTGGG + Intronic
1149621047 17:58045312-58045334 GAGGAGTTCGAGGCCAGCCTGGG + Intergenic
1150233876 17:63576703-63576725 CAGAAGTTCGAGGCCAGCCTGGG + Intronic
1150299150 17:64034174-64034196 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1150370458 17:64633060-64633082 CAGAAGTTCGAGGCCAGCCTGGG + Intronic
1150573587 17:66410063-66410085 GCCAGGTGCTATGCCAGGCTTGG + Intronic
1150738309 17:67759110-67759132 CAGAAGTTCAATGCCAGCCTGGG - Intergenic
1150779273 17:68106632-68106654 GAGAAGTTCAAGACCAGCCTGGG - Intergenic
1151283506 17:73093400-73093422 CAGGGGTTCGAGGCCAGCCTGGG - Intergenic
1151295785 17:73185217-73185239 CAGAAGTTCAATACCAGCCTGGG + Intergenic
1151762850 17:76116394-76116416 CAGGAGTTCTATACCAGCCTGGG - Intronic
1152086979 17:78226217-78226239 GAGAGGATCTATGAAAGCCTTGG - Intergenic
1152243899 17:79175433-79175455 GAGTGACTCCATGCCAGCCTTGG - Intronic
1153603331 18:6805031-6805053 CAGAGGTTCAAGGCCAGCCTGGG - Intronic
1153677651 18:7469665-7469687 CAGGGGTTCCAGGCCAGCCTGGG + Intergenic
1154078999 18:11235526-11235548 CAGAAGTTCGAGGCCAGCCTTGG - Intergenic
1154476257 18:14761758-14761780 CAGAAGTTCAATACCAGCCTGGG - Intronic
1154961846 18:21317163-21317185 CGGAGGTTCAAGGCCAGCCTGGG + Intronic
1154984629 18:21537327-21537349 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1155594354 18:27467647-27467669 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1155959360 18:31980939-31980961 CAGGGGTTCAATACCAGCCTGGG - Intergenic
1156671489 18:39475101-39475123 CAGGAGTTCAATGCCAGCCTGGG - Intergenic
1157254880 18:46130025-46130047 GAGGGGTTCAAGACCAGCCTGGG + Intergenic
1157735555 18:50045600-50045622 GGGCAGTTCTAGGCCAGCCTGGG - Intronic
1158363534 18:56705039-56705061 CAGGAGTTCAATGCCAGCCTGGG - Intronic
1159129588 18:64266002-64266024 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1159271541 18:66159468-66159490 CAGAGCTTCTACTCCAGCCTTGG + Intergenic
1160116165 18:76081583-76081605 GGGAGGTGCTTTTCCAGCCTGGG + Intergenic
1161315387 19:3615023-3615045 CAGATCTTCTCTGCCAGCCTGGG + Intronic
1162353545 19:10166338-10166360 GAGAGGGTCTGTGTGAGCCTGGG - Intronic
1162424052 19:10583424-10583446 CAGAAGTTCTAGACCAGCCTGGG + Intronic
1162568918 19:11459619-11459641 CAGAAGTTCAATACCAGCCTAGG - Intronic
1163350931 19:16776718-16776740 GAGATGTTCAAGACCAGCCTGGG + Intronic
1163367691 19:16885113-16885135 CAGGGGTTCGAGGCCAGCCTGGG - Intergenic
1164549845 19:29200580-29200602 CAGAGGTTCGAGACCAGCCTGGG - Intergenic
1165018810 19:32905926-32905948 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1165241292 19:34470438-34470460 CAGAAGTTCAAGGCCAGCCTGGG + Exonic
1165486555 19:36100046-36100068 GAGGAGTTCAAGGCCAGCCTAGG + Intronic
1165695918 19:37900915-37900937 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1166530757 19:43542004-43542026 CAGAAGTTCGAGGCCAGCCTGGG + Intergenic
1166709785 19:44929312-44929334 AAGGGGCTCTATGCCAGCCTGGG - Intergenic
1166710653 19:44935047-44935069 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
1167056706 19:47115673-47115695 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1167324981 19:48818789-48818811 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1167461497 19:49626825-49626847 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1167568161 19:50270002-50270024 CAGAGGTTCAAGACCAGCCTAGG + Intronic
1167680553 19:50917484-50917506 CAGGGGTTCGAGGCCAGCCTAGG + Intergenic
925089201 2:1139615-1139637 CAGAGGTTCAAGTCCAGCCTGGG + Intronic
926157395 2:10464433-10464455 CAGAGGTTCAAGACCAGCCTGGG - Intergenic
926416381 2:12653622-12653644 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
927113025 2:19877799-19877821 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
927948786 2:27153580-27153602 CAGGGGTTCGAGGCCAGCCTGGG - Exonic
929024967 2:37591669-37591691 CAGGGGTTCTAGACCAGCCTAGG + Intergenic
929527712 2:42721368-42721390 GAGACATTGTATTCCAGCCTGGG - Intronic
929707449 2:44228380-44228402 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
929888167 2:45896873-45896895 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
930710722 2:54548853-54548875 CAGAGAGCCTATGCCAGCCTAGG - Intronic
932240330 2:70151273-70151295 CAGTAGTTCAATGCCAGCCTGGG + Intronic
932420090 2:71596492-71596514 GAGAGGTTCTCTGCCGAGCTTGG + Intronic
933109796 2:78382789-78382811 GGGACGTTCTATGCCATCCATGG - Intergenic
933294329 2:80472212-80472234 GAGAGTTACTATGAGAGCCTAGG + Intronic
933301431 2:80545336-80545358 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
933678839 2:85080710-85080732 CAGAGGTTCAAGACCAGCCTTGG - Intergenic
933829625 2:86196215-86196237 CAGAGGTTCGATACCAGGCTGGG + Intergenic
933837027 2:86254237-86254259 CAGAAGTTCAAAGCCAGCCTGGG - Intronic
933873463 2:86593996-86594018 CAGGAGTTCAATGCCAGCCTGGG - Intronic
934586971 2:95509077-95509099 GAGAAGTTCAAGACCAGCCTAGG - Intergenic
936442557 2:112567585-112567607 CAGAGGTTCAAGACCAGCCTGGG - Intronic
936444571 2:112585688-112585710 CAGGGGTTCAATACCAGCCTCGG + Intronic
936473395 2:112818678-112818700 CAGGGGTTCTAGACCAGCCTGGG + Intergenic
938024940 2:127939502-127939524 CAGGGGTTCGAGGCCAGCCTAGG - Intergenic
938111948 2:128573761-128573783 GAGAGGAGCTCAGCCAGCCTTGG + Intergenic
938400672 2:130988264-130988286 GGGAAGCTCTCTGCCAGCCTTGG + Intronic
938610921 2:132946686-132946708 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
940266768 2:151847169-151847191 CAGAGGTTCAAGACCAGCCTAGG + Intronic
940938086 2:159523192-159523214 CAGGAGTTCTAGGCCAGCCTGGG + Intronic
941891457 2:170585972-170585994 GGGAGGTTGCATTCCAGCCTGGG + Intronic
942427645 2:175876648-175876670 CAGAAGTTCAATACCAGCCTGGG + Intergenic
943270889 2:185802100-185802122 GAGAGGTTTTATGTCATCCAAGG + Exonic
943375801 2:187075253-187075275 GTGAGGTTATATGCCTCCCTGGG + Intergenic
943635982 2:190307461-190307483 CAGAGGTTCGAGGCCAGTCTGGG + Intronic
944124837 2:196281427-196281449 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
944793513 2:203159025-203159047 CAGAGGTTCGAGACCAGCCTGGG - Intronic
945079002 2:206070064-206070086 CAGAAGTTCGAAGCCAGCCTGGG + Intronic
945079406 2:206073721-206073743 TAGAGGTTCGAGACCAGCCTGGG - Intronic
945960844 2:216133382-216133404 CAGAGGTTCCAGGCCAGCCTGGG - Intronic
946028901 2:216689906-216689928 GAGAGGTTATATTCCCACCTTGG - Intronic
947208782 2:227686525-227686547 CAGAGGTTCAAGACCAGCCTGGG - Exonic
947474601 2:230431380-230431402 GTGTGGTGCTGTGCCAGCCTGGG + Intronic
948163128 2:235841418-235841440 CAGGAGTTCTATACCAGCCTGGG + Intronic
1168858852 20:1030284-1030306 GAGATGGGCTCTGCCAGCCTGGG - Intergenic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1168884250 20:1234949-1234971 TAGAGGTTCAAGACCAGCCTGGG - Intronic
1169008899 20:2233240-2233262 CAGAGGTTCGAGACCAGCCTGGG - Intergenic
1169453254 20:5730258-5730280 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1170463777 20:16603985-16604007 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
1170639776 20:18141085-18141107 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1170825425 20:19790584-19790606 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1171472815 20:25385634-25385656 GAGAAGTTCAAGACCAGCCTAGG + Intronic
1172038658 20:32028613-32028635 CAGAGGTTCTAACCCAACCTAGG + Intronic
1172046014 20:32080718-32080740 CAGAAGTTCGAGGCCAGCCTAGG - Intronic
1172237983 20:33391043-33391065 CAGAAGTTCTAGACCAGCCTGGG + Intronic
1172313031 20:33932754-33932776 GAGGGGTTCAGTGCCAGCCCAGG + Intergenic
1172599906 20:36176402-36176424 TAGAGGTTCTATCCCTGCCGAGG + Intronic
1172754295 20:37272594-37272616 CACAGGTTCTAGACCAGCCTGGG - Intergenic
1174466191 20:50719473-50719495 TAGAGGTTCGAGACCAGCCTGGG - Intergenic
1174473831 20:50781857-50781879 CAGAGGTTCAAGGCCAGCGTGGG - Intergenic
1174634453 20:51987011-51987033 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
1174646549 20:52090879-52090901 CAGAAGTTCTAGACCAGCCTGGG + Intronic
1174837648 20:53873478-53873500 GTGAGGCTCTCTGCCAGCCAAGG + Intergenic
1175303156 20:57957182-57957204 GTGAGGTTCTATGCCAGGTTGGG + Intergenic
1176446180 21:6822850-6822872 CAGAAGTTCAATACCAGCCTAGG + Intergenic
1176732734 21:10517155-10517177 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1176824346 21:13687883-13687905 CAGAAGTTCAATACCAGCCTAGG + Intergenic
1177769437 21:25498137-25498159 GAAACGTTCCATTCCAGCCTTGG - Intergenic
1177778604 21:25598390-25598412 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
1178407439 21:32336151-32336173 AAGAGCTTCTATGCAAGCCCTGG + Intronic
1178842888 21:36152100-36152122 CAGGAGTTCAATGCCAGCCTGGG + Intergenic
1179000208 21:37450665-37450687 GAGAGTTCCCAGGCCAGCCTGGG + Intronic
1180864942 22:19112642-19112664 CAGAAGTTCTAAACCAGCCTGGG - Intronic
1180872280 22:19153087-19153109 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
1180904432 22:19398766-19398788 CAGAGGTACAATACCAGCCTAGG + Intronic
1181600737 22:23950359-23950381 CAGGAGTTCTAGGCCAGCCTCGG - Intergenic
1181607776 22:23990960-23990982 CAGGAGTTCTAGGCCAGCCTCGG + Intergenic
1182106774 22:27695331-27695353 GAGAAGTTCAACACCAGCCTGGG + Intergenic
1182348067 22:29680812-29680834 CAGGGGTTCAAAGCCAGCCTGGG + Intronic
1182671296 22:31998058-31998080 TAGGGGTTCCAGGCCAGCCTGGG + Intergenic
1183145365 22:35985832-35985854 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1183725315 22:39585770-39585792 CAGAAGTTCAAAGCCAGCCTGGG - Intronic
1184995141 22:48199842-48199864 GAGAGGTGAGAAGCCAGCCTGGG - Intergenic
1185211643 22:49573793-49573815 CAGAAGTTCTAGACCAGCCTGGG + Intronic
949964466 3:9343875-9343897 TAGAAGTTCGAGGCCAGCCTGGG - Intronic
950062608 3:10084506-10084528 CAGAGGTTCAAGACCAGCCTGGG - Intronic
950564129 3:13755470-13755492 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
950761053 3:15227063-15227085 CAGAGGTTCTAGAGCAGCCTGGG + Intronic
950912838 3:16613073-16613095 CAGAGGTTCCAGGCCAGCCTGGG - Intronic
951360618 3:21720343-21720365 CAGAAGTTCTAAACCAGCCTGGG + Intronic
951623453 3:24632970-24632992 CAGGGGTTCTAGACCAGCCTGGG - Intergenic
952490796 3:33870735-33870757 GAGGAGTTCAAGGCCAGCCTGGG - Intergenic
952794497 3:37226927-37226949 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
952821274 3:37488152-37488174 TAGACGTTCGAGGCCAGCCTGGG - Intronic
953150623 3:40320934-40320956 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
953156613 3:40380945-40380967 CAGGGGTTCAAGGCCAGCCTGGG + Intergenic
954214737 3:49118077-49118099 CAGAGGTTCAAGACCAGCCTGGG + Exonic
955526844 3:59829876-59829898 AAGAGTTTATATGACAGCCTGGG + Intronic
956170534 3:66430449-66430471 GAGAGATTGTTGGCCAGCCTTGG - Intronic
957899341 3:86468482-86468504 GAGAAGTTCAAGACCAGCCTGGG - Intergenic
958984730 3:100767146-100767168 CAGAAGTTCAATACCAGCCTGGG - Intronic
959266667 3:104149261-104149283 CAGAAGTTCAAGGCCAGCCTAGG - Intergenic
960135472 3:114099760-114099782 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
960390601 3:117073230-117073252 GAGAAGTTCCAGACCAGCCTGGG - Intronic
960819275 3:121710628-121710650 CAGAAGTTCTGTACCAGCCTGGG + Intronic
961025256 3:123550098-123550120 CAGGGGTTCTAGACCAGCCTGGG + Intronic
961139908 3:124547206-124547228 CAGAAGTTCGAGGCCAGCCTGGG - Intronic
961601593 3:128066630-128066652 CAGAAGTTCGATACCAGCCTGGG - Intronic
961625166 3:128256951-128256973 CAGGAGTTCTATACCAGCCTGGG - Intronic
961680755 3:128598492-128598514 CAGAAGTTCGAGGCCAGCCTGGG - Intergenic
961812333 3:129529070-129529092 GAGGGCTTCTTTGCCACCCTGGG + Exonic
962185103 3:133249983-133250005 TAGAAGTTCTAGGCCAGCCTGGG - Intronic
962235364 3:133702137-133702159 GAGAGCTTCAATGCCAGATTTGG - Intergenic
962393649 3:134994630-134994652 TAGGAGTTCAATGCCAGCCTGGG - Intronic
962642683 3:137404223-137404245 GAGAGGTTCCATCTCAGCTTAGG - Intergenic
963068490 3:141282542-141282564 GGGAGGTTATATTCTAGCCTGGG - Intronic
963192409 3:142487343-142487365 GAGGAGTTCAAGGCCAGCCTAGG - Intronic
963300961 3:143596868-143596890 GAGGGGTTCAAGACCAGCCTGGG - Intronic
963792416 3:149597385-149597407 TAGAGGTTCGAGACCAGCCTGGG + Intronic
964601795 3:158509573-158509595 CAGAGGTTCAAGGCCAGCCTGGG + Intronic
966535162 3:181024659-181024681 CAGAAGTTCTACACCAGCCTGGG - Intergenic
966599699 3:181762883-181762905 CAGGGGTTCAAGGCCAGCCTGGG - Intergenic
967083572 3:186072899-186072921 GACAGGTTATCTGCCTGCCTTGG - Intronic
967133713 3:186495702-186495724 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
967910828 3:194541370-194541392 GAGGGGTTCGAGACCAGCCTGGG - Intergenic
967911902 3:194549411-194549433 CAGGAGTTCTAGGCCAGCCTGGG + Intergenic
967965220 3:194955436-194955458 CAGGGGTTCGAGGCCAGCCTAGG + Intergenic
968276087 3:197441475-197441497 GAAAGGATGCATGCCAGCCTGGG + Intergenic
968926904 4:3553551-3553573 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
968963663 4:3758452-3758474 GTGAGGTTCCATGCCACGCTTGG - Intergenic
969369095 4:6719969-6719991 CAGAAGTTCGAGGCCAGCCTGGG + Intergenic
969856757 4:10006206-10006228 GAGATGCTCTAAGCCAGTCTTGG - Intronic
970575892 4:17427346-17427368 GAGGAGTTCTAGACCAGCCTGGG - Intergenic
970594404 4:17586746-17586768 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
971399414 4:26262281-26262303 TAGGGGTTCTAGTCCAGCCTGGG - Intronic
971777650 4:30987607-30987629 CAGAAGTTCTAGTCCAGCCTGGG + Intronic
972203337 4:36742055-36742077 CAGAAGTTCGAGGCCAGCCTGGG - Intergenic
972511838 4:39774086-39774108 CAGAAGTTCGATACCAGCCTAGG + Intronic
972561732 4:40234796-40234818 CAGGAGTTCAATGCCAGCCTGGG - Intronic
972588907 4:40465449-40465471 CAGAGGTTCAAGACCAGCCTGGG + Intronic
973318347 4:48784030-48784052 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
973839479 4:54846383-54846405 GAGAGGATCCTTTCCAGCCTGGG - Intergenic
973927961 4:55759049-55759071 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
973928991 4:55770251-55770273 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
974427753 4:61761719-61761741 CAGAAGTTCGATACCAGCCTGGG + Intronic
975130023 4:70823659-70823681 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
975133180 4:70848444-70848466 CAGAGGTTCAAGACCAGCCTGGG - Intergenic
976032162 4:80769600-80769622 CAGAGGTTCCATACCAGCCTAGG - Intronic
976542860 4:86297875-86297897 GAGATCTTCTATGCCATCTTAGG - Intronic
976645822 4:87386409-87386431 CAGGGGTTCAAGGCCAGCCTGGG - Intronic
976676511 4:87709565-87709587 GAGTAGTTCGATACCAGCCTGGG + Intergenic
976777051 4:88718520-88718542 GAGTGGTACTATGCCAGCTTAGG + Intergenic
977234944 4:94496696-94496718 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
977268100 4:94880531-94880553 GAGAAGTTCGAGACCAGCCTGGG - Intronic
977307375 4:95342109-95342131 TAATGGTTCTATGCCAGGCTCGG + Intronic
978127461 4:105151624-105151646 CAGAAGTTCTAGACCAGCCTGGG + Intronic
978512940 4:109541364-109541386 CAGAGGTTCGAGACCAGCCTGGG + Intergenic
978855590 4:113390615-113390637 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
980545481 4:134255935-134255957 GAGAGGTGTTATGCCAGTTTTGG + Intergenic
981250124 4:142591104-142591126 CAGGAGTTCTAAGCCAGCCTTGG + Intronic
981598985 4:146463530-146463552 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
981700156 4:147599205-147599227 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
981964149 4:150580595-150580617 GGGAGGTTATATTCCAGCCCTGG - Intronic
982031943 4:151309779-151309801 CAGAAGTTCTAGGCCAGCCTGGG + Intronic
982252374 4:153420092-153420114 CAGAAGTTCGAGGCCAGCCTGGG + Intergenic
982695225 4:158591538-158591560 GAGAAGTTCAAGACCAGCCTGGG + Intronic
983240860 4:165231238-165231260 GAGGGGTTCAAGACCAGCCTTGG + Intronic
984608563 4:181812714-181812736 GAGAGGTTGGATACCACCCTGGG + Intergenic
984808531 4:183773266-183773288 CAGAGGTTCGAAACCAGCCTGGG + Intergenic
985944623 5:3168336-3168358 CAGGGGTTCTAAACCAGCCTGGG + Intergenic
987054205 5:14176096-14176118 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
987382143 5:17295273-17295295 GAGAGGTTGCACTCCAGCCTGGG - Intergenic
987512060 5:18852509-18852531 GAAGAGTTCTATACCAGCCTGGG + Intergenic
988791067 5:34608236-34608258 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
989331818 5:40268663-40268685 GAAAAGTTCAAGGCCAGCCTAGG + Intergenic
990330729 5:54722966-54722988 CAGGGGTTCTAGACCAGCCTGGG - Intergenic
991389294 5:66125085-66125107 GAGAGGTTGTACTCCAGCCTGGG + Intergenic
991616328 5:68500824-68500846 GAATGTTTCTAGGCCAGCCTTGG - Intergenic
991708417 5:69382848-69382870 CAGAGGTTGTACTCCAGCCTGGG - Intronic
992369215 5:76125847-76125869 CAGAAGTTCTAGACCAGCCTTGG + Intronic
993720724 5:91319214-91319236 CAGAGGTTGTACTCCAGCCTGGG - Intergenic
994132437 5:96246035-96246057 GAGAGGTTCTCTGAGTGCCTGGG - Intergenic
994256090 5:97597899-97597921 AAGATGTTCTATGTAAGCCTCGG - Intergenic
995756329 5:115508543-115508565 GAAAGGTTCAAGACCAGCCTGGG - Intergenic
995858128 5:116615044-116615066 GAGAGCTTCAGTGCCAGGCTGGG + Intergenic
996328434 5:122303141-122303163 GAGAGGATCTAATACAGCCTTGG - Intergenic
997910186 5:137863922-137863944 CAGAAGTTCTAGACCAGCCTGGG + Intergenic
997916260 5:137928776-137928798 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
997971213 5:138403782-138403804 GAGGAGTTCAATTCCAGCCTAGG + Intronic
998124129 5:139604674-139604696 CAGGAGTTTTATGCCAGCCTGGG + Intronic
999159046 5:149480042-149480064 CAGGGGTTCTAGGCTAGCCTGGG + Intergenic
999209629 5:149876712-149876734 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1000567592 5:162868707-162868729 GAGGGGTTCAAGACCAGCCTGGG + Intergenic
1000579293 5:163015443-163015465 GAGATTTTCTATGCCAACTTTGG - Intergenic
1001056984 5:168457784-168457806 CAGAGCTTCCATGCCAGCCATGG - Intronic
1002049777 5:176563973-176563995 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1002631147 5:180579729-180579751 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
1002688679 5:181035778-181035800 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
1002988592 6:2216649-2216671 CAGGAGTTCAATGCCAGCCTGGG + Intronic
1003255690 6:4472900-4472922 GGCAGGTTTTATGCCAGCCTAGG + Intergenic
1004110508 6:12713628-12713650 CAGGGGTTCTAGACCAGCCTGGG + Intergenic
1004718307 6:18240745-18240767 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1004733014 6:18376638-18376660 GAGAAGTTCAAGACCAGCCTGGG + Intergenic
1004741243 6:18463471-18463493 GGGAGGTACCATCCCAGCCTGGG + Intronic
1005038230 6:21577016-21577038 CAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1005318125 6:24624248-24624270 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1005886787 6:30103137-30103159 GAGAGGAGCAACGCCAGCCTGGG - Exonic
1005892924 6:30154536-30154558 GGGAGTTTCTATGCCTTCCTTGG - Intronic
1005920814 6:30399119-30399141 CAGAGGTTCTAGACCAGCCTGGG - Intergenic
1006017798 6:31096144-31096166 GAGGGGTTCAAGACCAGCCTGGG + Intergenic
1006665792 6:35692186-35692208 CAGCGGTTCCAGGCCAGCCTGGG - Intronic
1007044749 6:38761502-38761524 CAGAAGTTCAAAGCCAGCCTGGG - Intronic
1007421928 6:41724748-41724770 GAGGGGTTCTCTGGGAGCCTTGG - Intronic
1007649397 6:43408799-43408821 CAGAGGTTCAAGACCAGCCTGGG + Intergenic
1007728343 6:43930511-43930533 TAGGAGTTCAATGCCAGCCTGGG + Intergenic
1007810957 6:44485384-44485406 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1008770404 6:54971882-54971904 TAGAGCTTCTTTGCCAGCTTTGG - Intergenic
1009976924 6:70681208-70681230 CAGAAGTTCAAGGCCAGCCTTGG + Intronic
1010237527 6:73587913-73587935 CAGGGGTTCGAGGCCAGCCTGGG + Intergenic
1010424551 6:75712894-75712916 CAGGAGTTCTATACCAGCCTGGG + Intronic
1010769935 6:79816831-79816853 CAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1011241905 6:85280771-85280793 GTGGGGTTCAAGGCCAGCCTGGG - Intergenic
1011459396 6:87587980-87588002 GAGACGTTCAAGACCAGCCTGGG - Intronic
1011522321 6:88222250-88222272 GACAGGGACTTTGCCAGCCTTGG - Intergenic
1012899174 6:104987532-104987554 CAGGAGTTCAATGCCAGCCTGGG - Intronic
1013541264 6:111112241-111112263 TAGAGGTTTGAGGCCAGCCTAGG - Intronic
1014029982 6:116690141-116690163 GAGGAGTTCAATACCAGCCTGGG - Intronic
1014032312 6:116719636-116719658 CAGGGGTTCGAGGCCAGCCTGGG + Intronic
1014447756 6:121547909-121547931 CAGAAGTTCAAAGCCAGCCTGGG + Intergenic
1015059088 6:128940741-128940763 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1015376567 6:132516625-132516647 CAGAAGTTCGAGGCCAGCCTAGG + Intergenic
1015974601 6:138776725-138776747 CAGAGGTTCAAGGCCGGCCTGGG - Intronic
1016879580 6:148897697-148897719 CAGGGGTTCAAGGCCAGCCTGGG - Intronic
1017073513 6:150598033-150598055 CAGAAGTTCGAGGCCAGCCTGGG + Intergenic
1019987358 7:4667439-4667461 CAGAGGTTCGAGACCAGCCTGGG + Intergenic
1020051892 7:5087111-5087133 CAGAGGTTCAAGGCCAGCCTGGG + Intergenic
1020231851 7:6325183-6325205 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1020358744 7:7304678-7304700 GATCTGTTCTATGCCAGCTTGGG + Intergenic
1022230073 7:28406022-28406044 GAGAAGTTCTTTGGGAGCCTAGG + Intronic
1022314239 7:29229767-29229789 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1022384094 7:29885600-29885622 CAGGAGTTCTAGGCCAGCCTGGG + Intronic
1022739302 7:33106382-33106404 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1022968740 7:35497916-35497938 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1023079367 7:36513245-36513267 GAGAGGCTCAGTGCCCGCCTTGG + Exonic
1023733733 7:43216861-43216883 CAGGGGTTCGAGGCCAGCCTGGG - Intronic
1024102673 7:46048852-46048874 GAGAGGTTCCAGGCTAGCCCTGG - Intergenic
1025921869 7:65920785-65920807 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
1025971936 7:66334776-66334798 GAGTGGTGTTATGCCAGCTTGGG - Intronic
1026028002 7:66762659-66762681 AAGAAGTTCAAGGCCAGCCTGGG + Intronic
1026085414 7:67259125-67259147 CAGAAGTTCAATCCCAGCCTGGG + Intergenic
1026095909 7:67346531-67346553 GAGAGATTCCATGCCATCCCTGG + Intergenic
1026131753 7:67626765-67626787 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1026333411 7:69372995-69373017 CAGAGGTTTGAGGCCAGCCTGGG + Intergenic
1026911843 7:74095612-74095634 CAGAGGTTTGAGGCCAGCCTGGG - Intronic
1026980276 7:74522489-74522511 CAGAAGTTCTAGACCAGCCTGGG + Intronic
1027180538 7:75936315-75936337 CAGAGGTTCGAGACCAGCCTGGG - Intronic
1027195525 7:76027422-76027444 GAGAAGGTCCATGACAGCCTGGG + Intronic
1027255768 7:76429877-76429899 TGGTGGTACTATGCCAGCCTCGG + Intronic
1027370708 7:77506730-77506752 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1027387957 7:77677159-77677181 GACAGGTGATATGCCCGCCTTGG + Intergenic
1028168688 7:87569122-87569144 CAGAAGTTCAAGGCCAGCCTGGG + Intronic
1028541288 7:91945150-91945172 CAGAGGTTCTAGATCAGCCTGGG + Intronic
1028593505 7:92523988-92524010 CAGAAGTTCAAAGCCAGCCTGGG + Intronic
1029563468 7:101319544-101319566 GAGAGGATCAAAGTCAGCCTGGG + Intronic
1029972009 7:104799256-104799278 GTTAGGTTGTGTGCCAGCCTAGG + Intronic
1030050813 7:105535744-105535766 CAGAAGTTCTAGACCAGCCTAGG - Intronic
1030675148 7:112376944-112376966 CAGGGGTTCGAGGCCAGCCTGGG - Intergenic
1031141773 7:117950440-117950462 CAGAAGTTCGATACCAGCCTGGG - Intergenic
1031691609 7:124794967-124794989 TAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1032137725 7:129296498-129296520 GAGGGGTTCAAGACCAGCCTGGG + Intronic
1032712532 7:134473290-134473312 CAGGAGTTCTAGGCCAGCCTGGG - Intergenic
1033358723 7:140622778-140622800 CAGAAGTTCTAGACCAGCCTGGG - Intronic
1034340179 7:150347733-150347755 GAGGAGTTCAAGGCCAGCCTGGG + Intergenic
1034533716 7:151713782-151713804 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1034831096 7:154308151-154308173 GTGAGTTTCTTTACCAGCCTTGG + Intronic
1035388111 7:158488277-158488299 GTGAGGTTCTGGCCCAGCCTAGG - Intronic
1035787877 8:2276894-2276916 CAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1035804933 8:2444822-2444844 CAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1036215784 8:6878533-6878555 GTGAGGGTCTGGGCCAGCCTGGG + Intergenic
1036584785 8:10113376-10113398 GGGAGGATCTATGGCAGACTGGG + Intronic
1036822522 8:11952052-11952074 CAGAGGTTCGAGACCAGCCTGGG - Intergenic
1037317621 8:17613667-17613689 CAGGAGTTCGATGCCAGCCTGGG + Intronic
1037589924 8:20303886-20303908 GAAAGTTTCTCTGCCCGCCTCGG - Exonic
1037639598 8:20730684-20730706 GAGAGGTTCTTTGTAAACCTAGG + Intergenic
1037940145 8:22945120-22945142 CAGAGGTTCGAGACCAGCCTGGG - Intronic
1038394260 8:27235456-27235478 GAGAGCTTCTTTTCCAGCCATGG + Exonic
1038580207 8:28741660-28741682 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1039003475 8:33007755-33007777 CAGATGTTCTAGGCCAGCCTGGG + Intergenic
1039061892 8:33578429-33578451 CAGAAGTTCAATGCCAGCCTGGG - Intergenic
1039065750 8:33606078-33606100 CAGAAGTTCGAGGCCAGCCTGGG - Intergenic
1039096322 8:33890114-33890136 CAGGAGTTCTAAGCCAGCCTGGG - Intergenic
1039410371 8:37349915-37349937 GATAGCTTGGATGCCAGCCTCGG - Intergenic
1039506916 8:38058873-38058895 CAGAAGTTCAATACCAGCCTGGG + Intronic
1039777907 8:40754802-40754824 CAGAGGTTCGAGACCAGCCTGGG + Intronic
1039990850 8:42486403-42486425 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1040425276 8:47279101-47279123 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1040494110 8:47950772-47950794 GAGGAGTTCAATACCAGCCTGGG + Intronic
1040904570 8:52453072-52453094 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1041228592 8:55726609-55726631 CAGAAGTTCAAGGCCAGCCTAGG + Intronic
1042337862 8:67647382-67647404 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1042696952 8:71564828-71564850 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1043054584 8:75421799-75421821 GAGATGGTCTATGCCAGCAGTGG - Intronic
1043436765 8:80242495-80242517 CAGAAGTTCAATGTCAGCCTGGG + Intergenic
1043471224 8:80565334-80565356 CAGGAGTTCCATGCCAGCCTAGG - Intergenic
1044097243 8:88081539-88081561 TAGAAGTTCCATACCAGCCTGGG + Intronic
1044567656 8:93682463-93682485 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1044857296 8:96489761-96489783 TAGGAGTTCGATGCCAGCCTGGG + Intergenic
1045219657 8:100186277-100186299 CAGAGGTTCGAGACCAGCCTGGG - Intronic
1045220718 8:100197242-100197264 CAGAAGTTCAATCCCAGCCTGGG + Intronic
1045308498 8:100980172-100980194 CAGGAGTTCTATACCAGCCTGGG + Intergenic
1045400029 8:101805514-101805536 TAGAGGTTCTATGCCAGGGAAGG + Intronic
1045560948 8:103262011-103262033 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1046622767 8:116545620-116545642 TAGAAGTTCAATACCAGCCTGGG + Intergenic
1047412226 8:124633100-124633122 CAGAGGTTCGAGACCAGCCTGGG + Intronic
1047489262 8:125361132-125361154 CAGAGGTTGTACTCCAGCCTGGG - Intronic
1048655170 8:136528157-136528179 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1049878323 8:145042737-145042759 CAGGGGTTCTAGACCAGCCTGGG - Intergenic
1049971428 9:825381-825403 CAGGAGTTCTATGCCAGCCTGGG + Intergenic
1050017693 9:1252483-1252505 GAGAGGATTTCTGCCAGACTTGG - Intergenic
1050667428 9:7956538-7956560 GAGAAGTTCGGGGCCAGCCTGGG + Intergenic
1051409668 9:16776346-16776368 CAGAGGTTCGAGACCAGCCTGGG - Intronic
1052319288 9:27150396-27150418 CAGAGGTTCGAGACCAGCCTAGG + Intronic
1052758024 9:32561535-32561557 CAGAGGTTCGAGACCAGCCTGGG - Intronic
1052856799 9:33412205-33412227 CAGGAGTTCAATGCCAGCCTGGG + Intergenic
1054463155 9:65477229-65477251 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1056371980 9:85965417-85965439 GAGGAGTTCGAGGCCAGCCTAGG + Intronic
1056415137 9:86368292-86368314 CAGGGGTTCTAGACCAGCCTGGG + Intergenic
1057526262 9:95804787-95804809 TAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1057718916 9:97517136-97517158 CAGGGGTTCAAGGCCAGCCTGGG + Intronic
1057896895 9:98916469-98916491 CAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1057900157 9:98942457-98942479 GAAAGGGTTCATGCCAGCCTGGG - Intergenic
1058746833 9:107999907-107999929 CAGATGTTCAATACCAGCCTGGG - Intergenic
1058884483 9:109313030-109313052 CAGAAGTTCCAGGCCAGCCTGGG + Intronic
1058913871 9:109546641-109546663 CAGAAGTTCGATACCAGCCTGGG + Intergenic
1058969420 9:110066486-110066508 CAGAAGTTCTAGACCAGCCTGGG + Intronic
1059016044 9:110517250-110517272 AAGAGTTTCAATACCAGCCTGGG + Intronic
1059099931 9:111460953-111460975 TAGTGGTTCCAGGCCAGCCTGGG + Intronic
1059138871 9:111833454-111833476 CAGAGGTTCAAGACCAGCCTGGG - Intergenic
1060117867 9:120958993-120959015 CAGGGGTTCTAGACCAGCCTGGG - Intronic
1060818779 9:126649916-126649938 CAGTGGTTCTCTGCCAGGCTCGG - Intronic
1060971573 9:127741445-127741467 CAGAGGTTCAAGACCAGCCTAGG - Intronic
1061477280 9:130876627-130876649 CAGAAGTTCAAGGCCAGCCTGGG - Intronic
1061515373 9:131086931-131086953 CAGAGGTTCAAGACCAGCCTGGG - Intronic
1061938767 9:133872902-133872924 TAGAAGTTCTAGACCAGCCTGGG + Intronic
1203523013 Un_GL000213v1:61675-61697 CAGAAGTTCAATACCAGCCTAGG - Intergenic
1185534729 X:851898-851920 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1186078529 X:5906557-5906579 GTGAGGTTCCACTCCAGCCTGGG - Intronic
1186428546 X:9484871-9484893 GAGAAGTTCGAGACCAGCCTGGG + Intronic
1186456087 X:9711131-9711153 CAGAGGTTCAAGACCAGCCTGGG + Intronic
1186899827 X:14042262-14042284 CAGAAGTTCGATACCAGCCTGGG - Intergenic
1187141258 X:16596080-16596102 CAGGAGTTCTAGGCCAGCCTGGG - Intronic
1187457168 X:19451853-19451875 CAGGGGTTCTAGACCAGCCTAGG + Intronic
1187511930 X:19927713-19927735 CAGGAGTTCAATGCCAGCCTGGG - Intronic
1187694328 X:21903386-21903408 GAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1187987151 X:24826610-24826632 GTGAGGTTCTATGTGAGCTTGGG - Intronic
1188074545 X:25758996-25759018 AAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1188709981 X:33384076-33384098 CAGAAGTTCTAGACCAGCCTGGG - Intergenic
1189053317 X:37669805-37669827 CAGGTGTTCAATGCCAGCCTGGG - Intronic
1190022416 X:46891206-46891228 GAGGAGTTCAAGGCCAGCCTGGG + Intronic
1190272792 X:48879412-48879434 CAAGAGTTCTATGCCAGCCTGGG + Intergenic
1190361453 X:49653227-49653249 TAGAAGTTCAAGGCCAGCCTGGG - Intergenic
1190784086 X:53626874-53626896 CAGGGGTTCGAGGCCAGCCTGGG - Intronic
1192244156 X:69359241-69359263 GAAAGGTCCAAAGCCAGCCTGGG - Intergenic
1192257446 X:69474352-69474374 CAGGTGTTCTAGGCCAGCCTGGG - Intergenic
1192574288 X:72230391-72230413 GAGAGGTTTTATGGCAGGGTTGG - Intronic
1192765870 X:74138982-74139004 GAGAAGTTCTATGGCAGGGTTGG - Intergenic
1192769603 X:74173629-74173651 CAGAAGTTCAAGGCCAGCCTGGG + Intergenic
1193368193 X:80659738-80659760 GTGATGTTCTATGCCATCTTGGG + Intergenic
1194457432 X:94122726-94122748 CAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1195012695 X:100748820-100748842 CAGAAGTTCGATACCAGCCTGGG + Intergenic
1195911018 X:109888299-109888321 CAGGGGTTCTAGGTCAGCCTGGG + Intergenic
1196461599 X:115937678-115937700 CAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1196601158 X:117603220-117603242 GAGAGGGTCTATTCCTGCCCTGG + Intergenic
1196623614 X:117852606-117852628 GAAAGGTTCTTTGCCAATCTGGG + Intergenic
1197962061 X:132017778-132017800 GAGAGATTCTTTGGAAGCCTGGG - Intergenic
1197981769 X:132224751-132224773 CAGAAGTTCGAGGCCAGCCTGGG - Intergenic
1198866089 X:141124492-141124514 CAGGGGTTCAAGGCCAGCCTGGG - Intergenic
1199498753 X:148485499-148485521 AAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1199712689 X:150481619-150481641 CAGGAGTTCAATGCCAGCCTGGG + Intronic
1200246003 X:154526060-154526082 CAGGGGTTCTAGGCCAGCCTGGG - Intergenic
1200804259 Y:7416063-7416085 CAGGGGTTCTAGACCAGCCTGGG + Intergenic
1200810823 Y:7482738-7482760 CAGGGGTTCAAGGCCAGCCTGGG + Intergenic
1201281092 Y:12342767-12342789 CAGGAGTTCGATGCCAGCCTAGG - Intergenic
1201620252 Y:15948931-15948953 GGGAGGCTCTATGCCAGTCTAGG + Intergenic