ID: 1113286463

View in Genome Browser
Species Human (GRCh38)
Location 13:108854241-108854263
Sequence CAGCACAGGGAGACTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 1, 1: 0, 2: 1, 3: 99, 4: 889}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113286463_1113286471 5 Left 1113286463 13:108854241-108854263 CCCACCACAGTCTCCCTGTGCTG 0: 1
1: 0
2: 1
3: 99
4: 889
Right 1113286471 13:108854269-108854291 ACAGGTGTAAGCCACCACACCGG 0: 9
1: 216
2: 1069
3: 3246
4: 6470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113286463 Original CRISPR CAGCACAGGGAGACTGTGGT GGG (reversed) Intronic
900331663 1:2137842-2137864 CAGCAGAGCGGGGCTGTGGTGGG - Intronic
900510922 1:3060727-3060749 CAGGCCAGGGAGCCTGTGGGTGG + Intergenic
900890904 1:5449026-5449048 GAGCCCGGGGAGCCTGTGGTTGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901847743 1:11994993-11995015 CAGCACTGGGAGGCTGAGGCAGG + Intronic
902314620 1:15608764-15608786 CAGCACTGTGAGACTGAGGTGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903172026 1:21560332-21560354 CAGCACAGGCAGACACTGGCAGG - Intronic
903213869 1:21832640-21832662 GAGGACAGGGAGCCTGTGGCTGG - Intronic
903533866 1:24053512-24053534 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
903847732 1:26288469-26288491 CAGCACTGAGAGAATGAGGTGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904721634 1:32514301-32514323 AATCCCAGGGAGACTGAGGTAGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905187295 1:36205602-36205624 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
905332269 1:37213489-37213511 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
905332414 1:37214611-37214633 CAGCAAAGGGAGATAGGGGTAGG - Intergenic
906049245 1:42857024-42857046 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906467747 1:46098946-46098968 CAGCTCTGGGAGACTGAGGTGGG - Intronic
906526880 1:46498757-46498779 CCGCACATGGACACTGAGGTGGG + Intergenic
906625886 1:47325260-47325282 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
906645200 1:47469865-47469887 CAGCCCAGGGTGACTCTGTTGGG - Intergenic
906729486 1:48069048-48069070 CTGCTCAGGGAAACTGAGGTAGG + Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906936573 1:50219065-50219087 CAGCACAGGGAGACAGGTTTGGG + Intergenic
907362399 1:53929161-53929183 CACCAGGGGGAGACTGGGGTGGG + Intronic
907861088 1:58354119-58354141 TAGCTCAGGGAGACTCTGATAGG + Intronic
908125529 1:61026471-61026493 CAACACTGGGAGACTGAGGCGGG + Intronic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908378572 1:63572801-63572823 CAGCAAAGGGAGATAGGGGTGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909057917 1:70844936-70844958 CAGCACAGGGACCCTGGGCTTGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910003059 1:82360261-82360283 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
910136094 1:83971783-83971805 CAGGACAGGGAGACTGAAGTGGG - Intronic
911041245 1:93592588-93592610 CTGCACATGGGGACTATGGTAGG + Intronic
911125817 1:94339982-94340004 AAGCACAGGGAGCCTGAGATGGG - Intergenic
911317125 1:96369183-96369205 CAGCACTGGGAGACTGAGGCAGG + Intergenic
911510113 1:98801154-98801176 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
912305990 1:108567885-108567907 CTACTCAGGGAGACTGAGGTGGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912815606 1:112825762-112825784 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
912823515 1:112885796-112885818 AGGAACAGGGAGACTGTGGGTGG + Intergenic
913244561 1:116860277-116860299 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
913583559 1:120250766-120250788 CTACACAGTGAGACTGTGGAGGG - Intergenic
913585729 1:120273596-120273618 GAGAACAGGGAGAGAGTGGTAGG + Intergenic
913624617 1:120647554-120647576 CTACACAGTGAGACTGTGGAGGG + Intergenic
914565547 1:148862602-148862624 CTACACAGTGAGACTGTGGAGGG - Intronic
914607278 1:149267650-149267672 CTACACAGTGAGACTGTGGAGGG + Intergenic
914679887 1:149931698-149931720 CAGCGGATGGAGACTGGGGTTGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915064464 1:153213195-153213217 GAGCTGAGGAAGACTGTGGTAGG + Intergenic
915490755 1:156248852-156248874 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
916866540 1:168865766-168865788 CAGCAAAGGGAGATAGGGGTAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917386052 1:174475657-174475679 CAGCTCTGGGAGGCTGAGGTGGG + Intronic
917981930 1:180274890-180274912 TAGCACAAGGTGACTGTGATAGG + Exonic
918567178 1:185948380-185948402 CAGCAAAGGGAGATAGGGGTGGG + Intronic
918568043 1:185953865-185953887 CAGCAAAGGGAGATAGGGGTGGG + Intronic
918914423 1:190616364-190616386 CAGCACAGGGACCCTGGGCTTGG + Intergenic
919091194 1:192980276-192980298 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
919328545 1:196139387-196139409 CTCCACAGGGGGACTGTTGTAGG - Intergenic
919832792 1:201553679-201553701 CAGAACACGGAGACAGTGGGTGG - Intergenic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920436957 1:205953290-205953312 TAGCCCAGGGAGACTGGGGTGGG + Intergenic
920446226 1:206020825-206020847 CAGCACAGGGGGACTCTGGCAGG - Intronic
921724825 1:218512137-218512159 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
921726793 1:218533243-218533265 CAGCACTGGGAGGCTGAGGTGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922598707 1:226833818-226833840 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
922599408 1:226838280-226838302 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
922724371 1:227915587-227915609 GAGCCCAGACAGACTGTGGTGGG - Intergenic
923341088 1:233007784-233007806 CTGCTCAGGGAGGCTGAGGTGGG - Intronic
923499411 1:234551846-234551868 CTGCTCAGGGAGGCTGAGGTGGG - Intergenic
923518870 1:234720792-234720814 CAGGACAGGGTAACTGTGGAAGG - Intergenic
923956759 1:239031139-239031161 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924025206 1:239825051-239825073 CAGCACTGGGTTACAGTGGTGGG + Intronic
924181170 1:241439761-241439783 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
924258999 1:242210746-242210768 CAGCAAAGGGAGATAGGGGTGGG - Intronic
924312925 1:242764193-242764215 AAGCCCAGGGCCACTGTGGTGGG - Intergenic
924489888 1:244526159-244526181 CAGCATTGGGAGGCTGAGGTGGG + Intronic
924743719 1:246813485-246813507 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
924948677 1:248863416-248863438 GAGCACAGGGAGGCCTTGGTCGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063449590 10:6142604-6142626 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064325037 10:14341898-14341920 CAGCACTGGGAGACTGAGGCAGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1064636845 10:17377277-17377299 CAGCAAAGGGAGAGAGGGGTGGG - Intronic
1064637591 10:17385480-17385502 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1065539680 10:26750245-26750267 CAGCACAGGGAGGCTGAGATGGG + Intronic
1065821981 10:29534160-29534182 CAGGACAGGGGGATGGTGGTGGG - Intronic
1066240823 10:33533225-33533247 CAGCGCAGGGAGATAGGGGTGGG - Intergenic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1067526587 10:47042995-47043017 CAGCAGAGGGAGACTGCTGTCGG + Intergenic
1068361145 10:55975965-55975987 CAGCGAAGGGAGATAGTGGTGGG - Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068536843 10:58249330-58249352 CAGCCCTGGGAGGCTGGGGTGGG - Intronic
1068661486 10:59627518-59627540 CAGCACAGGGAGGCTGACGTGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069160227 10:65083908-65083930 CAGCACCGGCAGAGGGTGGTAGG + Intergenic
1069378978 10:67822739-67822761 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1069380533 10:67839680-67839702 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1069787541 10:70998302-70998324 CAGGACAGGGATGCTGTGGCAGG + Intergenic
1070474507 10:76818536-76818558 CAGCGAAGGGAGATAGTGGTGGG - Intergenic
1070589146 10:77789215-77789237 CCCCACATGGAGACTGTGCTGGG - Intergenic
1070640364 10:78164459-78164481 CAGGACAGGGAGGATGGGGTAGG + Intergenic
1071187797 10:83063241-83063263 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1071353617 10:84770985-84771007 CAGCAAGGGGACACTGTGGTTGG + Intergenic
1071547640 10:86540371-86540393 CAGGACAGGGATTCTGAGGTTGG + Intergenic
1071916693 10:90300603-90300625 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1071960762 10:90807616-90807638 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1071961614 10:90813137-90813159 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1072162600 10:92782333-92782355 CAGCACTGGGAGGCTGAGGCCGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072974915 10:100049203-100049225 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1073132791 10:101201102-101201124 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1073466580 10:103697799-103697821 CTGCACAGGGAGAGGCTGGTGGG + Intronic
1073567795 10:104550215-104550237 TAGCACTGGGAGGCTGAGGTGGG - Intergenic
1073683264 10:105727879-105727901 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1075071324 10:119321730-119321752 TAGGGCAGGGGGACTGTGGTGGG - Intronic
1076075858 10:127533425-127533447 CAGCACAGAGGAAGTGTGGTCGG + Intergenic
1076516789 10:131050179-131050201 CAGCAAAGGGAGAGAGGGGTGGG - Intergenic
1076648419 10:131970432-131970454 CACCACAGGGCGCCTGTGCTGGG + Intronic
1076867075 10:133172743-133172765 CAGCACAGGGAGATTTGGGGAGG + Intronic
1077036045 11:494972-494994 CAGCTCACGCAGGCTGTGGTTGG + Exonic
1077397300 11:2331346-2331368 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1077883068 11:6366315-6366337 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1077883875 11:6371537-6371559 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1077937387 11:6802132-6802154 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078216717 11:9318007-9318029 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1078275383 11:9839986-9840008 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1078934912 11:15941712-15941734 CAGCACAGGGAGCCTGGGCAAGG + Intergenic
1080027423 11:27629171-27629193 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1080028263 11:27634578-27634600 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1080136393 11:28859444-28859466 GAGCACAGGGAGACCTTAGTAGG - Intergenic
1080460834 11:32453517-32453539 AAGCACAGGAAGACTGATGTTGG + Intergenic
1080883123 11:36341154-36341176 CAGCACAGGGAGGCTCAGGAAGG - Intronic
1081965375 11:47166108-47166130 CAGCACTGGGAGGCTGAGATGGG - Intronic
1082781938 11:57294735-57294757 CAGCACAGGGGCTCTGTGCTGGG - Intergenic
1083543218 11:63529418-63529440 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1083678302 11:64340160-64340182 CTGCACAGGGTGTCTGTGGCTGG + Intergenic
1084102242 11:66957502-66957524 CAGCACTGGGGGACTGTGGCAGG + Intronic
1084265861 11:68004752-68004774 CTGCAGCGGGAGCCTGTGGTGGG + Intronic
1085001629 11:73042171-73042193 CAACACTGGGAGGCTGAGGTGGG - Intronic
1085126398 11:74005421-74005443 CACCACAGGCAGGATGTGGTAGG - Intronic
1085354915 11:75827361-75827383 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085934759 11:81127367-81127389 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1085987682 11:81806445-81806467 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1085988580 11:81812556-81812578 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1086125088 11:83342081-83342103 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1086132827 11:83419423-83419445 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1086550802 11:88049510-88049532 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087840181 11:102912270-102912292 CAGCAAAGGGAGACAGGTGTGGG - Intergenic
1087932952 11:103999595-103999617 CAGCACTGGGAGATGATGGTTGG - Intronic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088491054 11:110388471-110388493 CACCACAGCGAGACTGGGGGAGG - Intergenic
1090195686 11:124814826-124814848 CAACTCAGGGAGGCTGGGGTGGG - Intergenic
1090628474 11:128626004-128626026 CTGCACAGGGAGTCTGTGTGTGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090926459 11:131254630-131254652 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1091319119 11:134637328-134637350 AGGCACAGAGAGGCTGTGGTGGG + Intergenic
1091530490 12:1350273-1350295 CAGCACTGAGACACAGTGGTGGG + Intronic
1091751621 12:3025188-3025210 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1092396371 12:8130626-8130648 CAGCACGGGGAGGCTGAGGTGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092474950 12:8810457-8810479 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1092510868 12:9154759-9154781 CAGCAGAGGGAGCCTGGGTTTGG + Exonic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092870837 12:12804497-12804519 CAGCACAGAGGGGCTGGGGTTGG - Intronic
1092925138 12:13265219-13265241 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1093400639 12:18742509-18742531 CAGCACTGGGAATCTGCGGTGGG - Intergenic
1093812313 12:23505931-23505953 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094316388 12:29140456-29140478 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094329448 12:29275166-29275188 CAGCGAAGGGAGACAGGGGTGGG + Intronic
1094621190 12:32082040-32082062 CAGCACTGGAAGGCTGAGGTGGG - Intergenic
1094684833 12:32701026-32701048 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1094723688 12:33090522-33090544 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094826611 12:34274134-34274156 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1095096492 12:38152142-38152164 CAGCACAGGGAAAAAGCGGTGGG + Intergenic
1096402450 12:51318506-51318528 CAACACTGGGAGGCTGAGGTGGG - Intronic
1096725098 12:53555071-53555093 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096906657 12:54942640-54942662 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1096907450 12:54948079-54948101 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1097398218 12:59101952-59101974 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1097416562 12:59323287-59323309 CAGCAAAGGGAGACAAGGGTGGG + Intergenic
1097590588 12:61570234-61570256 CAGCACAGGTACTTTGTGGTTGG + Intergenic
1097592894 12:61592809-61592831 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1097690523 12:62730135-62730157 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099291620 12:80783224-80783246 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1099292432 12:80788589-80788611 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1099612943 12:84898091-84898113 CAGCACTGGGAGGCTGAGATGGG + Intronic
1099663520 12:85596750-85596772 CAGCACAGGGATGCTGGGCTTGG + Intergenic
1099872552 12:88368351-88368373 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1100263814 12:92957151-92957173 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1100486403 12:95032344-95032366 CAGCACAAGGAGGCTGAGGCAGG + Intronic
1101520303 12:105475995-105476017 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1101593430 12:106141981-106142003 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1101610494 12:106287023-106287045 CAACACTGGGAGGCTGAGGTGGG + Intronic
1101674968 12:106909207-106909229 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1102110450 12:110361541-110361563 CAGCACTGGCAGGCTGAGGTGGG + Intergenic
1102117068 12:110410804-110410826 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102474854 12:113181903-113181925 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1102479229 12:113209630-113209652 CAGCACTGGGAGGCTAAGGTGGG - Intronic
1102600025 12:114022589-114022611 CAGCAAAGGGAGATAGAGGTGGG - Intergenic
1103293243 12:119864580-119864602 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1103346635 12:120255447-120255469 CAGCACTGGGAGACCGAGGCAGG + Intronic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103637141 12:122316454-122316476 CATCACTGGGAGGCTGAGGTGGG - Intronic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1103825115 12:123731836-123731858 TAGCACAGGCAGGCGGTGGTGGG - Intronic
1104083783 12:125456703-125456725 GAGCACAGAGAGACTGCAGTGGG - Intronic
1104137188 12:125951836-125951858 CAACACTGGGAGGCTGTGGCAGG - Intergenic
1104975957 12:132552086-132552108 CAGAACATGGAGGCTGTGGATGG - Intronic
1106148370 13:27073101-27073123 CACCACATGGAGACTGAGGCTGG + Intronic
1106907700 13:34425778-34425800 AAGCACAGGGAGTCGGGGGTGGG + Intergenic
1107524088 13:41213386-41213408 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1107539165 13:41369865-41369887 AAGCCCAGTGAGACTGTGTTGGG + Intronic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1107858457 13:44638160-44638182 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1108196659 13:48001885-48001907 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108319195 13:49271163-49271185 CAGCACTGGGAGACTGAGGCAGG + Intronic
1108893079 13:55286849-55286871 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1108912937 13:55578327-55578349 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108913759 13:55583737-55583759 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1109498958 13:63213425-63213447 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1109554528 13:63955006-63955028 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1109709181 13:66141433-66141455 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1109709979 13:66146706-66146728 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1110649997 13:77933322-77933344 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1111083086 13:83337759-83337781 CAGCACAGGGATACTGGGCCTGG - Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113448737 13:110390441-110390463 CAGCGCTGGGAGTCTGTGGGTGG + Intronic
1113579063 13:111415513-111415535 GAGCACAGGGAGAATGAGATTGG - Intergenic
1113673859 13:112195061-112195083 CAGCACCAGGAGCCTGGGGTGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113855522 13:113443359-113443381 CAGCACTTGGAGACTGAGGTGGG + Intronic
1113869634 13:113551257-113551279 CAGCACAGGGACACAGTGATAGG - Intronic
1113880080 13:113620068-113620090 CAGCACCGTGAGGCTGGGGTGGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114771288 14:25430641-25430663 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1114883966 14:26824330-26824352 CAGCAAAGGGAGCCTATCGTAGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117124440 14:52606548-52606570 CAGCCCTGGGAGTCTGAGGTGGG - Intronic
1117698908 14:58394465-58394487 CAGCACTGGGAGACCGAGGTGGG - Intergenic
1117850676 14:59965635-59965657 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1118609397 14:67528393-67528415 CAGCCCAGGGAGCCTGTGTGGGG - Intronic
1118933417 14:70264062-70264084 CAGCACAGGGACCCTGGGCTCGG - Intergenic
1119042234 14:71285509-71285531 CAGCCCAGGGATACTGAGTTTGG - Intergenic
1119247872 14:73128552-73128574 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1119480111 14:74953675-74953697 CAGCACACGGAGAGTGGGGCTGG - Intronic
1120250879 14:82061004-82061026 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
1120305121 14:82760252-82760274 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1120618711 14:86736939-86736961 CAGCACAGGGAGATAGGGGTGGG - Intergenic
1120661291 14:87254174-87254196 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1120788783 14:88560620-88560642 CTGCACTGGGATACAGTGGTAGG - Intergenic
1121389136 14:93559492-93559514 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1121704157 14:95978739-95978761 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1121756375 14:96406163-96406185 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1121823714 14:96993105-96993127 CAGCACAGAGAGAGTGAGTTGGG - Intergenic
1121980063 14:98446894-98446916 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1121980835 14:98452317-98452339 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1122507368 14:102240198-102240220 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1122529009 14:102411619-102411641 CAGCAGAGGGAGATAGGGGTGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1123457134 15:20436436-20436458 CAGCACAGAGAGCATGGGGTGGG + Intergenic
1123660928 15:22563923-22563945 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1123975851 15:25553914-25553936 CAGCACTGGGAAGCTGAGGTGGG + Intergenic
1124263288 15:28211589-28211611 CAGCACAGAGAGCATGGGGTGGG + Intronic
1124314729 15:28658157-28658179 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1125046400 15:35246134-35246156 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1125669148 15:41457285-41457307 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1126154346 15:45551338-45551360 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127201333 15:56655451-56655473 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127872116 15:63082433-63082455 CAGCACAGGGAGATCGAGGCAGG + Intergenic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1128370544 15:67036035-67036057 CAGCCTGGGGAGACTGTGGCTGG - Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1130876321 15:88017721-88017743 CAACACAGGGAGCCTGTGCCTGG - Intronic
1131201991 15:90406409-90406431 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1131447368 15:92511646-92511668 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1131830742 15:96353087-96353109 CTGGACAGGGAGATGGTGGTTGG + Intergenic
1132406445 15:101544173-101544195 CAGACCCGGGAGACTGGGGTGGG - Intergenic
1132757353 16:1492418-1492440 CAGCACTGGGAAGCTGAGGTGGG - Intergenic
1132792989 16:1703802-1703824 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1133869943 16:9676921-9676943 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1134150514 16:11801105-11801127 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1134167204 16:11940490-11940512 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134188109 16:12100068-12100090 CAGCATAGGGAGTCCTTGGTGGG + Intronic
1134255036 16:12603496-12603518 CAGCACTGGGGGTCTGTGGGAGG + Intergenic
1134283750 16:12841826-12841848 CAGCTCAGGGAGGCTGAGGCAGG - Intergenic
1134581685 16:15376668-15376690 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135249852 16:20891733-20891755 GAGCACAGGGACACAGTGGCTGG - Intronic
1135292044 16:21248269-21248291 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1135312599 16:21417949-21417971 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135325922 16:21525844-21525866 GGACACAGGGAGACCGTGGTTGG + Intergenic
1135332558 16:21572976-21572998 CAGCACTGGAAGGCTGAGGTGGG + Intergenic
1135365547 16:21850402-21850424 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135446292 16:22520934-22520956 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1136241448 16:28946974-28946996 CAGCACTGGGAGCCTGAGGTGGG - Intergenic
1136309301 16:29396901-29396923 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136322719 16:29498457-29498479 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136437401 16:30238425-30238447 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137421251 16:48336523-48336545 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1138621185 16:58212624-58212646 CAGCACTTGGAGGCTGAGGTGGG + Intergenic
1138805587 16:60085548-60085570 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1139047165 16:63076001-63076023 CAGTACAGGGAGACTGTCTAGGG + Intergenic
1139230097 16:65275359-65275381 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1139524469 16:67505769-67505791 CAACGCTGGGAGACTGAGGTGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139632407 16:68238547-68238569 CAGCACTGGGAGACCGAGGCGGG - Intergenic
1139677883 16:68537803-68537825 TAGCACAGGGAGGCTGAGGAGGG - Intronic
1139825489 16:69754049-69754071 CAGCACTGGGAGACCGAGGCGGG - Intronic
1139840348 16:69873525-69873547 CAGCACAAGGATACAGTGGGTGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140454541 16:75097335-75097357 CAGCCCAGGGAGAATCTGGGGGG + Intronic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141574353 16:84954525-84954547 AAGCCCAGGGAGACTGAGGCTGG + Intergenic
1141793715 16:86254280-86254302 CAGCACCGGGAGGCTGAGGAGGG - Intergenic
1142000114 16:87659473-87659495 CAGCACTGGGAGGTTGAGGTGGG + Intronic
1142038955 16:87880535-87880557 GGACACAGGGAGACCGTGGTTGG + Intergenic
1142217173 16:88835551-88835573 CAGCAGAGGAGGGCTGTGGTGGG - Intronic
1142594608 17:1023378-1023400 CTGCACAGGGAGGCAGTGGTGGG - Intronic
1142698577 17:1646507-1646529 CAGGAGCTGGAGACTGTGGTTGG + Exonic
1142708292 17:1709940-1709962 GCGCACAGGGAGACTGCGGCCGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142983264 17:3683482-3683504 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1143001237 17:3796535-3796557 CAGCACGTGGAGGCTGAGGTTGG + Intronic
1143098234 17:4489899-4489921 CAGCTCTGGGAGGCTGAGGTGGG + Intergenic
1143167786 17:4906604-4906626 CATCACTGGGAGGCTGAGGTAGG + Intergenic
1143642840 17:8209257-8209279 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144104299 17:11972064-11972086 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1144203242 17:12960319-12960341 CAACACTGGGAGGCTGAGGTGGG + Intronic
1144409866 17:14990536-14990558 CACCAGTGGGAGACTGGGGTGGG - Intergenic
1144544975 17:16185823-16185845 CAGGACTGGGAGACTAAGGTGGG + Intronic
1144992625 17:19244210-19244232 CAGCACTGGGAGGCTGAGGCTGG + Intronic
1145024594 17:19458433-19458455 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1145856693 17:28165966-28165988 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1145891943 17:28423261-28423283 CAGGACAGCTAGACTGTGTTTGG - Intergenic
1146165964 17:30588995-30589017 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146334943 17:31961298-31961320 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146597544 17:34183499-34183521 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1147154710 17:38538170-38538192 CAGCACTGGGAGGCTGAGGTGGG + Intronic
1147299570 17:39514838-39514860 GGGCACAAGGAAACTGTGGTGGG - Intronic
1147665946 17:42148160-42148182 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1147752762 17:42746427-42746449 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1147767227 17:42845108-42845130 CAGCACCGGGCGACGGTGATAGG - Exonic
1147820055 17:43236049-43236071 CATCACAGGGAGACAGACGTTGG - Intergenic
1147821369 17:43243448-43243470 CATCACAGGGAGACAGACGTTGG - Intergenic
1147822166 17:43247931-43247953 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823090 17:43253377-43253399 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823860 17:43257977-43257999 CATCACAGGGAGACAGACGTTGG - Intergenic
1147824619 17:43262417-43262439 CATCACAGGGAGACAGACGTTGG - Intergenic
1147827795 17:43280241-43280263 CATCACAGGGAGACAGACGTTGG - Intergenic
1147828903 17:43286402-43286424 CATCACAGGGAGACAGACGTTGG - Intergenic
1147829998 17:43292545-43292567 CATCACAGGGAGACAGACGTTGG - Intergenic
1147834974 17:43323594-43323616 CATCACAGGGAGACAGACGTTGG + Intergenic
1148051239 17:44770866-44770888 CATCACTGGGAGGCTGAGGTGGG + Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1149472862 17:56933251-56933273 CAACACTGGGAGACTGAGGTGGG - Intergenic
1149682867 17:58517900-58517922 CAGGAGAGGGGCACTGTGGTGGG - Exonic
1149930792 17:60753088-60753110 CAGCACTGGGAGGCTGAGATGGG - Intronic
1150136685 17:62699652-62699674 CAGCACTGGGAGGCAGAGGTGGG - Intergenic
1150493432 17:65589819-65589841 CAGCACTGGGAGGCTGAGGCGGG + Intronic
1151310264 17:73288503-73288525 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1151628254 17:75291446-75291468 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
1151706123 17:75768846-75768868 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1151714761 17:75825619-75825641 CAGCACCGGGTGTCTGCGGTAGG + Exonic
1151730863 17:75910362-75910384 CTCCACAGGTAGACTGTTGTGGG - Intronic
1151892510 17:76958998-76959020 CAGCACAGGGAGATTGGGAGAGG - Intergenic
1151898014 17:76993427-76993449 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152192738 17:78898403-78898425 CAGCACAAGGAGACTCTGCTTGG + Intronic
1152322134 17:79613582-79613604 AAACACAGGGAGACTGGGCTTGG + Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1153649590 18:7228340-7228362 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1153834835 18:8954637-8954659 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1153860704 18:9202072-9202094 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1154118480 18:11632603-11632625 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155174376 18:23289923-23289945 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1155892199 18:31284300-31284322 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1156258283 18:35420637-35420659 CAGCACTGGGAGGCTCAGGTGGG + Intergenic
1156938301 18:42737315-42737337 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1157896340 18:51471870-51471892 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1157905920 18:51570162-51570184 CAGCAAGGGGAGACAGGGGTGGG + Intergenic
1158554266 18:58462111-58462133 GAGCCCAGGGAGATTGAGGTTGG + Intergenic
1158577015 18:58646440-58646462 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1158581972 18:58691620-58691642 CAACACTGGGAGTCTGAGGTGGG + Intronic
1158986325 18:62821181-62821203 CAACACTGGGAGGCTGAGGTGGG + Intronic
1159507990 18:69360618-69360640 CAGCACAGGGACCCTGGGCTTGG - Intergenic
1160334016 18:78020827-78020849 CAGCACAGAGAGAATGTAGCTGG - Intergenic
1160709284 19:543596-543618 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1161377864 19:3949461-3949483 CAGCCCATGGAGTCTGTGGAGGG + Intergenic
1161760081 19:6164675-6164697 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1162261733 19:9539648-9539670 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1162263378 19:9550447-9550469 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1162266795 19:9582521-9582543 CAGCAAAGGGAGATAGGGGTCGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162971508 19:14183704-14183726 GAGGACAGGGAGACTGAGGTGGG + Intronic
1163318350 19:16556739-16556761 CAGCCCAGGGTGACCGTGATTGG + Intronic
1163413985 19:17174523-17174545 TACCACAGGGAGGCTGAGGTAGG + Intronic
1163585338 19:18160820-18160842 CAGCAAAGGGAGACTGCAGGGGG + Intronic
1163943937 19:20518933-20518955 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1164080542 19:21858384-21858406 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1164082081 19:21867265-21867287 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1164259261 19:23554930-23554952 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1164925965 19:32130178-32130200 AAACACCGGGAGGCTGTGGTGGG - Intergenic
1165010754 19:32844581-32844603 CAGCACTGGGAGACTGAGGCAGG + Intronic
1165694597 19:37891408-37891430 CAGCACTGGGACGCTGAGGTGGG - Intronic
1165852406 19:38857301-38857323 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166411381 19:42557666-42557688 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1166499305 19:43329054-43329076 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1166793215 19:45410131-45410153 CAGCACTGGGAGGCTGAGGCAGG - Exonic
1167212149 19:48139951-48139973 CAGGTAAGGGGGACTGTGGTTGG - Exonic
1167262536 19:48467278-48467300 CAGCTCAGGGTGTCTGGGGTAGG + Intronic
1167643049 19:50692651-50692673 AAGTTCAAGGAGACTGTGGTGGG - Intronic
1167695801 19:51015156-51015178 AGGCACAGTGAGACTGGGGTTGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
927424802 2:22970291-22970313 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
927915104 2:26930574-26930596 CAGCACTGGGAGGCTGCGGCAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928155009 2:28868764-28868786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
928408948 2:31038990-31039012 CAGCACTGGAAGGCTGAGGTGGG - Intronic
928497571 2:31849578-31849600 CAACACAGGGAGACCGTCTTGGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928923457 2:36551384-36551406 ACGCACAGGAGGACTGTGGTGGG + Intronic
929076197 2:38080901-38080923 CAGCCAAGGGAGACAGGGGTGGG + Intronic
929195562 2:39180933-39180955 CAGCACTGGGAGGCCGAGGTGGG - Intronic
929202162 2:39246989-39247011 CAACACTGGGAGGCTGAGGTGGG - Intergenic
929383230 2:41378137-41378159 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930023623 2:47016318-47016340 CAGCATCAGGAGACTGGGGTTGG + Intronic
930272947 2:49277863-49277885 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
930487629 2:52027290-52027312 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
930718920 2:54620137-54620159 CAGCACAGCGGGAATGTGGTAGG + Intronic
930958003 2:57227520-57227542 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
931170235 2:59795406-59795428 CAGGAGAGAGAGACTGTGTTGGG - Intergenic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
931413504 2:62058525-62058547 CAGCACTGGGAGGCTGAGGTGGG + Intronic
931702744 2:64922407-64922429 CAGCAGGGGCTGACTGTGGTCGG + Intergenic
932158896 2:69443112-69443134 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
932531382 2:72537353-72537375 CAGCACTGGGAGGCTGAGGCAGG + Intronic
932696512 2:73961394-73961416 CAACACAGTGAGACTGTTGTGGG - Intergenic
932854536 2:75219188-75219210 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
933065001 2:77781617-77781639 CAGCACAGGGACCCTGTGCCTGG - Intergenic
933163414 2:79051675-79051697 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
933417580 2:82005960-82005982 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
933447303 2:82398376-82398398 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
934142148 2:89056843-89056865 CAGCAAAGGGAGATAGTGGTGGG - Intergenic
934227093 2:90143703-90143725 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
934569625 2:95360942-95360964 CAGCAAATGGAGACTTTGATGGG + Intronic
935002521 2:99033592-99033614 CAGCACTGGGAGGCTGAGGTGGG + Intronic
935200973 2:100856350-100856372 CAGCATTGGGAGCCTGTGCTCGG - Intronic
935594188 2:104867051-104867073 CACCGCAGGGCGACTGCGGTGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935724968 2:106015741-106015763 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
935872224 2:107463473-107463495 CAACACTGGGAGGCTGAGGTGGG + Intergenic
936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG + Intronic
936115356 2:109698104-109698126 CAGCACAAGGAGGCTGAGGCAGG - Intergenic
936290255 2:111217358-111217380 GAGCACAGGGAGGCTCTGATCGG + Intergenic
936392216 2:112085738-112085760 AAGCTCAGGGAGACAGTGTTCGG + Intronic
936757654 2:115734407-115734429 CAGCACTGGGAGGCCGAGGTGGG + Intronic
936794545 2:116189401-116189423 CAGCAAAGGGAGATAGGGGTAGG + Intergenic
936870540 2:117130872-117130894 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
937028978 2:118722216-118722238 CAGCTCAGGGAGCCTCTGTTGGG - Intergenic
937238371 2:120444110-120444132 CAGGACAGGGGCACTGGGGTGGG + Intergenic
937525591 2:122765071-122765093 CAGCACAGACAGACAGTGGAAGG - Intergenic
937922765 2:127143524-127143546 CAGCACCGGGAGGCTGAGGTGGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938657092 2:133445708-133445730 CAGCACAGGGAGAGTAAGGAAGG + Intronic
938792639 2:134690530-134690552 CAGCACTGGGAGGCTGAGGCTGG - Intronic
939701713 2:145400552-145400574 TTGCATAGGGAGACTGAGGTTGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940726681 2:157343170-157343192 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
941528996 2:166641572-166641594 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
941999946 2:171636185-171636207 CAACACTGGGAGGCTGAGGTGGG - Intergenic
942155161 2:173120623-173120645 GAGCTCAGGGGTACTGTGGTGGG + Intronic
942407505 2:175671198-175671220 CAGCACTGGGAGCCTGAGGCGGG + Intergenic
943196576 2:184759893-184759915 CAGCAAAGGGAGATAGAGGTGGG - Intronic
943460441 2:188166077-188166099 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943951603 2:194136244-194136266 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
944906876 2:204270566-204270588 CAGCAAAGGAAGACAGAGGTGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945362507 2:208908246-208908268 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
945528927 2:210925926-210925948 TAGCACAAGGAGACTGTGGCAGG - Intergenic
945737192 2:213615342-213615364 CAGCACTGGGAGGCTGAGGCGGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946458336 2:219847935-219847957 CTGCTCAGGGACATTGTGGTAGG + Intergenic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
946893750 2:224302240-224302262 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948179962 2:235972023-235972045 CAGCACTGGGAGGCTGAGGTGGG - Intronic
948247959 2:236502328-236502350 CAGCACTGGGTGACTGAGGTGGG + Intronic
948390312 2:237607072-237607094 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948391169 2:237612531-237612553 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948717327 2:239873773-239873795 CAGCACAGGGAAAGGATGGTGGG + Intergenic
948726384 2:239936547-239936569 CAGGACAGGGACACTCTGGTGGG + Intronic
948792799 2:240388059-240388081 CAGGCCAGGGAGGCTGTGGAAGG + Intergenic
1168927084 20:1590735-1590757 CCGCACAGTGAGGCTGTGGCAGG + Intronic
1168994871 20:2125636-2125658 CAGCACAGGCACACTGTGGCAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169239412 20:3962945-3962967 CAACACTGGGAGGCTGAGGTGGG - Intronic
1169325284 20:4670731-4670753 GAGCACAGGGAGAATGGGGGAGG + Intergenic
1169372212 20:5036609-5036631 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
1169858239 20:10126236-10126258 CCCCACAGGGACTCTGTGGTGGG + Intergenic
1170068380 20:12340370-12340392 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1170069179 20:12345609-12345631 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1171201170 20:23243584-23243606 CTCCACATGGGGACTGTGGTGGG + Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171448207 20:25219318-25219340 CAGCACAGGAGGGCTGTGGGGGG + Intronic
1171522076 20:25783669-25783691 CAGCCCAGGGCTCCTGTGGTGGG - Intronic
1171529827 20:25845614-25845636 CAGCCCAGGGCTCCTGTGGTGGG - Intronic
1171554751 20:26072214-26072236 CAGCCCAGGGCTCCTGTGGTGGG + Intergenic
1172391046 20:34565504-34565526 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1172931940 20:38592497-38592519 CAGCAAAGGGAGATGGGGGTGGG + Intergenic
1172932851 20:38598489-38598511 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1174208127 20:48856144-48856166 GAACCCAGGGAGACAGTGGTAGG + Intergenic
1174402968 20:50285768-50285790 CAGCTCCTGGAGACTGAGGTGGG + Intergenic
1174575566 20:51534579-51534601 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1175215550 20:57390242-57390264 CAGCACAGGGCGACGCAGGTGGG - Intergenic
1175989365 20:62780036-62780058 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1176024369 20:62978344-62978366 CAGCAGAGGGAGATGGGGGTGGG - Intergenic
1176230712 20:64031426-64031448 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1177006731 21:15682556-15682578 CAGCAGAGGGAGGTTGTGGTCGG - Intergenic
1177116018 21:17088063-17088085 CAGCAAAGGGAGACAAGGGTGGG - Intergenic
1177349212 21:19913153-19913175 CACCACTGGGAGGCTGAGGTGGG + Intergenic
1178001680 21:28166801-28166823 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1178221798 21:30669025-30669047 CAGCACAGAGACACTGGGCTTGG - Intergenic
1178296892 21:31417716-31417738 CTGCACAGGTAGAGTGTGGCAGG - Intronic
1179041017 21:37802253-37802275 CAGGCCTGGGAGACTGTGGCAGG + Intronic
1179062075 21:37988530-37988552 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1179893002 21:44346595-44346617 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1180137419 21:45870819-45870841 CAGAACAGGATGAGTGTGGTGGG - Intronic
1180782383 22:18528536-18528558 CTGCAGAGGGAAACTGAGGTTGG - Intronic
1181125936 22:20702563-20702585 CTGCAGAGGGAAACTGAGGTTGG - Intergenic
1181239272 22:21467871-21467893 CTGCAGAGGGAAACTGAGGTTGG - Intergenic
1181323349 22:22025637-22025659 CAGCACAAAGAGCCTGGGGTGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182007856 22:26976078-26976100 GAGCTCAGAGAGCCTGTGGTGGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182731950 22:32503062-32503084 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1183046938 22:35227883-35227905 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1183411375 22:37656738-37656760 CAGCACTGGGAGCCTGAGGCAGG + Intronic
1183461121 22:37951300-37951322 CAACACTGGGAGGCTGAGGTGGG - Intronic
1183475902 22:38035632-38035654 CAGCACCTGGAGAGTGAGGTGGG - Intronic
1183574049 22:38675757-38675779 CAGCACAGTGACACAGTGGAAGG + Intergenic
1183602634 22:38848950-38848972 CAGCACTGAGACAGTGTGGTGGG - Intergenic
1183636441 22:39066197-39066219 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1183699244 22:39440962-39440984 CAGCACTGGGAGGCTGAGGTTGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184340890 22:43885316-43885338 CAGATCAGGGAGAGTGGGGTGGG - Intronic
1184441624 22:44520256-44520278 CAGAATTGGGAGACTATGGTTGG - Intergenic
1184700585 22:46169550-46169572 AATAACAGGGAAACTGTGGTGGG + Intronic
1184733656 22:46385341-46385363 CAGCACTGGGAGGCTGAGATGGG - Intronic
1184760716 22:46542538-46542560 CTGCTCAGGGACAGTGTGGTGGG - Intergenic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
949235586 3:1805444-1805466 CAGCTCAGAGAGACTCTGTTTGG - Intergenic
949827911 3:8182593-8182615 CAGCGCAGGGAGATAGGGGTGGG - Intergenic
950348721 3:12325172-12325194 CAACACTGGGAGGCTGAGGTGGG + Intronic
951298349 3:20967642-20967664 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
951299133 3:20972921-20972943 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
951315815 3:21189121-21189143 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
951877338 3:27441732-27441754 CAACACTGGGAGACTGAGGCAGG - Intronic
952343047 3:32461036-32461058 CAGCAAAGGGAGATAGGGGTGGG + Intronic
952541247 3:34370542-34370564 CAGCACAGGGACCCTGGGGCCGG - Intergenic
952819026 3:37470041-37470063 CAGCACTGGGAGGCCGAGGTGGG - Intronic
953177664 3:40566551-40566573 CAGCAAAGGGAGATAGGGGTGGG - Intronic
953833903 3:46326839-46326861 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
953927230 3:46988639-46988661 CAGAACAGGGGAACAGTGGTGGG - Intronic
953991552 3:47487849-47487871 CAGCACTGGGAGGCCGAGGTAGG - Intergenic
954058054 3:48044514-48044536 CAGCACTGGGAGGCCGAGGTGGG + Intronic
954103687 3:48397821-48397843 AAGAACAAGGAGACTGGGGTGGG + Intronic
954185350 3:48912797-48912819 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954436501 3:50499063-50499085 CAACACAGCTTGACTGTGGTGGG - Intronic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
954680278 3:52342190-52342212 CAGGGCAGGGTTACTGTGGTTGG + Intronic
955231048 3:57098897-57098919 CAGGACAGAGAAACTGAGGTTGG + Intronic
956233757 3:67043853-67043875 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
956548476 3:70434773-70434795 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
956709740 3:72028783-72028805 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
956822101 3:72963324-72963346 CAGCACTGGGAGGCTGAGGCGGG + Intronic
956858716 3:73301429-73301451 CAGCACTGGGAGGCTCAGGTGGG - Intergenic
957316344 3:78581313-78581335 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
957317652 3:78588573-78588595 CAGCAGAGGGAGATAGGGGTTGG + Intergenic
957394583 3:79621318-79621340 CAGCAAAGGGAGATAGGGGTGGG - Intronic
957904211 3:86537169-86537191 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
958181857 3:90071419-90071441 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
958416534 3:93881074-93881096 CAGCACTGGGAGGCTGAGGCAGG + Intronic
958421689 3:93938318-93938340 CAGCAAAGGGAGATAGGGGTGGG - Intronic
958940985 3:100314519-100314541 CAGCACTGGGAGGCTGAGGTGGG + Intronic
958945446 3:100356747-100356769 CAGCACATGGAAACTGTTGGGGG - Exonic
959071739 3:101707822-101707844 CAACACTGGGAGGCTGAGGTGGG - Intergenic
959287877 3:104440031-104440053 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959644516 3:108682628-108682650 AAGCACAGGGAGAGGTTGGTTGG + Intronic
959970181 3:112400529-112400551 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
960226220 3:115172328-115172350 CATCACAGGGATAATGTGGTAGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960863066 3:122171398-122171420 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
961343750 3:126247647-126247669 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
961650822 3:128415908-128415930 CAGCACAGGGAACCTTTGGGGGG + Intergenic
961731064 3:128965275-128965297 CAGCAAAGGGAGATAGGGGTGGG - Intronic
961880691 3:130059440-130059462 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
962344119 3:134607417-134607439 TAGCACAGGGTGCCTGTGGGTGG - Intronic
963058261 3:141205185-141205207 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
963059264 3:141211608-141211630 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966055239 3:175678954-175678976 CAGCAAAGGGAGACAGGGATGGG + Intronic
966233084 3:177670782-177670804 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
966276187 3:178172872-178172894 CAGCACTGGGAGGCTGAGGTGGG + Intergenic
966278895 3:178207690-178207712 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967194212 3:187012628-187012650 CAGGACTGAGAGAGTGTGGTGGG - Intronic
967241059 3:187440020-187440042 CAGCAAAGGGAGAGGGTAGTTGG + Intergenic
967496705 3:190150081-190150103 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
968451805 4:679443-679465 CAGCACAGCCCGAGTGTGGTGGG + Intronic
968467883 4:762028-762050 CAGGAGAGGCGGACTGTGGTGGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969339030 4:6528893-6528915 CAGCAAAGGGAGATAGGGGTGGG - Intronic
969653536 4:8482500-8482522 CAGCAAAGGGAGATAGGGGTGGG + Intronic
970028725 4:11653668-11653690 CAGCTAAGGGAGACAGGGGTGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970723589 4:19016639-19016661 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
971103534 4:23496736-23496758 CAGCAAAGGGAGAGCGGGGTGGG - Intergenic
971729638 4:30361050-30361072 CAGCAGTAGGAGGCTGTGGTGGG + Intergenic
971980795 4:33747553-33747575 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
972629505 4:40831149-40831171 CAGCACTGGGAGGCCGAGGTGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972857146 4:43120643-43120665 CAGCACAGGGACCCTGGGCTTGG + Intergenic
973317242 4:48774791-48774813 CGGCACTCGGAGACTGAGGTGGG - Intronic
975221734 4:71820385-71820407 CACCACAGGGGGACTGATGTGGG + Intergenic
975250534 4:72173484-72173506 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
975570839 4:75816209-75816231 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976171604 4:82310583-82310605 CAGCACAGAGAGACTCTATTTGG - Intergenic
976278650 4:83304577-83304599 CAACACTGGGAGGCTGAGGTGGG + Intronic
976782400 4:88775455-88775477 CAGCACTGGGAGGCTGAGGTGGG + Intronic
976966318 4:91045890-91045912 CAGCAAAGGGAGATAGGGGTGGG + Intronic
976983922 4:91268650-91268672 CAGCAAAGGGAGATAGGGGTGGG + Intronic
977799360 4:101207578-101207600 CAGCACTGGGAGGCCGAGGTGGG + Intronic
977823428 4:101502583-101502605 GAGCCCTGGGAGACTGGGGTGGG + Intronic
978031187 4:103941600-103941622 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
978141336 4:105320684-105320706 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978873400 4:113607689-113607711 CAGCAAAGGGAGATAGGGGTGGG - Intronic
978915721 4:114124228-114124250 CAGCACAGGGACCCTGTGCCTGG + Intergenic
979146302 4:117252385-117252407 CAGCAAAGGGAGATAGAGGTGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979641105 4:123013052-123013074 CAGCAAAGGGAGATAGGGGTGGG + Intronic
979850649 4:125567107-125567129 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
980202751 4:129677126-129677148 CAGCACAGGGACACTGGGCCTGG - Intergenic
980680420 4:136152663-136152685 CAGCCCAGTGGGGCTGTGGTTGG - Intergenic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
982015097 4:151145545-151145567 CAGCAAAGGGAGACAGGAGTGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982135708 4:152272330-152272352 CAGTCCAGGGAGTCTGTGGGTGG + Intergenic
982774198 4:159425490-159425512 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
982791358 4:159595294-159595316 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
982932805 4:161429509-161429531 CAGCACAGAAAGACTTTGTTTGG + Intronic
983359535 4:166710314-166710336 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983638281 4:169920063-169920085 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984145806 4:176058718-176058740 CATGACAGAGAGACTGGGGTGGG + Intergenic
984393922 4:179170219-179170241 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
984436955 4:179720810-179720832 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
984700283 4:182814618-182814640 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985511095 5:314271-314293 CAGCACAGGGAGGCGCAGGTGGG - Intronic
985822444 5:2169554-2169576 GAGCACAGGCAGCCTTTGGTGGG + Intergenic
986790663 5:11156430-11156452 CAGCAGAAGGAGCATGTGGTAGG - Intronic
987755459 5:22094939-22094961 CAGCAAAGGGAGATAGGGGTGGG - Intronic
988075168 5:26342973-26342995 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
988599258 5:32624284-32624306 CAGAACAAGTAGACTGTGGTAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990504734 5:56433104-56433126 CAGCAGAGGGAGAGAGGGGTGGG + Intergenic
991068893 5:62455271-62455293 CAGCACTGGGAGGCCGTGGTGGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991379803 5:66008168-66008190 CAACACTGGGAGGCTGAGGTGGG + Intronic
992129124 5:73673923-73673945 CAACACTGGGAGGCTGAGGTGGG + Intronic
992868870 5:80985746-80985768 CAGCACAGGAAGGATGTGGAGGG + Intronic
992960497 5:81953540-81953562 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
992961343 5:81959112-81959134 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
993730739 5:91419605-91419627 CAGCAAAGCAAGAATGTGGTAGG + Intergenic
994325519 5:98441213-98441235 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
994340129 5:98617261-98617283 CAGCACTGGGAGACTGAGGCAGG + Intergenic
994545116 5:101156140-101156162 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
994775373 5:104031995-104032017 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
996509593 5:124304091-124304113 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
997264341 5:132486356-132486378 CAGCACATGGCGACAGTGCTGGG + Exonic
997579416 5:135007931-135007953 CAAGGCAGGGACACTGTGGTAGG - Intronic
998138822 5:139688617-139688639 AAGCACTGGGAGGCTGCGGTAGG - Intergenic
998754854 5:145366052-145366074 CTGCACAGGCAGATTGAGGTAGG - Intergenic
998885615 5:146690979-146691001 CACCAGAGAGAGACTGGGGTAGG + Intronic
999202044 5:149823516-149823538 CAGCTCAGGAAGACTGGGGGTGG + Intronic
999275517 5:150327393-150327415 AAGAACTGGGAGACTGAGGTAGG - Intronic
999473662 5:151878593-151878615 CAGCACAGGGACCCTGGGCTTGG - Intronic
999734273 5:154500964-154500986 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1000885619 5:166744350-166744372 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1000935089 5:167297732-167297754 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1001323903 5:170705554-170705576 CAGAACAGGGGGTCTGTGGGTGG - Intronic
1001335234 5:170791180-170791202 GAGAACAGGGAGCCTGGGGTAGG + Intronic
1001552769 5:172616672-172616694 CAGCACAGAAAGTCAGTGGTGGG - Intergenic
1001890316 5:175333008-175333030 CACAAGAAGGAGACTGTGGTGGG - Intergenic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002107642 5:176888010-176888032 CAACACTGGGAGGCTGAGGTGGG - Intronic
1002172097 5:177380926-177380948 CAGCACTTGGAGGCTGAGGTGGG - Intronic
1002494233 5:179600942-179600964 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1002525946 5:179816392-179816414 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1003100612 6:3173733-3173755 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1003626701 6:7747626-7747648 CAGCACAGGGAGACCCCTGTTGG + Intronic
1003678041 6:8225193-8225215 CAGCAATGGGAGGCTGAGGTGGG - Intergenic
1004768097 6:18754245-18754267 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1004768927 6:18759581-18759603 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1004813826 6:19290399-19290421 CAGCTCAGGGCCACTGTAGTTGG + Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005672581 6:28122326-28122348 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1005786848 6:29252469-29252491 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1006820286 6:36887969-36887991 CAACACTGGGAGGCTGAGGTGGG - Intronic
1007012772 6:38433609-38433631 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1007059208 6:38921858-38921880 CAGCGAAGGGAGACAGGGGTGGG + Intronic
1007460488 6:42014674-42014696 CAGCACTGGGAGGCTGAGGTTGG + Intronic
1008147337 6:47907733-47907755 CAGCACAGGGGAACAGAGGTAGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008621577 6:53276570-53276592 CAGAGCAGGGAGCCTGTGATTGG - Intronic
1009749661 6:67867731-67867753 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1010543553 6:77122861-77122883 CTGCACAGGAAGAGTGGGGTGGG + Intergenic
1010826481 6:80482903-80482925 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1011706139 6:90003281-90003303 AATCACAAGGAGGCTGTGGTGGG - Intronic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1012253666 6:97008177-97008199 CAGCAGAGGGAGGTTGTGGTGGG + Intronic
1013312620 6:108910215-108910237 CAACACTGGGAGGCTGAGGTGGG + Intronic
1014757079 6:125313180-125313202 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1015270120 6:131329014-131329036 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1015801725 6:137066812-137066834 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016113672 6:140257597-140257619 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016373518 6:143397757-143397779 CAACACAGGAAGTCGGTGGTGGG - Intergenic
1016650696 6:146456139-146456161 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016707963 6:147135559-147135581 CTGAACAGTTAGACTGTGGTTGG - Intergenic
1016746909 6:147590657-147590679 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1016750966 6:147630627-147630649 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1017270429 6:152497045-152497067 CAGCAAAGGGAGACAGAGGTGGG - Intronic
1017286596 6:152683271-152683293 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1017307454 6:152935682-152935704 CAGCACTGGGAGGCTGAGGAGGG - Intergenic
1017689273 6:156946779-156946801 AAACACAGGGAAACGGTGGTGGG + Intronic
1017837556 6:158192801-158192823 CAGCTTAGGGAGGCTGAGGTGGG + Exonic
1018232897 6:161692656-161692678 CAGCACTGGGAGGCTGAGGGGGG + Intronic
1018242883 6:161795478-161795500 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1018374213 6:163195686-163195708 CAGCACAGGGAGGCTGAGAGGGG - Intronic
1018441303 6:163815962-163815984 CAGCACAGAGAGCCTGGGGAAGG - Intergenic
1018521002 6:164652241-164652263 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1018521855 6:164657755-164657777 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1019364850 7:628016-628038 CATCACAGGGGGACAGCGGTGGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019632407 7:2056744-2056766 CAGCCCAGGGGGACTGTTGTGGG + Intronic
1019670293 7:2274346-2274368 CAGGACACGGTGACTGTGGAAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1019965316 7:4494094-4494116 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1020014066 7:4820839-4820861 CTGCACAGTGACCCTGTGGTGGG - Intronic
1020303882 7:6817764-6817786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1020315716 7:6904078-6904100 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1020512295 7:9073081-9073103 CAGCACTGGGAGGCTGAGGTAGG - Intergenic
1020540550 7:9457801-9457823 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1020541437 7:9463868-9463890 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1021173322 7:17420639-17420661 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1021393329 7:20121042-20121064 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1021425508 7:20495526-20495548 CTGCACAGGGATACTGTGCACGG + Intergenic
1021636992 7:22703644-22703666 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1021637857 7:22709190-22709212 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022103411 7:27182438-27182460 CAGTAGAGGGAGGGTGTGGTGGG + Exonic
1022789215 7:33670145-33670167 TACCACAGGGAGACAGTGCTTGG - Intergenic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1024738093 7:52327356-52327378 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1025257671 7:57396407-57396429 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1025302153 7:57826566-57826588 CAGCCCAGGGCTCCTGTGGTGGG + Intergenic
1025729546 7:64097842-64097864 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026201493 7:68218394-68218416 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1026315686 7:69225245-69225267 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1026884094 7:73927864-73927886 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1028541282 7:91945112-91945134 CAACACTGGGAGGCTGAGGTGGG + Intronic
1028828467 7:95301529-95301551 CAGAACAGGTAGACGGTGGTGGG - Intronic
1029026062 7:97418169-97418191 TAGCACAGGGAGTATGTGGCTGG - Intergenic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029411928 7:100418542-100418564 CAGCACTGAGAGGCTGAGGTGGG + Intronic
1029498579 7:100912644-100912666 CAGCATTGGGAGGCTGAGGTGGG + Intergenic
1029797184 7:102908747-102908769 CAGAACAGAGAGACTCTGTTTGG - Intronic
1030144721 7:106341481-106341503 CAGCACAGGGACACTGGGCTTGG + Intergenic
1030193166 7:106829949-106829971 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1030865579 7:114698498-114698520 CAGCACAGGGAGAGTAGGGGAGG - Intergenic
1031013559 7:116548646-116548668 CAGCACAAGGAGTTTGGGGTGGG + Intronic
1031018111 7:116597415-116597437 CAGGGAAGGGAGACTGAGGTTGG - Intergenic
1031193145 7:118580830-118580852 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1031296354 7:120009506-120009528 CAGCACAGGGAGATAGGGGTGGG - Intergenic
1031297115 7:120014712-120014734 CAGCGCAGGGAGATAGGGGTGGG - Intergenic
1031928411 7:127660376-127660398 CTTGACTGGGAGACTGTGGTGGG + Intronic
1032390128 7:131550406-131550428 TAGCACTGGGAGGCTGAGGTGGG + Intronic
1032395651 7:131587965-131587987 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033519762 7:142148807-142148829 CAAGACAGGGAGACTTTGATGGG + Intronic
1033943771 7:146688436-146688458 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1034018041 7:147608812-147608834 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1034135604 7:148765517-148765539 CTGCACAGGGAGGCTGAGGCAGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034972990 7:155430772-155430794 CCGCACAGGAAGGCTGTGGAGGG + Intergenic
1036070417 8:5436567-5436589 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
1036472684 8:9064895-9064917 CAGCGAAGGGAGACAGGGGTGGG + Intronic
1037608441 8:20456834-20456856 CAACACTGGGAGGCTGAGGTGGG - Intergenic
1037615355 8:20514245-20514267 GAGGACAGGAATACTGTGGTTGG + Intergenic
1037875801 8:22547556-22547578 CAGCTCAGGTAGACTGCGATGGG - Intronic
1038325601 8:26570490-26570512 CAACACTGGGAGGCTGAGGTGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038883929 8:31641829-31641851 CATCACAGGCAGACTCTGCTTGG - Intronic
1039372789 8:37003519-37003541 CAATGCAGGGAGACTGTGTTGGG - Intergenic
1039403274 8:37291376-37291398 CAGCACAGAGAGTCTGAGGCTGG - Intergenic
1039499261 8:38003800-38003822 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1039671613 8:39606785-39606807 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1039824064 8:41158035-41158057 CAGCTCCTGGAAACTGTGGTTGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040394827 8:46987229-46987251 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040880760 8:52201762-52201784 CAGCCCAGGGAGTCTGAGGACGG - Intronic
1041047029 8:53897264-53897286 CAGCACAAGCAGACTGGGCTAGG + Intronic
1041675773 8:60537924-60537946 CAGCACTGGGAGGCTGAGGTGGG - Intronic
1042307360 8:67345416-67345438 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1042365103 8:67927216-67927238 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1042829957 8:73016004-73016026 CAGCTCTGGGAGGCTGAGGTGGG + Intronic
1042945101 8:74146436-74146458 CAACACAGGGCGACTCTGATGGG - Intergenic
1043721504 8:83550544-83550566 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1043838250 8:85069030-85069052 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1044019081 8:87082321-87082343 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1044690389 8:94871218-94871240 CAGCACCGGGAGGCTGAGATGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045163825 8:99580601-99580623 CAACACTGGGAGGCTGAGGTGGG + Intronic
1045778736 8:105838601-105838623 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1046439733 8:114241931-114241953 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1046440493 8:114246962-114246984 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046772401 8:118129036-118129058 CAACACTGGGAGGCTGAGGTAGG - Intergenic
1047261260 8:123262591-123262613 CAACACAGGGAGGCAGAGGTGGG - Intronic
1048171064 8:132106831-132106853 CAGCAAAGGGTGACTGGGGGTGG + Intronic
1048584955 8:135767292-135767314 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1048804909 8:138231129-138231151 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1049035689 8:140074249-140074271 CAGCCCAGGGACACTGGAGTGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050894278 9:10867134-10867156 AAGCACAGGGAGACTCGGGTGGG + Intergenic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1051306836 9:15718617-15718639 CAGCACAGAGAGACTCTGTTTGG + Intronic
1052291943 9:26852168-26852190 GAGCCCTGGGAGACTGAGGTGGG - Intronic
1052484272 9:29075997-29076019 GTGCACAGAGAGGCTGTGGTGGG - Intergenic
1053028125 9:34748523-34748545 CAGCATAGAGAGACTCTGTTTGG + Intergenic
1053202437 9:36161936-36161958 CAGCACTGGGAGACTGAGGCAGG + Intronic
1053344152 9:37365587-37365609 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1054361201 9:64122187-64122209 CTACACTGGGAGGCTGTGGTAGG + Intergenic
1054903468 9:70393440-70393462 CAGCTCAGGGAGTCTGGGGAGGG - Intronic
1055881446 9:81009362-81009384 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1056060835 9:82884060-82884082 CAGCAAAGGGAAATTGGGGTGGG - Intergenic
1056061633 9:82889368-82889390 CAGCAAAGGGAAATTGGGGTGGG - Intergenic
1056517888 9:87372142-87372164 AATCCCAGGGAGACTGAGGTGGG + Intergenic
1056813142 9:89779981-89780003 TCCCACAGGGAGACTCTGGTGGG + Intergenic
1057228416 9:93304512-93304534 CCCCACAGGGAGACCGAGGTGGG + Intronic
1057337176 9:94165540-94165562 AAGCTCAGGGAGGCTGAGGTGGG + Intergenic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1057523083 9:95775550-95775572 CAGCAGAGGAAGACAGTGTTGGG + Intergenic
1057601039 9:96457379-96457401 CAGCACTTGGACACTGTGCTGGG - Intronic
1057851009 9:98566733-98566755 CTGCTCAGGGAGGCTGAGGTGGG + Intronic
1058425313 9:104870766-104870788 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1058862161 9:109126976-109126998 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
1058964146 9:110020859-110020881 AAGCACTGGGAGGCTGAGGTGGG + Intronic
1059777400 9:117489169-117489191 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1060299036 9:122363274-122363296 CAGCTCAGGGAGGCTGAGGCGGG - Intergenic
1060318767 9:122535847-122535869 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1060924832 9:127449071-127449093 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1060942038 9:127548309-127548331 CAGAGCAGGGGGGCTGTGGTCGG - Intronic
1061510085 9:131055249-131055271 CAGAACAGGGAGACTGGAGGCGG - Intronic
1061675038 9:132210794-132210816 CAGCAGAGGGAGCGTGGGGTGGG + Intronic
1062103035 9:134738309-134738331 CTGCAAAGGGGGCCTGTGGTGGG - Intronic
1062329421 9:136030907-136030929 CAGCACTGCGAGGCTGAGGTGGG - Intronic
1062519294 9:136950975-136950997 CAGGACAGGGAATCTGGGGTGGG + Intronic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1062676034 9:137744564-137744586 CAACACTGGGAGACTGAGGCGGG - Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1185515641 X:697081-697103 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
1185583609 X:1229028-1229050 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1185889177 X:3809245-3809267 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1185907456 X:3949273-3949295 CAGCACTGGGAGGCTGAGGTTGG - Intergenic
1185961047 X:4545974-4545996 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1186116307 X:6308240-6308262 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1186568599 X:10690985-10691007 AATCACAAGGAGACAGTGGTAGG - Intronic
1187104610 X:16228153-16228175 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1187119560 X:16391410-16391432 GAGCAAAGGGAGATTGTGGTTGG - Intergenic
1187400081 X:18951417-18951439 CCGCACAGAGGGACTGTGCTGGG + Intronic
1187950585 X:24466209-24466231 CCGGACAGGGAGAATGTGGGTGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188552369 X:31378051-31378073 CAGCAAAGGGAGACAGGGGTGGG - Intronic
1188819963 X:34763034-34763056 CAGCACAGTGAAACTGATGTAGG + Intergenic
1189413984 X:40798182-40798204 CAACACTGGGAGGCTGAGGTGGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189935835 X:46067316-46067338 CAGCAAAGGGAGATGGGGGTAGG - Intergenic
1190099382 X:47509422-47509444 CAGAACAGTGAGTCTATGGTGGG - Intergenic
1190489718 X:50969541-50969563 CAACATAGCGAGACTGTGGCAGG - Intergenic
1190636151 X:52435911-52435933 CAGCACAGGTAGACTGGGTTTGG + Intergenic
1190824168 X:54001666-54001688 CAGCAAAAGGAGTCTGAGGTGGG + Intronic
1191020862 X:55858757-55858779 CAGCACAGGGACCCTGGGCTTGG + Intergenic
1191244319 X:58213963-58213985 CAGCACTGGGAGGCTGAGGTGGG - Intergenic
1192122773 X:68472828-68472850 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1192730872 X:73801560-73801582 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1192774059 X:74223531-74223553 CAGCACTTGGAGGCTGAGGTGGG - Intergenic
1192914394 X:75637387-75637409 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1193851106 X:86538023-86538045 CAGCAAAGGGAGATAGGGGTAGG - Intronic
1194180436 X:90704967-90704989 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1194344867 X:92751112-92751134 CAGCACTGGCAGAGTGTGCTAGG + Intergenic
1194399234 X:93422385-93422407 CATCTCAGGGACACTGTGATGGG - Intergenic
1194874139 X:99164886-99164908 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1195841140 X:109178671-109178693 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1195841977 X:109184037-109184059 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1196226633 X:113176232-113176254 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196606209 X:117660324-117660346 CAGCACTGGGAGGCTGAAGTGGG - Intergenic
1196774182 X:119323143-119323165 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196922257 X:120595855-120595877 CAGAACAGAGAGACTATGTTTGG + Intronic
1196992305 X:121343997-121344019 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196993015 X:121348369-121348391 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1199073192 X:143502299-143502321 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1200012171 X:153127386-153127408 CCGCACAGGGAGCCTGGAGTAGG + Intergenic
1200027429 X:153272533-153272555 CCGCACAGGGAGCCTGGAGTAGG - Intergenic
1200062561 X:153490077-153490099 CAGCACCAGGAGGCTCTGGTGGG - Intronic
1200546824 Y:4527974-4527996 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1200653208 Y:5867754-5867776 CAGCACTGGCAGAGTGTGCTAGG + Intergenic
1200659962 Y:5945913-5945935 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1201233484 Y:11888585-11888607 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1201240283 Y:11952229-11952251 CAGCACAGGGACATAGGGGTGGG + Intergenic
1201307751 Y:12565071-12565093 CAGCAAAGGGAGATAGAGGTGGG + Intergenic
1201483400 Y:14465816-14465838 CAGCAAAGAGAGACAGGGGTGGG - Intergenic
1201549883 Y:15208798-15208820 GTGCACTGGGAGACTGAGGTGGG - Intergenic
1201725060 Y:17141824-17141846 CAGCAAAGGGAGTTAGTGGTAGG + Intergenic
1201764771 Y:17566544-17566566 CAGCACAGGGAAAAAGCGGTGGG - Intergenic
1201836782 Y:18339446-18339468 CAGCACAGGGAAAAAGCGGTGGG + Intergenic
1202303920 Y:23447605-23447627 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1202366347 Y:24168468-24168490 CACCACAGGGTGACTTTGGGAGG + Intergenic
1202504434 Y:25501655-25501677 CACCACAGGGTGACTTTGGGAGG - Intergenic
1202566890 Y:26222986-26223008 CAGCACTGGGAGGCTGAGGCGGG + Intergenic