ID: 1113294015

View in Genome Browser
Species Human (GRCh38)
Location 13:108938390-108938412
Sequence CTGGGGGTCAGGAGCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 1, 2: 5, 3: 102, 4: 720}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113294006_1113294015 15 Left 1113294006 13:108938352-108938374 CCATGGAATGCACAGTGGTCTGA 0: 3
1: 5
2: 15
3: 27
4: 177
Right 1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG 0: 1
1: 1
2: 5
3: 102
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113294015 Original CRISPR CTGGGGGTCAGGAGCCAGGA AGG Intronic
900012846 1:131538-131560 CTGGGTGTCAGGAGACATGATGG - Intergenic
900042911 1:487525-487547 CTGGGTGTCAGGAGACATGATGG - Intergenic
900064348 1:722522-722544 CTGGGTGTCAGGAGACATGATGG - Intergenic
900208061 1:1439950-1439972 CTGGAGGGCAGGCGCCAGGCGGG - Exonic
900294874 1:1943795-1943817 CTGGAGGTCAGAAGCCAAGACGG + Intronic
900509964 1:3054120-3054142 CTGAGGGTCAGGAGCGAGTGGGG + Intergenic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
901664263 1:10817465-10817487 TAGGGAGGCAGGAGCCAGGAAGG - Intergenic
901741190 1:11343041-11343063 CAGGAGGGGAGGAGCCAGGAGGG + Intergenic
901776417 1:11563368-11563390 CTGGGGGACAGGGACAAGGAAGG + Intergenic
902308999 1:15566207-15566229 CTGGGGGGCAGGTGCCGGGGAGG - Intronic
902548456 1:17205199-17205221 CTGGGAGCCAGGTGACAGGATGG + Exonic
902634863 1:17728656-17728678 GTGGGGGTCAGGGGGCAGGGGGG - Intergenic
902988104 1:20167859-20167881 TTGGGGGTCAGGAGACAGAAGGG - Intronic
903132973 1:21291061-21291083 GGGGGAGTCAGAAGCCAGGAAGG + Intronic
903446615 1:23426301-23426323 GTGGGGCTCAGGAACCTGGAGGG + Intergenic
903588629 1:24437592-24437614 CAGGAGGTCTGGAACCAGGATGG + Intronic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
903767009 1:25741505-25741527 CAGGAGGGCAGGAGCCAGGCTGG - Intronic
904334133 1:29786015-29786037 TTGTGGGTCAGGATCCAAGAAGG + Intergenic
904829033 1:33295023-33295045 CTGGTGGGCAGGAGGCAGGCAGG - Intronic
904924740 1:34038678-34038700 CTGGGGGGCTGGAGCCAGGCAGG - Intronic
904995135 1:34625795-34625817 GTGGTGGTCAGGAGGCAGAAAGG - Intergenic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905611704 1:39358159-39358181 CTGCTGGTCAGGATACAGGAAGG - Intronic
905866512 1:41379779-41379801 CTGGTGGGAAGGAGGCAGGAGGG + Intronic
905869570 1:41395353-41395375 CTGGGAGTGAGGAGCGGGGAGGG - Intergenic
905880407 1:41459729-41459751 CTGGGGCTCAGAGGCAAGGATGG - Intergenic
905885916 1:41491889-41491911 CTGAGGGTCAGAACCCAGGCAGG - Intergenic
905906391 1:41621226-41621248 CTGGGGGCCAGGAGGCTGAAGGG - Intronic
906100288 1:43255951-43255973 CTGGGGATGAGGGGCCAGCAGGG + Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906580234 1:46929997-46930019 CTGGGGGACAGCAGGCAGGTGGG + Exonic
906603491 1:47148893-47148915 CTGGGGGACAGCAGGCAGGTGGG - Exonic
906609125 1:47190041-47190063 CTGGAGGAGAGGAGCTAGGAAGG + Exonic
906651325 1:47515161-47515183 GTGGGGGTCAGGGGACATGATGG + Intergenic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
907250402 1:53134308-53134330 CAGGTGGTCCGGAACCAGGAGGG - Intronic
907278928 1:53332343-53332365 CAGGGGGACAAGAGCCAGGGAGG + Intergenic
907370553 1:54000355-54000377 ATGGGGGTGAGGATCAAGGATGG + Intergenic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
907780373 1:57561125-57561147 CTGGGGGAGAGGAGGCAGGGTGG - Intronic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
908580661 1:65512559-65512581 CAGGGCATCAGGGGCCAGGAAGG + Intronic
909036694 1:70601260-70601282 CTCGGGGGGAGGAGCCAAGATGG - Intergenic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
909812246 1:79944401-79944423 ATGGGGGGGAGGAGCCAAGATGG - Intergenic
910638955 1:89439683-89439705 CTGGGGGAGAGCAGGCAGGATGG + Intergenic
911191403 1:94952382-94952404 ATGGGGGTGAGGTGCCATGAGGG - Intergenic
912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG + Intergenic
914408546 1:147402381-147402403 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
914754264 1:150553968-150553990 CTGAGGGTCAGGCTCCAGGCGGG - Exonic
914830853 1:151169872-151169894 CTGGGGATCAGCAGGCAGGGAGG - Exonic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
915325000 1:155077276-155077298 CTGGGGATGAGGAGCCTGCAGGG + Intergenic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915555771 1:156659959-156659981 CTGGGGGTTAGGCCGCAGGAAGG + Intergenic
915633675 1:157171764-157171786 TGGGGGGTCAGGAACCAGGAAGG + Intergenic
915657945 1:157377070-157377092 GAGGGGGTCAGGAACCAGGTAGG + Intergenic
915671120 1:157489901-157489923 GAGGGGGTCAGGAACCAGGAAGG - Intergenic
915996765 1:160571668-160571690 CTGGGGGGGAGGAGCTAGGGAGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
917512720 1:175681579-175681601 CTGGAGGGCAGGAGACAGGAAGG - Intronic
919758039 1:201078140-201078162 CTGGGAGTCAGGAGAAGGGAAGG - Intronic
919780457 1:201217497-201217519 CTGGGATCCTGGAGCCAGGAGGG - Intronic
919787540 1:201269382-201269404 CTGGTATTCAGGAGCCATGACGG - Intergenic
919837330 1:201583842-201583864 CTGGGGGAGAGGAGCCAGTCAGG + Intergenic
920251034 1:204622607-204622629 ATGGGGGTCAGGAAGCAGGGAGG + Intronic
920415065 1:205793569-205793591 CTGGGGGTGAGGGGGCTGGAGGG + Intronic
920647487 1:207814179-207814201 CTGGGAGTCAGGAGGCAGCATGG - Intergenic
922099247 1:222468534-222468556 CTGGGTGTCAGGAGACATGATGG - Intergenic
922261285 1:223948028-223948050 CTGGGTGTCAGGAGACATGATGG - Intergenic
922735787 1:227977712-227977734 CTGGGTGTCAGGAGACATGATGG + Intergenic
922802826 1:228371946-228371968 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
922978142 1:229802040-229802062 CTGGGGGTTAGGATTCAGCATGG + Intergenic
923105540 1:230850953-230850975 CAGGGGGTCAGGTGCCTGGCAGG - Intronic
923622726 1:235591331-235591353 CTGGGAGTGAGGTGTCAGGAGGG + Intronic
923738657 1:236635568-236635590 CAGAGGGTCAGGAGCAGGGAGGG + Intergenic
924087186 1:240464686-240464708 CTGGGGGTCCGGGGCCAGCACGG - Intronic
924342446 1:243050208-243050230 CTGGGTGTCAGGAGACATGATGG - Intergenic
924947137 1:248854153-248854175 CTGGGGCACAGGGGCCAGGAAGG - Intronic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1063371923 10:5527693-5527715 CTGGCGGTCAGCAGCCATGTGGG - Intergenic
1063455845 10:6182313-6182335 CTGGGGGTCTGGGTGCAGGAGGG + Intronic
1065122453 10:22542928-22542950 CTTGGGCTCAGGGTCCAGGAAGG + Intronic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1066444941 10:35473779-35473801 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1066734026 10:38455347-38455369 CTGGGTGTCAGGAGACATGATGG + Intergenic
1067438104 10:46292889-46292911 CTGAGGGTCAGCCGGCAGGAAGG + Intronic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067699825 10:48562607-48562629 CCTGGGGTCAGGGGTCAGGAGGG + Intronic
1068116140 10:52739675-52739697 CTGGGGCTCAGAAGCCTGGGAGG + Intergenic
1068837182 10:61568090-61568112 CTGGGGGAGAGGAGCCAGGGTGG + Intergenic
1069084169 10:64120278-64120300 ATGGGGGAGAGGAGCCAAGATGG + Intergenic
1069289217 10:66756592-66756614 GTAGGGGTCAGGAGAGAGGAAGG - Intronic
1069544799 10:69320252-69320274 CTGGAGGTCAGCTTCCAGGAGGG + Intronic
1069661613 10:70127038-70127060 CTAGGGACCAGGACCCAGGAGGG + Intronic
1069795436 10:71048906-71048928 CTGAGGGGCAGGAGACAGGCAGG + Intergenic
1069868377 10:71518272-71518294 CTGGGAGGCAGGACACAGGATGG - Intronic
1070630474 10:78081165-78081187 CTGGGGGGCAGGAGGAAGAATGG + Intergenic
1070646593 10:78206081-78206103 CCTCGGGTCAGGAGCTAGGAGGG - Intergenic
1070798806 10:79232987-79233009 CTGGAAGCCAGGAGCCAAGAGGG - Intronic
1070813824 10:79311377-79311399 TGGGGGGACAGGAGCCAGCAGGG - Intronic
1070868939 10:79731087-79731109 CAGGAGGACAGGAGCCAGCAAGG + Intergenic
1071156298 10:82692942-82692964 CAGAGGGTCAGGACACAGGAAGG + Intronic
1071306401 10:84302826-84302848 CTGGGGGAGAGGAGGCAGCATGG - Intergenic
1071501269 10:86205958-86205980 ATGGAGGCAAGGAGCCAGGAAGG + Intronic
1071635852 10:87253269-87253291 CAGGAGGACAGGAGCCAGCAAGG + Intergenic
1071659389 10:87484670-87484692 CAGGAGGACAGGAGCCAGCAAGG - Intergenic
1072412487 10:95216388-95216410 CTGGAGATCAGGATCAAGGAAGG + Intronic
1072733438 10:97863744-97863766 CTGGGAGTCAGGAGACTGGGGGG - Intronic
1073083201 10:100872748-100872770 CTGGGGGTCTCCAGCCAGCAGGG - Intergenic
1073489160 10:103841287-103841309 CTGGGAGCCAGGAGGCAGGTAGG - Intronic
1074298810 10:112214830-112214852 TTGGGGGTTCTGAGCCAGGATGG + Intronic
1074883043 10:117673183-117673205 ATGGGAGGCAGGAGCCAGGGTGG + Intergenic
1075085011 10:119409110-119409132 TTGGGGGTCAGGAGCTGGGCTGG - Intronic
1075091989 10:119448975-119448997 CAGGGAGTCAGAAGCCAGGAAGG + Intronic
1075333956 10:121596106-121596128 CTGGGGCTCAGACTCCAGGAAGG - Intronic
1075551069 10:123392585-123392607 CTGGGAGGCAGGAGCGAGGTAGG + Intergenic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1076071264 10:127491743-127491765 CTTGGGACCAGGAGCCAGGACGG + Intergenic
1076364077 10:129910910-129910932 CTGGGGCACAGGTGCCAGCAGGG + Intronic
1076511807 10:131019605-131019627 CTGGGAATCAGGGCCCAGGAGGG + Intergenic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1076667186 10:132100061-132100083 CCCGGGGGCAGGAGCCAGGGTGG - Intergenic
1076736055 10:132459462-132459484 ATGGGGGTCAGGAGGCTGGGTGG + Intergenic
1076794214 10:132790866-132790888 CTGGGGCTCAGGATTCAGGGAGG - Intergenic
1076849459 10:133086009-133086031 GTGGTGGTCAGGACCCGGGAGGG - Intronic
1076923772 10:133470678-133470700 CTGAGGGGCAGGACACAGGAAGG - Intergenic
1076969184 11:123742-123764 CTGGGTGTCAGGAGACATGATGG - Intergenic
1076979577 11:197436-197458 GAGAGGGTCAGGAGCCAGGCGGG + Intronic
1077198961 11:1295966-1295988 CTGGGGGCCAGGCCCCAGGCTGG - Intronic
1077232616 11:1464825-1464847 CTGGAGGGCAGGAGGCAGGCAGG - Intergenic
1077408650 11:2393549-2393571 TTGGGGGGCAGGAGCCAGCAGGG + Intronic
1077432496 11:2522764-2522786 CCGGGGGTTGGGAGCCAGCAGGG - Intronic
1077663564 11:4089753-4089775 CTGAGGGTCAGAAGTTAGGAAGG - Intronic
1078083108 11:8218011-8218033 CTGGACCCCAGGAGCCAGGAAGG + Intergenic
1078323419 11:10357870-10357892 ATGGGGGTGAGGAACCAGGCTGG - Intronic
1079586123 11:22128502-22128524 CAGGGGGAAAGTAGCCAGGAGGG - Intergenic
1079808525 11:24963900-24963922 CTGGAGGGGAGGAGCCAAGATGG - Intronic
1080573929 11:33580996-33581018 CTGGGGGCCAGGTTCCAGGCAGG + Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1081578496 11:44334702-44334724 CTTGGGGTCAGTACCCAGAAGGG + Intergenic
1083187677 11:61026985-61027007 CTGGGGGAAGGGAGCCAGGGAGG - Intergenic
1083474897 11:62909393-62909415 CAGGAAGTCAGGAGCCAGCAGGG - Exonic
1083562702 11:63685960-63685982 ATGGGGATCAGGGGTCAGGATGG + Intronic
1083571654 11:63764669-63764691 GCTGGGGTGAGGAGCCAGGATGG - Intronic
1083598485 11:63931803-63931825 AGGGCGGGCAGGAGCCAGGAAGG + Intergenic
1084146000 11:67265803-67265825 GTTGGGGTCAGTAACCAGGATGG + Intergenic
1084331240 11:68431887-68431909 CTGGAGTTCCCGAGCCAGGAGGG - Intronic
1084560532 11:69903161-69903183 CGGGGGTTCAGGTGCAAGGAAGG + Intergenic
1084972241 11:72778209-72778231 CAGGGGCTCTGGAGCCAGGCTGG + Intronic
1085130209 11:74031831-74031853 TTAGGGGCCAGGATCCAGGATGG + Intronic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1085748737 11:79140308-79140330 TTGGGGGTAGGGAGCCCGGAGGG - Intronic
1086653409 11:89319888-89319910 CTGGGGGACAGGAGCGAGACTGG - Intergenic
1087615458 11:100481726-100481748 TTGGGGGGGAGGAGCCAAGATGG - Intergenic
1088319038 11:108535840-108535862 CTGGGGGTCTGGAACAAGAAAGG + Intronic
1088469264 11:110176407-110176429 GTGGAAGGCAGGAGCCAGGAGGG - Intronic
1088913463 11:114209520-114209542 CTCAGGGTCAGAGGCCAGGAGGG - Intronic
1089235168 11:117018156-117018178 CTGGGGGACTGGTTCCAGGAAGG + Intronic
1089289059 11:117426863-117426885 CTGTGGATCAGGAACCTGGAAGG - Intergenic
1089297191 11:117476873-117476895 CCGATGGTCAGGACCCAGGATGG + Intronic
1089378223 11:118010280-118010302 CCAGGTGCCAGGAGCCAGGAGGG - Intergenic
1089499446 11:118923827-118923849 CTGGGAGGCTGGTGCCAGGAAGG - Intronic
1089647478 11:119889706-119889728 CTGAGGCTCTGGAGCCTGGAAGG - Intergenic
1089694092 11:120205829-120205851 CTGGGGGTGGGGAGCAGGGAAGG + Intergenic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089742055 11:120591250-120591272 CTGGATGTCAGGAGGCAGGGAGG + Intronic
1090003538 11:122981462-122981484 ATGGGCGTGAGGAGCCAAGAGGG + Exonic
1091580272 12:1783047-1783069 CTTGAGGTCAGGAGCCAAGATGG - Intronic
1091657244 12:2354629-2354651 CTGGAGGCCAGGAGAAAGGATGG - Intronic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1091750709 12:3019799-3019821 CTGGGGGACAGAAGGCAGCAGGG - Intronic
1092031622 12:5290940-5290962 TTAGGGGACAGGAGCCAAGATGG - Intergenic
1092299124 12:7228482-7228504 CTGGAGATCAGGATCAAGGAAGG + Intergenic
1092388956 12:8058494-8058516 CTGGGGGTTGGGACCCAGCAAGG - Exonic
1092874610 12:12837322-12837344 CTAGGGGTCAGGGGTCAGGGTGG + Intergenic
1093693638 12:22136527-22136549 ATGGGGGGGAGGAGCCAAGATGG + Intronic
1093964570 12:25311219-25311241 CTGGGGGTGAGAAGGCAGGGTGG - Intergenic
1094105361 12:26805780-26805802 ATGGCTGGCAGGAGCCAGGAAGG + Intronic
1094435625 12:30417968-30417990 CTGAGGGTGAGGAGTCAGGTGGG + Intergenic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1095083240 12:38031430-38031452 CTGGGGGCGAGGAGCCAAGACGG + Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096575585 12:52550732-52550754 CTGGGGAGCAGGACCAAGGAGGG - Intronic
1096618651 12:52848744-52848766 CTGGGGGTCAGGGGGTAGGCTGG - Exonic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1097033372 12:56105237-56105259 CGGGGCGTCAGGAGCCAAGCCGG + Intronic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097675051 12:62591285-62591307 CTGAGGGTGAGGAGTCAGGCTGG - Intronic
1098831874 12:75373763-75373785 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1099424483 12:82505353-82505375 CTGGCAGACAGGAGGCAGGAAGG + Intergenic
1099689808 12:85938286-85938308 CTGGGGGACAGAAGGCAGGGTGG - Intergenic
1099959162 12:89380297-89380319 ATGGAGTTTAGGAGCCAGGAGGG + Intergenic
1100237398 12:92674567-92674589 CTGCTTTTCAGGAGCCAGGAAGG + Intergenic
1100263039 12:92950595-92950617 CTGGGCAACAAGAGCCAGGAAGG + Intergenic
1100581051 12:95940903-95940925 CTGGAGGTCAAGAGGAAGGAAGG + Intronic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1101240478 12:102833190-102833212 GTGGGGGGGAGGAGCCAAGATGG - Intergenic
1101423900 12:104571655-104571677 CCAGGGGTTAGGAGCCAGAAAGG - Intronic
1102069983 12:110010604-110010626 CTGGGCTCCAGGAGACAGGAAGG + Intronic
1102207011 12:111097712-111097734 CTCAGAGTCAGGAGCCAGGGAGG + Intronic
1102570839 12:113826033-113826055 CTGGAAGCCAGGAGCCAGCAAGG - Intronic
1102594704 12:113983595-113983617 CAGTGGTTCAGGAACCAGGATGG - Intergenic
1102750051 12:115285119-115285141 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103923942 12:124413494-124413516 CTTGGGGACACGAGGCAGGAAGG + Intronic
1103984903 12:124760667-124760689 CTGGGGCTCAGGGGCCAGAACGG + Intergenic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1105840928 13:24253080-24253102 CAGGGGTTCAGGTCCCAGGATGG + Intronic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1106118002 13:26833471-26833493 AAGCGGGGCAGGAGCCAGGAAGG + Intergenic
1106506335 13:30373778-30373800 CTGGAGGTCAGGACACAGGTAGG - Intergenic
1107396426 13:40022831-40022853 CTGTGGGTCTAGGGCCAGGATGG + Intergenic
1107639234 13:42424877-42424899 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1110841737 13:80151898-80151920 ATGGGGGGGAGGAGCCAAGATGG + Intergenic
1111201659 13:84945714-84945736 CTGGGAGTCAGGAGTAAGCATGG + Intergenic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113672727 13:112185796-112185818 CTGTGGGTCAGGAACAGGGATGG - Intergenic
1113937458 13:114001928-114001950 GTGGGGAGCAGGAGACAGGATGG + Intronic
1114276364 14:21149081-21149103 CTGTGGGTCAGGAGGCTGCAAGG + Intergenic
1114674506 14:24431376-24431398 CTGGAGCTCAGGAGCGAGCAAGG + Intronic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1115851948 14:37595775-37595797 CTTTGGGTCAGGAATCAGGAGGG - Intronic
1116323863 14:43505347-43505369 CTGTGTGTCAAGAGCCAGCAAGG + Intergenic
1116648113 14:47556059-47556081 CTGGGGGTCAGGTGTCTGGAAGG - Intronic
1117804284 14:59474342-59474364 CTTAGAGTCAGGAGGCAGGATGG + Intronic
1118776079 14:68974909-68974931 CTGGGGGCCTGGAGCCAGGGTGG - Intronic
1118917986 14:70123933-70123955 CTGGGGGACCGGAGCCTGGGAGG - Intronic
1119691538 14:76676508-76676530 CTTGGGGTAAGGAGCAAGGGAGG + Intergenic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1121554897 14:94829109-94829131 CTGGGGGCCTGGAGCTGGGAGGG - Intergenic
1121863865 14:97344113-97344135 CTGCAGGTCAGGAGCCTGGATGG - Intergenic
1122048837 14:99041609-99041631 CTGGAGGTACGGAGCCAGGCTGG - Intergenic
1122292783 14:100688468-100688490 CTGGGGGTGGGGGGCCAGGAAGG - Intergenic
1122530922 14:102426430-102426452 CTGGGGGTGAGGAGTCGGGAGGG - Intronic
1122632021 14:103111555-103111577 CTGGAGGTCAGGAGCAGGGCAGG + Intergenic
1122636518 14:103132168-103132190 CTGGGAGTCAGGCGCGGGGATGG - Intronic
1122828397 14:104383447-104383469 CTGGGGGCGCTGAGCCAGGAGGG - Intergenic
1122854645 14:104554275-104554297 CCTGGGGTGAGGAGACAGGAGGG + Intronic
1123121913 14:105920617-105920639 CCTGGGGACAGGAGCCAGGCAGG + Intronic
1123404604 15:20012266-20012288 CCTGGGGACAGGAGCCAGGCAGG + Intergenic
1123513937 15:21018913-21018935 CCTGGGGACAGGAGCCAGGCAGG + Intergenic
1124612138 15:31215985-31216007 CTCGGGCTGAGGAGGCAGGAGGG - Intergenic
1126416111 15:48419027-48419049 CTGGGAGTGAGGATCCAGGGAGG + Intronic
1126505077 15:49395980-49396002 CTGGGGGCGAGGAGCCAAGATGG + Intronic
1126560253 15:50035661-50035683 CCTGTGCTCAGGAGCCAGGATGG - Intronic
1126676231 15:51161251-51161273 CTGGGGGTCTGGATCTAGGATGG + Intergenic
1126706081 15:51406354-51406376 CTGGGGCTCTGCAGCCAGGAAGG + Exonic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1127775141 15:62258603-62258625 CTGGGGGTCGGGACACAGAAAGG + Intergenic
1128214795 15:65926905-65926927 CTGACGGGCAGGAGCCAGCAGGG + Intronic
1128260779 15:66231449-66231471 CTGGAGGGCAGGGCCCAGGAAGG - Intronic
1128337727 15:66798143-66798165 CTTGGAGTCACCAGCCAGGAAGG - Intergenic
1128513575 15:68328062-68328084 CTGGGGGTGGGGAGAAAGGAGGG + Intronic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128705982 15:69837720-69837742 CTGGAGCTCAGCAGACAGGAAGG + Intergenic
1128710312 15:69866741-69866763 CTGGGTGTCAGCAGGCAGCATGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129150402 15:73684586-73684608 CAGGGGAGCAGGAGCCCGGAGGG - Intronic
1129703577 15:77781974-77781996 GTTGGGGACAGGAGCCAGAAAGG + Intronic
1129738416 15:77978241-77978263 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1129847657 15:78775368-78775390 CTGGAGGCCAGGAGGCAGGGAGG + Intronic
1129868304 15:78925305-78925327 CAGGGTCCCAGGAGCCAGGAGGG - Intronic
1129977317 15:79833061-79833083 CTGGGGAGCTGGAGCTAGGATGG + Intergenic
1130073556 15:80669400-80669422 GTGGTGATCAGGACCCAGGATGG + Intergenic
1130218324 15:81995163-81995185 CGGGGGGGGAGGAGCCAAGATGG + Intergenic
1130254246 15:82318541-82318563 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1130326928 15:82888902-82888924 CTGGTGGGGAGGAGCCAAGATGG - Intronic
1130554491 15:84913290-84913312 CTTGGGGTCTGGAGACATGAGGG + Intronic
1130600723 15:85271429-85271451 CTGGAGGCCAGGAGGCAGGGAGG + Intergenic
1130932247 15:88437872-88437894 CTGGAGGTGAGGAGCTAGGCTGG + Intergenic
1131157859 15:90085720-90085742 CTCCGGGTCACGAGCCAGGCTGG - Intronic
1131515012 15:93071587-93071609 CTGGGGGCCAGGAGCAGGGCTGG + Intronic
1132240084 15:100251154-100251176 CTGGGGATCAGGAGATAGGCTGG + Intronic
1132372347 15:101307621-101307643 CTGGGTGCCAGGGCCCAGGAGGG - Intronic
1132551159 16:554352-554374 CCGGGAGTGAGGGGCCAGGAGGG - Exonic
1132606094 16:794357-794379 GTGGGGAGCAGGAGCCAGGAGGG + Intronic
1132656061 16:1042359-1042381 CAGGGTGTCAGGCACCAGGATGG + Intergenic
1132807242 16:1780426-1780448 GTGGGGGTCAGGGGCCATGGGGG + Intronic
1132908849 16:2298283-2298305 CTGGAGGAAGGGAGCCAGGAGGG - Intronic
1133027959 16:2996876-2996898 CAGGGAGGCAGGGGCCAGGAAGG - Intergenic
1133061919 16:3180386-3180408 CCATGGGGCAGGAGCCAGGATGG + Intergenic
1133189973 16:4126550-4126572 CTGGTTGCCAGGGGCCAGGACGG + Intergenic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1134092002 16:11396494-11396516 CTGGAGGTCAGTGGCCAGGATGG - Exonic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135667563 16:24348956-24348978 CTAGGGGTGAGGAGAGAGGAAGG - Intronic
1136410529 16:30074316-30074338 CTGGGCGACAAGAGCAAGGAAGG + Intergenic
1136480743 16:30540023-30540045 CTGGGGGCCTGGAGACAGAAAGG + Intronic
1136687279 16:32002856-32002878 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1136881890 16:33907382-33907404 CTGGGAGTGGGGAGGCAGGAGGG - Intergenic
1137374896 16:47944161-47944183 CCGGGGGTCAGGGGTCAGCATGG + Intergenic
1137446459 16:48535398-48535420 CTGGTACTCAGGAACCAGGAGGG + Intergenic
1137619921 16:49869435-49869457 CAGGGGGTCAGGGGCCTGCAGGG + Intergenic
1137720429 16:50624621-50624643 CTGGGGCGCAGGTGCGAGGAAGG + Intronic
1137734979 16:50717060-50717082 CAGGAGGTCAGGAGCCAGTGTGG - Intronic
1137753236 16:50881947-50881969 CTTGGGGTGTGCAGCCAGGAAGG + Intergenic
1138515642 16:57534283-57534305 CTGGGGTTCAGGAGCCCTGATGG - Intronic
1138547379 16:57727872-57727894 TTGGGGGTCGTGAGGCAGGATGG + Intronic
1139504166 16:67390853-67390875 CTGGGGGGCTGGAACCAGGGAGG - Intronic
1139890600 16:70251302-70251324 GTGGGGTCCAGGAGCCAGGTGGG + Exonic
1139928140 16:70503337-70503359 CTTGGGGTCAGGTGCCAAGGTGG - Intronic
1139967212 16:70752453-70752475 CTCTGGGTCAGGGCCCAGGATGG - Intronic
1140223947 16:73064172-73064194 CTGGGGGGCAGGAGGCAGGTGGG + Intergenic
1140237481 16:73172304-73172326 CTGGCGGGCAGGAGGAAGGAGGG - Intergenic
1140393225 16:74606509-74606531 CTGGGAGTGAGGAGCAAAGAGGG + Intronic
1140819676 16:78651436-78651458 CTGGAGGTCAGAAGCCATGCAGG + Intronic
1140890226 16:79278794-79278816 TTGGGGGCCAGCAGGCAGGAAGG - Intergenic
1141597143 16:85104311-85104333 CAGGGCTTCAGGAGCCTGGAAGG + Intronic
1141673037 16:85502847-85502869 CTGGGGACCAGGAGCAAGCAGGG + Intergenic
1141910775 16:87056997-87057019 CTGGGATTCTGGAGCCAGGCAGG + Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142451491 16:90175380-90175402 CTGGGTGTCAGGAGACATGATGG + Intergenic
1203090121 16_KI270728v1_random:1208064-1208086 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1143538787 17:7557616-7557638 CTGGGGGTCTGTGGCCAGGGGGG - Exonic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144768202 17:17744355-17744377 ATGAGGGTCAGTAGCCAGAAAGG + Intronic
1145270101 17:21400292-21400314 CAGGGTGTGAGGAGACAGGAGGG - Intronic
1145308323 17:21687743-21687765 CAGGGTGTGAGGAGACAGGAGGG - Intergenic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1146077431 17:29744193-29744215 CCGGGGGTGAGGGGCCAGGTGGG + Intronic
1146289899 17:31599442-31599464 CTGAGGGCCAGGCGCCAGGGTGG + Intergenic
1146306188 17:31731391-31731413 CTTGGGCTCTGGAGCCTGGATGG + Intergenic
1146844236 17:36173500-36173522 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1146856541 17:36261435-36261457 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1146864076 17:36326940-36326962 CTGGGGGTCGGCACCCAGGCTGG + Intronic
1146872451 17:36385346-36385368 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1146879809 17:36436431-36436453 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1147046005 17:37752651-37752673 CTGGGGGTGAAGAGCCATGCAGG + Intergenic
1147066936 17:37927528-37927550 CTGGGGGTCGGCACCCAGGCTGG + Intronic
1147075335 17:37985970-37985992 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1147078468 17:38007089-38007111 CTGGGGGTCGGCACCCAGGCTGG + Intronic
1147086860 17:38065516-38065538 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1147094406 17:38131024-38131046 CTGGGGGTCGGCACCCAGGCTGG + Intergenic
1147102805 17:38189479-38189501 CTGGGGGTCGGCACCCAGGCTGG - Intergenic
1148146339 17:45367354-45367376 CGGGGGGTCAGGACGCAGCATGG + Intergenic
1148742081 17:49898607-49898629 ATGGGGAGCAGGAGCCAGGCTGG - Intergenic
1148845424 17:50527179-50527201 CAGGGGACCAGGAACCAGGAGGG - Intronic
1149625627 17:58078627-58078649 CAGGGAGTCTGGAGACAGGAGGG + Intergenic
1149850467 17:60030725-60030747 CCTGCGGCCAGGAGCCAGGAAGG + Intergenic
1149859699 17:60115799-60115821 CCTGCGGCCAGGAGCCAGGAAGG - Intergenic
1150085737 17:62272563-62272585 CTGGGGGTCGGCACCCAGGCTGG - Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150318317 17:64188361-64188383 CTGTGGGTCAGGTGCCCGGACGG + Exonic
1150389086 17:64780611-64780633 GCCGGGGTCCGGAGCCAGGAAGG + Intergenic
1151535911 17:74738641-74738663 CTGGGACCCAGGAGCCAGGGAGG + Intronic
1151554598 17:74840388-74840410 CTGGGGGACAGGTAGCAGGAAGG - Intergenic
1151576843 17:74956783-74956805 CTGGGGTTCAGGACCTAGCAAGG - Intronic
1151801493 17:76382365-76382387 CAGGGGGTTAGGCGCCAGGGAGG + Intronic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1152117735 17:78398991-78399013 CTGGGGGTGAGGGGCAAGGTGGG + Intronic
1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG + Intronic
1152319825 17:79602475-79602497 CTGGGGGCACGCAGCCAGGATGG + Intergenic
1152347078 17:79759727-79759749 CTGGTGGCCAAGTGCCAGGAAGG - Intergenic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152403770 17:80084983-80085005 CTGGGGGTGAGGTCCCAGGCAGG + Exonic
1152468435 17:80477958-80477980 CTGGGGGTCCCCAGCCAGCAGGG + Intergenic
1152531824 17:80923329-80923351 CTGGGGTTCGGGAGCCATGATGG + Intronic
1152768437 17:82153230-82153252 CTGGGGGAGAGGGGCCAGGCAGG + Intronic
1153063499 18:1018695-1018717 CAGGGGGTGAGGAGCCATGGGGG + Intergenic
1153164535 18:2247164-2247186 CTGAGGGGGAGGAGCCAAGATGG + Intergenic
1153429828 18:5004133-5004155 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1153719281 18:7885110-7885132 CTGGGGTTCAGGGCCAAGGATGG - Intronic
1154374424 18:13797436-13797458 CTAAGGGTCAGGGGCCAGGGTGG + Intergenic
1155098084 18:22579547-22579569 CTGGGTGCCCTGAGCCAGGATGG + Intergenic
1155927593 18:31673471-31673493 CTGGTGGTCAGCAACGAGGATGG + Intronic
1156195039 18:34765164-34765186 CTGGGCATCAGGAGCCATGCTGG + Intronic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156401550 18:36744614-36744636 GTGGGGAGCAGGAGCCGGGAGGG - Intronic
1157574371 18:48733767-48733789 CTGAGTGTGAAGAGCCAGGAGGG - Intronic
1157604466 18:48917197-48917219 ATGGGGGACAGGGGCAAGGATGG + Intergenic
1157717955 18:49902115-49902137 CTGGAGGTCAGGAGTCTGAAGGG + Intronic
1160006697 18:75073657-75073679 GTGGGGTTCAGGAGGCAGTAGGG - Intergenic
1160075208 18:75667874-75667896 CTGAGAGGCAGGAGCCAGCATGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160425034 18:78773619-78773641 CTGGGCCTCAGGAGCAAGGCAGG - Intergenic
1160580141 18:79879052-79879074 GTGGGGGTCAGGCTCCTGGAGGG + Intronic
1160645989 19:193668-193690 CTGGGTGTCAGGAGACATGATGG - Intergenic
1161064173 19:2229396-2229418 CTGGGAGCCAGGAGCCAAGGCGG + Intronic
1161225412 19:3142557-3142579 CTGGGGGACAGGAGCCCAAAAGG + Intronic
1161520744 19:4722466-4722488 CTGGGGTTTGGCAGCCAGGAAGG - Intronic
1161555119 19:4937004-4937026 CCGGGGGTCAGGGACCAGGTGGG - Intronic
1161684126 19:5694722-5694744 GTGGGCGGCAGGTGCCAGGAGGG + Intronic
1161796805 19:6391864-6391886 CTGGGGGTCAGGGGCTGGGGTGG - Intronic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1162326743 19:10003971-10003993 CTAGGGATCTGGAGCCAGGAAGG + Intronic
1162432066 19:10635083-10635105 CAGGGTGCCAGGGGCCAGGATGG + Intronic
1162440350 19:10688527-10688549 CTGGGGGAGAGAAGACAGGATGG - Intronic
1162746688 19:12802464-12802486 CTCGGGGATAGGTGCCAGGAAGG + Intronic
1163014108 19:14443335-14443357 CTGGGGGCCAGCAGACAGGCAGG - Intronic
1163115350 19:15185560-15185582 GTGGGGGCAAGGAGCCAGGCGGG + Exonic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1163783955 19:19264894-19264916 ATGGATGTCAGGGGCCAGGAAGG + Intronic
1163819467 19:19487727-19487749 CTGTGGGCCAGGCCCCAGGAGGG + Intronic
1164097059 19:22021090-22021112 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
1164675123 19:30095600-30095622 CTGGGAAGCAGGTGCCAGGACGG - Intergenic
1164780270 19:30886147-30886169 CTGGGAGGCAGGTGCCAGGGAGG - Intergenic
1164826857 19:31290313-31290335 CTCCCGGTCAAGAGCCAGGAGGG - Intronic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165057510 19:33187403-33187425 CGGGGGGGCAGGGGGCAGGAGGG - Intronic
1165143630 19:33717992-33718014 CTGGGGGTCTTCTGCCAGGATGG - Intronic
1165319381 19:35076063-35076085 CTGAGGTCCGGGAGCCAGGAAGG - Intergenic
1165829038 19:38721475-38721497 CTGTGGGGCAGGAGTCTGGAGGG - Intronic
1165898037 19:39155149-39155171 CTGGGTGCCCGGACCCAGGATGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166049261 19:40248384-40248406 CTTGAGGTCAGGAGCCATGATGG - Intronic
1166111575 19:40626375-40626397 CAGGGGGTCTGGGGCCAGGATGG - Intronic
1166218953 19:41353351-41353373 CGGGGGCTCAGGAGACAGGCCGG + Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166254851 19:41596141-41596163 ATAGGGGTGAGGTGCCAGGATGG - Intronic
1166280120 19:41786772-41786794 ATAGGGGTGAGGTGCCAGGACGG - Intergenic
1166396636 19:42446071-42446093 ATAGGGGTGAGGTGCCAGGACGG + Intergenic
1167257966 19:48442577-48442599 CTGCGGGTCCGGGGACAGGACGG - Intronic
1167269181 19:48498401-48498423 CCGGGAGACAGGACCCAGGAAGG - Exonic
1167699077 19:51031838-51031860 CCAGGGGTCAGGGGTCAGGATGG - Intronic
1168339709 19:55615921-55615943 CTGGGGGTGAGGACGCAGGCGGG + Exonic
1168347621 19:55658737-55658759 CTAGGGGTCAGGTGCCAGGCAGG - Intronic
1168523081 19:57068104-57068126 CTGAGGTCCAGTAGCCAGGATGG - Intergenic
1168670734 19:58239281-58239303 CTGGTGGGCAGAGGCCAGGAAGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925451726 2:3974696-3974718 CTGGGGGACAGAAGCATGGATGG + Intergenic
925463697 2:4087485-4087507 CGCAGGTTCAGGAGCCAGGAAGG - Intergenic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
927210107 2:20634022-20634044 GTGGGGGCCACGAGCCAGGATGG - Intronic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
928393480 2:30926847-30926869 TTGGGGGCCAGGAGAAAGGAGGG + Intronic
929695433 2:44110896-44110918 CTGAGGGTCAGAAGTCTGGAGGG - Intergenic
930889871 2:56372400-56372422 CTGGGGGTCCAGAGCCCGGCGGG + Exonic
930989312 2:57631579-57631601 GTGGGGGGCGGGAGGCAGGAAGG + Intergenic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
932429997 2:71668529-71668551 CTGGGGGTCAAGGGTCAGGGTGG - Intronic
932474096 2:71990389-71990411 CTGGAGGTGAGCAGGCAGGAAGG + Intergenic
932571273 2:72939741-72939763 CTGGAGCTCAGGAGACAGGTAGG - Intergenic
932780738 2:74556924-74556946 CTGGGGCTTGGGAGCAAGGAGGG - Exonic
933590220 2:84224735-84224757 ATGGGGGAGAGGAGCCAAGATGG + Intergenic
934077521 2:88440654-88440676 CTGGAGGTGAGAAGCCAGCAGGG - Intergenic
934718506 2:96556952-96556974 CTGTGAGTCAGAAGCCAGGCGGG - Intergenic
935425075 2:102911063-102911085 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
935573563 2:104687287-104687309 CTGGGGATCAGGGGGCAGAACGG - Intergenic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
936287285 2:111190626-111190648 CTGGGGGTCACTAGCCTGGCTGG - Intergenic
936573352 2:113634376-113634398 CAGAGAGCCAGGAGCCAGGAGGG + Intronic
937062070 2:118988190-118988212 CTGGAGGTGAGGAGCTAGGAAGG + Intronic
937269446 2:120638820-120638842 CTTGGGGTCATCAGCCTGGATGG - Intergenic
937304892 2:120865124-120865146 CTGGGGAGCCCGAGCCAGGAGGG + Intronic
937320893 2:120960168-120960190 CTGGAGCTCAGGCACCAGGAAGG - Intronic
937439328 2:121903254-121903276 CAGCGGGTCAGGCTCCAGGAGGG - Intergenic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
937922875 2:127144338-127144360 CTCTGCATCAGGAGCCAGGAAGG - Intergenic
938109887 2:128556841-128556863 CTTGGGGTCTCTAGCCAGGATGG + Intergenic
938659486 2:133471020-133471042 CAGGGGGGGAGGAGCCAAGATGG - Intronic
940148471 2:150573351-150573373 CTTGGGGGCAGGAGTCAGCAAGG + Intergenic
940335854 2:152526485-152526507 CTGGGAGTGAGAAGCCAGAAAGG - Intronic
940586829 2:155662428-155662450 CTGGGGGTTAGTAGCAGGGATGG + Intergenic
941405464 2:165082223-165082245 ATGGGGGTCAGAAGACAGTAGGG - Intergenic
941668050 2:168261392-168261414 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
942151725 2:173082476-173082498 CTGTCTGTCAGCAGCCAGGATGG + Intronic
942304174 2:174589570-174589592 CTGGGTGTGAGGATCCAGGCAGG - Intronic
942734419 2:179093542-179093564 TTGGGGGGGAGGAGCCAAGATGG - Intergenic
947718789 2:232355235-232355257 ATGGGGGGGAGGAGCCAAGATGG + Intergenic
947832077 2:233148550-233148572 CAGGGTGTCAGGAGGCAGGGGGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948788686 2:240366051-240366073 CTGGGGGTCAGGGAGCATGAAGG - Intergenic
948814085 2:240500819-240500841 CTGGGAGTCGGGTGCCAGGGAGG - Intronic
948970037 2:241418373-241418395 CTGGGGGGCAGGAGGCAGTGGGG - Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168886003 20:1256538-1256560 GTGGGTTTCAGGAGCCAGGGAGG - Intronic
1169011824 20:2257427-2257449 CTAAGGGTCAGGAATCAGGAAGG - Intergenic
1169207640 20:3749209-3749231 CTGGGGGTCAGGAGACAGCAGGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169410969 20:5370090-5370112 ATGAGGGGCAGGAGGCAGGAGGG - Intergenic
1170142374 20:13137867-13137889 TTTGGAGTCAGGAGCCAGGAAGG - Intronic
1170890128 20:20368988-20369010 CTGGGGCTCAAGATCAAGGAGGG + Exonic
1171053931 20:21887652-21887674 CTTGGGGGGAGGAGCCAAGATGG + Intergenic
1171986147 20:31662507-31662529 CTGGGAATCAGGAGTCAGGGAGG - Intergenic
1172456359 20:35077381-35077403 GTGGGGGTCCGGTTCCAGGATGG - Intronic
1172705457 20:36879167-36879189 CTGGTGCTCAGGGACCAGGACGG + Exonic
1172754063 20:37271051-37271073 CAGGGGGACAGGAGCTAGGCAGG - Intergenic
1172830387 20:37829106-37829128 CTGGGGGGCAGGGGGCAGGTGGG + Intronic
1173185549 20:40837205-40837227 GTGGGGGCCAGGAGCCAGTGGGG - Intergenic
1174037566 20:47677744-47677766 CTGGGGGTCAGGGGACAGGGTGG - Intronic
1174112282 20:48205034-48205056 CTGGGGGTCTGGCAGCAGGAGGG + Intergenic
1174148290 20:48467883-48467905 CTGGCTGGCAGGAGACAGGATGG + Intergenic
1174385645 20:50187221-50187243 GTGGTGGGCAGGAGCCAGGCGGG - Intergenic
1175022569 20:55865960-55865982 CTGGGGGTTATGAAGCAGGATGG - Intergenic
1175312122 20:58019378-58019400 CTCGGGCTCAGGAGCCAGGCAGG + Intergenic
1175787837 20:61723313-61723335 CCGGTGCTGAGGAGCCAGGACGG - Intronic
1175844425 20:62051164-62051186 CTGGGGCTGAGGAGCAAGAAGGG + Intronic
1175855428 20:62118462-62118484 AAGGGGGACAGGAGGCAGGAGGG + Intergenic
1175862138 20:62156232-62156254 CTGGGGGTTAGGAGTCAAGGAGG + Intronic
1176136290 20:63523421-63523443 CTTGGGGTCAGGACCAAGGGTGG + Intergenic
1176143601 20:63555619-63555641 CTGGGTGTCAGCTGCCAGGCAGG - Exonic
1176168864 20:63688208-63688230 CAGGGGTCCAGGATCCAGGATGG - Intronic
1176279517 20:64292548-64292570 CTGGGTGTCAGGAGACATGATGG + Intergenic
1178715096 21:34957328-34957350 CAGGAAGCCAGGAGCCAGGATGG + Intronic
1179090745 21:38263280-38263302 CTGCTGGTCAGAAGGCAGGAGGG + Intronic
1179124354 21:38578001-38578023 CTTGGTTTCAGGAGGCAGGAAGG - Intronic
1179190733 21:39119709-39119731 CTGGGGGTCCGGGGTCAGGAAGG + Intergenic
1179191017 21:39121659-39121681 CTGGGGGTGCAGAGCCAGGCTGG - Intergenic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1179991543 21:44950751-44950773 GTGGGAGTCAGGAGCCAGCCAGG + Intronic
1180177391 21:46097564-46097586 CTGAGGGTGGGGAGCCGGGAGGG - Intergenic
1180236067 21:46459623-46459645 CTGAGGGTCGGGAGTCCGGAGGG - Intronic
1180395035 22:12323600-12323622 GTGGGGGGGAGGAGCCAAGAAGG - Intergenic
1180404705 22:12541148-12541170 GTGGGGGGGAGGAGCCAAGAAGG + Intergenic
1180762373 22:18220066-18220088 CTGGGGGGCCGGGGACAGGAGGG + Intergenic
1180773295 22:18404542-18404564 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1180804648 22:18654091-18654113 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1180806100 22:18715319-18715341 CTGGGGGGCCGGGGACAGGAGGG + Intergenic
1180980845 22:19877336-19877358 CTGGGGGTCAGGGGACAGTGAGG - Intronic
1181062453 22:20288168-20288190 CAGAGGGGCAGGAGCGAGGAGGG - Intergenic
1181134129 22:20752274-20752296 CAGGTGGTCAGGAGCCAGCCAGG - Intronic
1181192391 22:21151475-21151497 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1181217048 22:21341100-21341122 CTGGGGGGCCGGGGACAGGAGGG + Intergenic
1181343556 22:22201101-22201123 CTGTGGGGCAGGGGCCAGCAGGG - Intergenic
1181439999 22:22930838-22930860 CTTTGGGACAGGAGCCAGGGAGG + Intergenic
1181669668 22:24420284-24420306 CTGAGGATCTGGAGCCTGGATGG + Intronic
1181681652 22:24499652-24499674 ATGGGGCTCAGGAGACAGGTTGG - Intronic
1182228464 22:28818400-28818422 CTTGGGATCAGGAGCTGGGATGG + Intergenic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183080557 22:35453108-35453130 CAGAGGGGCAGAAGCCAGGAGGG - Intergenic
1183459855 22:37943195-37943217 GTGGGTGTCAGGAGCCAGAGGGG + Intronic
1183674518 22:39292055-39292077 CAGGGGGTGGGGACCCAGGAAGG + Intergenic
1183727308 22:39596901-39596923 CTGAGTGTCAGGAGACAGAAAGG - Intronic
1183730290 22:39614693-39614715 CTAGGAGCCAGGAGCCAGGGAGG + Intronic
1183979441 22:41531072-41531094 TTGGAGGCCAGGACCCAGGAAGG + Intronic
1184038393 22:41929158-41929180 ATGGGGGACAGGACCCTGGAGGG + Intergenic
1184123878 22:42472926-42472948 CTGAGAGGCAGGAGCCAGGAGGG + Intergenic
1184450228 22:44578193-44578215 CTGGGAGCCGGGACCCAGGAGGG - Intergenic
1184671142 22:46012888-46012910 CTGGGGGCCATGGGACAGGAGGG - Intergenic
1184781718 22:46652936-46652958 CTGGTGGGCAGGAGGCAGGCCGG + Intronic
1184863510 22:47190272-47190294 CAAGGGGTGAGGGGCCAGGAGGG + Intergenic
1185083491 22:48723048-48723070 CTGGGGCTCAGGGGACAGGCTGG - Intronic
1185272152 22:49934644-49934666 CTGGGGGTCGGGGGGCAGAAGGG + Intergenic
1185386985 22:50537929-50537951 CTGGGCTTCAGGAGCAAGGAAGG - Intergenic
1185426830 22:50776504-50776526 CAGAGAGCCAGGAGCCAGGAGGG - Intronic
1203235125 22_KI270731v1_random:145524-145546 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
950148437 3:10668051-10668073 CAGGAGGTCGGAAGCCAGGATGG - Intronic
950252156 3:11474871-11474893 GTGGGGGGCCGGAGCCAGTATGG + Intronic
950707611 3:14792778-14792800 GTGAGGGTCAGGTGCCAAGAGGG - Intergenic
952977005 3:38705060-38705082 ATGCTGGTCAGGAGCTAGGATGG + Intronic
953676104 3:45003630-45003652 CTGGGTTGGAGGAGCCAGGAAGG - Intronic
953997801 3:47534091-47534113 CTGGGGAGGAGGAGCCAGGCTGG + Intergenic
954127203 3:48538650-48538672 ATCAGGGTCAGGAGCCAGGCGGG + Intronic
954183372 3:48898833-48898855 CTGGGGCTGAGAAGCCAGGACGG - Exonic
954371536 3:50171698-50171720 CTGTGGGTGAGCAGCCAGGCGGG + Intronic
954626005 3:52022239-52022261 CTGGGAGTTGGGAGCCAGGGTGG - Intergenic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955513189 3:59701315-59701337 CTGGGGCTCAGGTGCGAGGTAGG - Intergenic
955769177 3:62372242-62372264 CTTGGGGTGAGCAGCCAGGGCGG + Exonic
956703871 3:71982624-71982646 CTGGGGGTGAGAAGGCAGGGTGG + Intergenic
957601163 3:82337496-82337518 CTGCGGGGGAGGAGCCAAGATGG + Intergenic
957806252 3:85153068-85153090 CTGCGGGGGAGGAGCCAAGATGG + Intronic
957954073 3:87161247-87161269 CAGAGGGTCTGGAGCCAGCATGG - Intergenic
958853694 3:99358805-99358827 CTGGCTGACAGGAGCCAGGCAGG - Intergenic
959464140 3:106665290-106665312 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
960912055 3:122659016-122659038 CTGGGAGGCAGAGGCCAGGAGGG + Intergenic
961064803 3:123866287-123866309 CTAGGGGGCTGGAGCCAGGGAGG + Intronic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
961354485 3:126327394-126327416 CTGAGGGACAGCAGCCAGAAGGG - Intergenic
961354921 3:126331601-126331623 GTGGGGGGGAGGAGCCAAGATGG + Intergenic
961383459 3:126510577-126510599 CTGGGGGCCAGGAACAAGGAGGG - Intronic
961444561 3:126973091-126973113 TTGGGGCTCAGAAGCCTGGAGGG - Intergenic
961453640 3:127013847-127013869 AGGGGGCTCTGGAGCCAGGAAGG + Intronic
962259188 3:133892361-133892383 CAGGGGGACAGCTGCCAGGAGGG + Intronic
962351793 3:134661728-134661750 CTGGAAGGCAGGAGGCAGGAAGG + Intronic
962442997 3:135439842-135439864 ATGGGGGGGAGGAGCCAAGATGG - Intergenic
962648145 3:137460965-137460987 ATGGGGGGGAGGAGCCAAGACGG - Intergenic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
966003452 3:174979001-174979023 TTGGGTGAAAGGAGCCAGGAAGG + Intronic
967287794 3:187890217-187890239 CTCGGGGGGAGGAGCCAAGATGG + Intergenic
968121743 3:196130741-196130763 CAGGGGGTGAGGAGCCAGTCCGG - Intergenic
968371692 3:198225858-198225880 CTGGGTGTCAGGAGACATGATGG + Intergenic
968512094 4:1000286-1000308 CCAGGGGTCAGGAGCCAGGCAGG - Intronic
968517788 4:1022143-1022165 CTTGGGGTCCGGAGCCGGGGGGG - Intronic
968531561 4:1094559-1094581 CAGGGGCTCAGCTGCCAGGATGG + Intronic
968619524 4:1597516-1597538 CTGGGGGTCTGGAGCAGGCAGGG - Intergenic
968690438 4:1987281-1987303 CTGGGGGCCAGAGGGCAGGACGG - Intronic
968800211 4:2738382-2738404 CTGGGGGAGAGGAGGCAGGGTGG - Intergenic
968812222 4:2805211-2805233 CGGAGGGTCAGCAGCCAGGCTGG + Intronic
968906979 4:3458231-3458253 CTGGGGGAGAGGAGGCAGGGTGG - Intergenic
969299146 4:6287276-6287298 ATCGGGGTCAGGAGCCAGCGTGG + Intronic
969346994 4:6575960-6575982 CAGGGAGTCAGGAGGCATGAGGG - Intronic
969442787 4:7227240-7227262 GTGGGGGTGTGGAGCCAGGCTGG - Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969601607 4:8179724-8179746 CTGCAGGTCAGGAGCCTGGCGGG - Intergenic
970681540 4:18514236-18514258 CTGGTGGGCAAGAGCCAGGTAGG - Intergenic
974659350 4:64865153-64865175 TTGGGGGGGAGGAGCCAAGATGG - Intergenic
976326024 4:83772665-83772687 CTGTGGTTCAGGAACCTGGATGG + Intergenic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
978341559 4:107725286-107725308 CTGGGGGACAGAAGGCAGGGTGG + Intergenic
979260380 4:118638336-118638358 CGGGGTGTCAGGAGACATGATGG + Intergenic
979953768 4:126928252-126928274 GTGGGGGGGAGGAGCCAAGATGG + Intergenic
980497500 4:133605099-133605121 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
981039896 4:140213418-140213440 CTGTGGGTCAGGAGTCTGGGTGG + Intergenic
981443544 4:144809655-144809677 TTGGGGGGGAGGAGCCAAGATGG + Intergenic
981633595 4:146849765-146849787 CTGGGGGCCTGGAGCCAGTAAGG - Intronic
982258271 4:153470903-153470925 CTGCAGGGCAGGAGTCAGGAAGG - Intronic
983446317 4:167857878-167857900 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
983768685 4:171519879-171519901 GTGGGAGTTAGAAGCCAGGAAGG + Intergenic
985632671 5:1022108-1022130 CTGGTGGACAGGGGCCAGCAAGG - Intronic
985680705 5:1254228-1254250 CTGGGGGCCTGGAGCCACGCTGG - Intronic
985749950 5:1668033-1668055 CTGGGGGACAGGAGCCTCCAGGG - Intergenic
985764200 5:1768283-1768305 ATGTGGGTCAGAAGCCAGGTGGG + Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
985836726 5:2277245-2277267 CAGGGGGTCAGCACCCAGTAGGG - Intergenic
985886781 5:2686304-2686326 CCGGTGCTCAGGGGCCAGGAAGG - Intergenic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986478354 5:8159058-8159080 CTGGCGGGGAGGAGCCAAGATGG + Intergenic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
987038623 5:14041265-14041287 CTGGGGACCATGAGGCAGGAAGG - Intergenic
987092707 5:14522130-14522152 TTGGGGGTGAGGAGTCAGGGGGG - Intronic
987337107 5:16906586-16906608 CTGGATGTCAGAAGCCAGCATGG + Intronic
988558653 5:32260659-32260681 GTGGGGGTCAGGACCCTGGCAGG + Intronic
989307472 5:39974360-39974382 CTGGGGGACAGAAGGCAGAATGG + Intergenic
989779199 5:45243985-45244007 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
990008382 5:50967808-50967830 CTTGGAGCCAGGAGCCAGGGAGG + Intergenic
990547239 5:56835272-56835294 CTGCAGGTTAGGAGACAGGAAGG + Intronic
991499622 5:67264058-67264080 CTGGGAGGCAGGAGGCTGGAGGG - Intergenic
992078936 5:73216268-73216290 CTGGAGCGCGGGAGCCAGGACGG + Intergenic
992554011 5:77885621-77885643 CTGTGGCTCAGGACCTAGGAGGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994535765 5:101027252-101027274 CTGGAGCTCTGGGGCCAGGATGG + Intergenic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
996433402 5:123405711-123405733 GTAGTGGTCAGGAGTCAGGAAGG - Intronic
999558239 5:152768680-152768702 GTGGGGGGGAGGAGCCAAGATGG - Intergenic
999606797 5:153325323-153325345 CCGGGGGGAAGGAGCCAAGATGG + Intergenic
999615937 5:153424184-153424206 CTGGGGGAAATGAGACAGGAGGG + Intergenic
999899181 5:156067948-156067970 GTGGGGGGGAGGAGCCAAGATGG - Intronic
1001304304 5:170560559-170560581 CCGGGGATCAGGGACCAGGATGG + Intronic
1001552199 5:172611106-172611128 TTGGGGGTGAGCAGGCAGGATGG + Intergenic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1001691891 5:173639290-173639312 CGGGAGCTCAGGAGCCAGGGTGG + Intergenic
1001742776 5:174067778-174067800 CTGGGGCTCATGATCCAGGGAGG + Intronic
1002664013 5:180809969-180809991 GTGGGGGTCAGAGTCCAGGAAGG - Intronic
1002730932 5:181331404-181331426 CTGGGTGTCAGGAGACATGATGG + Intergenic
1002753601 6:142700-142722 CTGGGTGTCAGGAGACATGATGG - Intergenic
1003457930 6:6300750-6300772 CTCGGGGGGAGGAGCCAAGATGG - Intronic
1004179647 6:13370127-13370149 CTGGGGCTCAGGAACTGGGATGG - Intronic
1004260630 6:14104520-14104542 CTGGGGCTCAGGAGCAAGGTGGG - Intergenic
1004288228 6:14342595-14342617 CAGGAGCACAGGAGCCAGGATGG - Intergenic
1004513664 6:16303418-16303440 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1005882350 6:30071186-30071208 CAGGGGGCCAGGCGCCTGGAAGG + Exonic
1006012841 6:31056815-31056837 ATGGGTGTCAGGAGCCTGGTGGG - Intergenic
1006080139 6:31560381-31560403 CTGGGGGCCAGACACCAGGAAGG - Intergenic
1006377182 6:33678087-33678109 ATTGGAGTCAGGAGCCAGGGTGG - Intronic
1006395134 6:33782310-33782332 CTGAGAGCCAGGTGCCAGGAAGG - Intronic
1006510974 6:34520862-34520884 CCAGGAGCCAGGAGCCAGGAGGG - Intronic
1006519859 6:34564931-34564953 GGTGGGGTCATGAGCCAGGATGG + Intergenic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1006623148 6:35381210-35381232 CTGGAGGTCAGGAGGAGGGAAGG - Intronic
1006659817 6:35631407-35631429 CTGGGGCTCAGGGTCCAGGAAGG + Intronic
1006728024 6:36214120-36214142 CGGGGTGTCAGGGGCCATGAGGG - Exonic
1006981425 6:38151205-38151227 CTCTGGGTCAGGAACAAGGAGGG - Intronic
1007237838 6:40403715-40403737 CTGGGGGATGGGAGCAAGGAAGG - Intronic
1007407942 6:41645460-41645482 CTGGGGGTGAGGAGCAGGGAGGG - Intronic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1007872921 6:45062444-45062466 GTAGGGGTGAGGAGCCAAGATGG + Intronic
1007881761 6:45176058-45176080 CTTGGGGGGAGGAGCCAAGATGG + Intronic
1007930600 6:45687265-45687287 CCAGGGGTCAGGAGCAAAGATGG - Intergenic
1008635473 6:53406208-53406230 TTCGGGGACAGGAGCCAAGAAGG - Intergenic
1009282361 6:61769172-61769194 CTGGGAGGGAGGAGCCAAGATGG + Intronic
1009965808 6:70576940-70576962 TTGGAGGTCAGGAGTCTGGAAGG + Intronic
1011066595 6:83333949-83333971 CAGGGGGGGAGGAGCCAAGATGG + Intronic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1011409303 6:87050246-87050268 CAGAATGTCAGGAGCCAGGAAGG + Intergenic
1012427070 6:99126683-99126705 CTGGTGGTCAGGACCCACCAAGG - Intergenic
1012999894 6:106011603-106011625 CGGGGGGTGAGAAGGCAGGAGGG - Intergenic
1013124967 6:107174095-107174117 CTGGGGGCCATGAGTCAAGAGGG + Intronic
1013406698 6:109850067-109850089 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1014499367 6:122165840-122165862 CTGGTGGGAAGGGGCCAGGAAGG - Intergenic
1015768986 6:136749799-136749821 CTGGAAGTCAGCAGCCAGGGAGG + Intronic
1015893920 6:137998275-137998297 TTGGGGGGCAGGTGCCTGGATGG + Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1018716652 6:166538233-166538255 ATTGGGCACAGGAGCCAGGAAGG - Intronic
1019215206 6:170438875-170438897 CTGGGGGTCAGCAGGCTGGGGGG + Intergenic
1019504895 7:1385872-1385894 CTGGGAGTGTGAAGCCAGGAAGG + Intergenic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1019690552 7:2408581-2408603 CTGGGTGGCAGGAGACGGGAGGG + Intronic
1019715623 7:2538027-2538049 CTGGGGCTCAGGACCAAGGGAGG - Exonic
1019903311 7:4041604-4041626 CTGGGGGTCGGCAGTCAGGAGGG - Intronic
1020083405 7:5298098-5298120 CTGAGGGTCGGGAACCAGAATGG + Intronic
1020348312 7:7188606-7188628 CTGGGTGGCATGAGCAAGGAAGG - Intronic
1022498686 7:30869080-30869102 CTGGATGACAGGAGCCAGGAGGG - Intronic
1022520790 7:31005656-31005678 CTGGGAGGAAGGAGACAGGAAGG + Intergenic
1023402097 7:39797936-39797958 CTGGGTGTCAGGAGACATAACGG + Intergenic
1023743753 7:43303249-43303271 CTGGAGGCCAGGCTCCAGGAGGG - Intronic
1023980130 7:45064650-45064672 CAGGAGGTCAGGGGTCAGGAGGG + Intronic
1024076075 7:45818566-45818588 CTGGGTGTCAGGGGACATGACGG + Intergenic
1024353586 7:48392784-48392806 CTGGGGTGCATGGGCCAGGAAGG + Intronic
1024647526 7:51382723-51382745 CTGGGTGTCAGGAGACATGACGG - Intergenic
1024766533 7:52667590-52667612 CTGAGAGTCAGGAACCTGGAAGG - Intergenic
1025060130 7:55798474-55798496 CTGGGTGTCAGGAGACATGACGG - Intronic
1025128328 7:56362886-56362908 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025176711 7:56805767-56805789 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025695083 7:63770619-63770641 CTGGGTGTCAGGAGACATGACGG + Intergenic
1025721963 7:64025303-64025325 CTTGTGGGCAGGATCCAGGAAGG - Intergenic
1026445440 7:70480683-70480705 CTGTGTGGCAGGAGACAGGAAGG + Intronic
1026449189 7:70512428-70512450 CCGGGGGCCAGAAGCAAGGAAGG + Intronic
1026865604 7:73822386-73822408 CTGGGGAGCAGGAGGCAGGGTGG - Intronic
1026877226 7:73886698-73886720 CTGGGGGCCAGCGGACAGGATGG - Intergenic
1026902834 7:74046467-74046489 CTGGGGCCCAGGCCCCAGGAGGG + Intronic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1027058167 7:75064735-75064757 GTGGGGGTGAGTAACCAGGACGG - Intronic
1027689490 7:81325051-81325073 CAGAGGATCAGGAGCCAGGGGGG - Intergenic
1028211219 7:88077355-88077377 ATGAGGGTCGGGAGCCAAGATGG + Intronic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1029124965 7:98289401-98289423 CTGGGGGTCTGGACTCATGAGGG - Intronic
1029346311 7:99981118-99981140 CTTGGGGTGGAGAGCCAGGACGG + Intergenic
1029558861 7:101289398-101289420 CTTGGGGTGGAGAGCCAGGACGG - Intergenic
1030355518 7:108538329-108538351 CTGGGGGACAGAAGGCAGGGTGG - Intronic
1031085424 7:117297716-117297738 CAGGTGGTCATGAACCAGGATGG - Exonic
1031969691 7:128055180-128055202 CAGGGGGTTGGGAGGCAGGAAGG + Intronic
1032052610 7:128658329-128658351 CTGGGTGTCAGGAGACATGATGG + Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032153074 7:129446694-129446716 CTGGGGGAAAGAAGCCAGGGTGG + Intronic
1033601125 7:142889046-142889068 GAAGGGGTCAGGAGCCAAGAGGG + Intergenic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034275460 7:149821979-149822001 CTGGGTGTCAGGGCCCAGGCAGG - Intergenic
1034906365 7:154950957-154950979 CCAGGGGTCAGCAGGCAGGAAGG + Intronic
1035156223 7:156915524-156915546 ATGGGGGGGAGGAGCCAAGATGG - Intergenic
1035314693 7:157990608-157990630 CTGGGGGTCAGGGCTCAGGGCGG + Intronic
1035431909 7:158829048-158829070 CTGGTGGTCAGGGGTCGGGACGG + Intronic
1035702550 8:1647774-1647796 CTGGGGTTCATAAGCCAGGCAGG - Intronic
1035727461 8:1833778-1833800 ATGGGGGTCAGCGGCCAGGAGGG - Intronic
1035839853 8:2799633-2799655 CTTGAGTTCAGGAACCAGGAAGG - Intergenic
1037308709 8:17532329-17532351 ATTGGGGTCAGGAGGCAGCAGGG - Intronic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1038076778 8:24084704-24084726 GTGGGGGTCAGAAGACAGAAGGG - Intergenic
1039009154 8:33074290-33074312 CTGGAGGTCAGGAAACAGAAAGG + Intergenic
1039870661 8:41542449-41542471 ATGGGGTTTAGTAGCCAGGATGG - Exonic
1040588408 8:48765736-48765758 CAGGGGCCCAGGAGCAAGGATGG + Intergenic
1041113218 8:54507111-54507133 CTGGGTAACAGGAGCCAGGCCGG + Intergenic
1042487312 8:69361044-69361066 AAGAGGGTCAGGAGACAGGAGGG - Intergenic
1044727197 8:95203411-95203433 CTGGGCTTCAGGATCCAGGCTGG - Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046812531 8:118548533-118548555 CTGGAGGGGAGGAGCCAAGATGG + Intronic
1047149452 8:122244415-122244437 CCGGGGGGGAGGAGCCAAGATGG + Intergenic
1047328831 8:123865989-123866011 GTGGGGGGGAGGAGCCAAGATGG - Intronic
1047424102 8:124729720-124729742 CTTGGGGACAGGATCCAGCAGGG - Intergenic
1047786650 8:128159846-128159868 TTGGGGGTGAGGGGACAGGAAGG - Intergenic
1047815556 8:128459002-128459024 CTGGGAGGGAGGAGCCAAGATGG - Intergenic
1048453367 8:134554145-134554167 CTGGGAGTCAGGAGCAAGGAGGG - Intronic
1048471321 8:134706726-134706748 CTTGGGGTGAGGAGCAGGGATGG + Intronic
1048534831 8:135283534-135283556 GTTGTGGTCAGGAGCTAGGAGGG + Intergenic
1048596872 8:135875859-135875881 TTGGGGGGGAGGAGCCAAGATGG + Intergenic
1048627010 8:136196204-136196226 CTTGGGGGGAGGAGCCAAGATGG - Intergenic
1049211229 8:141387287-141387309 CTGGAGCTCAGCAGGCAGGAGGG - Intergenic
1049360246 8:142209374-142209396 CTGGGGGGCAGGAGGCTGGCAGG + Intergenic
1049487433 8:142873895-142873917 CTAGGGGTCAGGCTGCAGGAGGG + Exonic
1049488359 8:142878202-142878224 GAGGGAGTCAGGACCCAGGAAGG - Intronic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049786625 8:144454029-144454051 CTGGGAGGCAGGAGCCAAGCTGG + Intronic
1049826373 8:144671496-144671518 CTGGGGGTCAGGGAGCAGGTGGG - Intergenic
1050164466 9:2749404-2749426 CTTGAGGTCTGGAGCCAGGCTGG - Intronic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1052442236 9:28512019-28512041 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1052973826 9:34397903-34397925 GAGGGGGTCAGGAGCAGGGAGGG - Intergenic
1053025121 9:34723218-34723240 GTGAGGGTCAGGAGCTAGGTTGG + Exonic
1053036650 9:34832281-34832303 CTGAGGGTTAGGAGCTAGGGTGG + Intergenic
1053135681 9:35649173-35649195 CTGGGGATGAGGGGCCAAGAGGG - Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055860890 9:80747671-80747693 CTCGGGGGGAGGAGCCAAGATGG - Intergenic
1056965370 9:91160198-91160220 GTGGGGGCCAGGGGCCAGGAAGG - Intergenic
1057298095 9:93860984-93861006 CTGGGGGGCAGGATCCAGCAGGG + Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057351724 9:94304342-94304364 CTGGGGATCAGGGAACAGGAGGG - Intergenic
1057392874 9:94653916-94653938 CTGCCTGTCAGGAGCCAAGATGG + Intergenic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1058976074 9:110126742-110126764 GTGGGGGTCAGCAGCGGGGAGGG - Intronic
1059340298 9:113594205-113594227 GTGGGGGACAGGAGCCAGAGTGG + Intronic
1060222124 9:121770115-121770137 CTGGGGCTCAGGTGCCAAGGTGG + Intronic
1060223935 9:121780256-121780278 CTGGGGGTGGGGTGGCAGGAGGG - Intronic
1060256596 9:122036103-122036125 GTGGGGGTCCGGAGCAAGGGCGG - Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1061265221 9:129500819-129500841 TAGGGGGCCAAGAGCCAGGAGGG - Intergenic
1061931715 9:133836250-133836272 TGGGGGGCCAGGAGCCAGGGAGG + Intronic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062173211 9:135146935-135146957 CTGGGGCTGGGGAGCCAGCATGG - Intergenic
1062755338 9:138283911-138283933 CTGGGTGTCAGGAGACATGATGG + Intergenic
1203410362 Un_KI270581v1:3063-3085 GTGGGGGGGAGGAGCCAAGAAGG + Intergenic
1203579251 Un_KI270745v1:28083-28105 CTGGGTGTCAGGAGACATGATGG + Intergenic
1185431625 X:14715-14737 GTGGGCGTCAGGGGCCAGGCTGG - Intergenic
1185432888 X:19730-19752 GTGGGCGTCAGGGGCCAGGCTGG - Intergenic
1185440949 X:227434-227456 GTGGGCGTCAGGGGCCAGGCTGG - Intergenic
1185442240 X:232552-232574 GTGGGCGTCAGGGGCCAGGCTGG - Intergenic
1186214087 X:7280624-7280646 TTGGGGGTCAGGTGGAAGGATGG + Intronic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187552064 X:20316084-20316106 CTGGGTGTCAGGGCCAAGGACGG + Intergenic
1187947147 X:24437248-24437270 CAGGGGCTCTGGAGCCAGTAAGG + Intergenic
1188535989 X:31197149-31197171 CAGGAGTTCAGGGGCCAGGAAGG + Intronic
1189003124 X:36966376-36966398 CTAGGGGTAGGGAGACAGGATGG - Intergenic
1189154853 X:38746459-38746481 CTGGGGGACAGAAGGCAGGGCGG + Intergenic
1190260775 X:48795486-48795508 CTGTGGGTCAGGCGGCAGGCTGG + Intergenic
1190300590 X:49054774-49054796 ATGGAGGTCAAGAGGCAGGATGG - Intronic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191095676 X:56670906-56670928 CTGGGGGAGAGAAGACAGGATGG + Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1191946381 X:66539273-66539295 CTGGGGGTGAGAAGTCAGGGTGG - Intergenic
1192660583 X:73037818-73037840 CCGGGGGGCTGGAGCCAAGATGG - Intergenic
1192667159 X:73100065-73100087 ATGGGGGGCTGGAGCCAAGATGG - Intergenic
1193447181 X:81619030-81619052 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1193595432 X:83439380-83439402 CTGGTGGTGGGGAGACAGGATGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1195117797 X:101717088-101717110 GTGGGGGAGAGGAGCCAAGATGG - Intergenic
1196770913 X:119292431-119292453 GTGGGGGTCAGGATGCTGGATGG - Intergenic
1197628446 X:128830666-128830688 CTGGCAGTTAGGAGCCAGAATGG - Intergenic
1197824441 X:130573680-130573702 CTGGGAGGGAGGAGCCAAGATGG - Intergenic
1200114572 X:153764573-153764595 GTGGGGGTGGGGAGCCAGGCGGG - Intronic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200585734 Y:5003066-5003088 CTGCGAGCCAGGACCCAGGAGGG - Intronic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1202381859 Y:24280705-24280727 CTGGGTGTCAGGAGACATGATGG + Intergenic
1202488925 Y:25389420-25389442 CTGGGTGTCAGGAGACATGATGG - Intergenic
1202577124 Y:26339730-26339752 ATGGGGGAGAGGAGCCAAGATGG + Intergenic