ID: 1113294302

View in Genome Browser
Species Human (GRCh38)
Location 13:108941066-108941088
Sequence TCATTTTTGTTTCCAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113294302_1113294307 26 Left 1113294302 13:108941066-108941088 CCACAGGCTGGAAACAAAAATGA 0: 1
1: 0
2: 1
3: 35
4: 328
Right 1113294307 13:108941115-108941137 GAGTGAGACACAGGCTGGAAAGG 0: 1
1: 0
2: 5
3: 46
4: 400
1113294302_1113294304 -7 Left 1113294302 13:108941066-108941088 CCACAGGCTGGAAACAAAAATGA 0: 1
1: 0
2: 1
3: 35
4: 328
Right 1113294304 13:108941082-108941104 AAAATGAGTGAGACACAGGCTGG 0: 1
1: 1
2: 3
3: 41
4: 356
1113294302_1113294305 17 Left 1113294302 13:108941066-108941088 CCACAGGCTGGAAACAAAAATGA 0: 1
1: 0
2: 1
3: 35
4: 328
Right 1113294305 13:108941106-108941128 AACAAAAACGAGTGAGACACAGG 0: 1
1: 1
2: 4
3: 23
4: 309
1113294302_1113294306 21 Left 1113294302 13:108941066-108941088 CCACAGGCTGGAAACAAAAATGA 0: 1
1: 0
2: 1
3: 35
4: 328
Right 1113294306 13:108941110-108941132 AAAACGAGTGAGACACAGGCTGG 0: 1
1: 1
2: 2
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113294302 Original CRISPR TCATTTTTGTTTCCAGCCTG TGG (reversed) Intronic
900769797 1:4531604-4531626 TCCCCTGTGTTTCCAGCCTGTGG + Intergenic
900811940 1:4810336-4810358 TCATTTATGTATCAGGCCTGCGG - Intergenic
901616035 1:10540554-10540576 TTATTTTCGTTTTCATCCTGGGG - Intronic
901700541 1:11042950-11042972 TGCTTTTTGTTTCAATCCTGTGG + Exonic
901706894 1:11080720-11080742 TAATACTTGTTTCCAGACTGAGG - Intronic
901788176 1:11638373-11638395 ATGTTTTTGTTCCCAGCCTGAGG - Intergenic
902128173 1:14235115-14235137 TCATTTTTGTTTCCACTTTTTGG - Intergenic
904233539 1:29097962-29097984 TTAATTTTGTTTGCAGCCTTTGG - Intronic
905966489 1:42102687-42102709 ACATTTTTTTTTCCAGTTTGGGG - Intergenic
908337052 1:63137303-63137325 TCATTTCCTCTTCCAGCCTGTGG + Intergenic
908688244 1:66747709-66747731 TCAATTTAATTTACAGCCTGTGG - Exonic
909046321 1:70714375-70714397 ACATTCCTGTTTTCAGCCTGTGG + Intergenic
910244539 1:85124429-85124451 TCATTTGTTTTTCCTTCCTGAGG + Intronic
912628156 1:111223194-111223216 TCATTGTTATTTCCTCCCTGTGG + Intronic
912872340 1:113320189-113320211 ACATTATTCTTTCCAGCCTCTGG - Intergenic
912942005 1:114053499-114053521 TTATTTTTGTCTCCAGCCTTTGG + Intergenic
913718422 1:121564150-121564172 TCATCTTCATTTCTAGCCTGGGG + Intergenic
915007068 1:152648083-152648105 TCATTTCTGAGCCCAGCCTGGGG + Intergenic
915338456 1:155162363-155162385 TCCTTTCTGTTTTCAGCCTCCGG - Intergenic
916086082 1:161270560-161270582 TCTTTTTTTTTTTGAGCCTGGGG - Intronic
916887678 1:169086038-169086060 TCATCTTTGGCTTCAGCCTGAGG + Intergenic
917971413 1:180210496-180210518 TCCTTTCTGTGTTCAGCCTGTGG + Intergenic
919117546 1:193299020-193299042 TCATTTTTATTTCTACCCTTTGG + Intergenic
920753149 1:208701487-208701509 TCAATATTTTTTCCAGTCTGTGG - Intergenic
921426484 1:215007638-215007660 GCATTTTTGTTTCCTACTTGTGG - Intronic
921660591 1:217796543-217796565 ACATTTCTGTCTCCACCCTGGGG + Intronic
922087765 1:222367607-222367629 TCCCTTTTGTTTCCTTCCTGGGG + Intergenic
922116919 1:222622112-222622134 GTATTTTTGTTTGCAGCCTTGGG + Intronic
922814629 1:228439775-228439797 TCATTTCTGTGGCCTGCCTGGGG - Intergenic
923359505 1:233196432-233196454 ACATTTTTTTTTTCAGGCTGTGG - Intronic
923414074 1:233737713-233737735 TCGCTTTTGTTTCCAACCTTAGG + Intergenic
924162559 1:241247781-241247803 TCATTTTTAATTCCATCATGAGG - Intronic
924845387 1:247763682-247763704 TCATTCTTCTCTCCAGTCTGTGG + Intergenic
1063039404 10:2321483-2321505 TAATTTTTATTTCCAACATGTGG + Intergenic
1064558242 10:16568891-16568913 CCATTTTTGTTTCCAGTTTGGGG - Intergenic
1065201917 10:23320809-23320831 TTATTTTTGTTTGCAGAATGAGG - Exonic
1066059597 10:31710113-31710135 TAATTTTTGCTTACAGACTGGGG - Intergenic
1066182249 10:32974412-32974434 TCATTTTCGTTTCCTGTCTTTGG - Intronic
1066443902 10:35464389-35464411 TCATTTTTTTCACCAGCGTGCGG + Intronic
1068183468 10:53553530-53553552 TCATTTTTGTTTTCACACTGTGG - Intergenic
1068887666 10:62114317-62114339 TCACTTTTGTGCCCAGGCTGGGG - Intergenic
1069178464 10:65325467-65325489 TCCTTGGTGTTTCCAGCCTTTGG - Intergenic
1069443063 10:68446830-68446852 TCACTATTGTTCCCAGCCTCTGG - Intronic
1069726077 10:70579873-70579895 TCATATTTGTTTTCACCTTGTGG - Intergenic
1069771332 10:70902148-70902170 TCACTCTTGTTCCCAGGCTGAGG + Intergenic
1069824847 10:71248662-71248684 TCATTTTTCTTTGCAGCCCAAGG + Intronic
1071814196 10:89215292-89215314 TCATTTTGGTGCCCAGCCTACGG - Intronic
1076620977 10:131787909-131787931 TCATTTTCCTTGCCAGGCTGTGG - Intergenic
1076910037 10:133382896-133382918 TCTTTTTTGTTTCCCTCCAGTGG + Intronic
1078455522 11:11471707-11471729 TAAATTTTGTTACCTGCCTGGGG + Intronic
1079054563 11:17194414-17194436 TCTTTTTTCTTTCCTGCCTCAGG - Intronic
1079293750 11:19212841-19212863 TCATATTTTATTCCAGTCTGTGG + Intergenic
1079732139 11:23947311-23947333 TCATTTTTGTTTCTCCCTTGAGG + Intergenic
1079750190 11:24187082-24187104 TCATGCTTGTTTCCTGCCTTAGG - Intergenic
1079932307 11:26579462-26579484 TCATTGTTATTTGCTGCCTGTGG - Intronic
1080435800 11:32242297-32242319 TCTGTATTGTTTCCAGTCTGGGG - Intergenic
1081989939 11:47332378-47332400 CCATGTTTGTTTCCAGCCTTGGG - Intronic
1082171384 11:49009448-49009470 GCATCTGTATTTCCAGCCTGGGG + Intergenic
1082699761 11:56413400-56413422 TCATTTTCTTTGCCATCCTGAGG + Intergenic
1085142024 11:74154442-74154464 TCATTTATATTCCCAGCCTTTGG - Intronic
1086545684 11:87965101-87965123 ACATTTTTGGTTACAACCTGAGG - Intergenic
1086694508 11:89827648-89827670 GCATCTGTATTTCCAGCCTGGGG - Intergenic
1086711637 11:90016851-90016873 GCATCTGTATTTCCAGCCTGGGG + Intergenic
1088147351 11:106697905-106697927 TCATTGTTGTTCCAAGCCTAAGG - Intronic
1089807706 11:121106304-121106326 TCATTTTTCTTTCCCTTCTGGGG + Intronic
1091555333 12:1569192-1569214 TCATTTTCCTTTCCAGGTTGAGG + Intronic
1091932737 12:4409867-4409889 ACAATTTTTCTTCCAGCCTGAGG + Intergenic
1095438474 12:42217734-42217756 TTATATTTGTTTCCTTCCTGAGG - Intronic
1097325260 12:58269445-58269467 CCACTTTTGTTTCCAGAATGAGG + Intergenic
1097373290 12:58810236-58810258 TCATTTGTGTTTAAAGACTGAGG - Intronic
1097689987 12:62725791-62725813 TGATTTTTGCTGCCAGCCAGGGG - Intronic
1098719916 12:73883425-73883447 TCATTTTTGTTTCAATTTTGAGG - Intergenic
1098972597 12:76871922-76871944 TCATTTTTCTTACAAGCCTTTGG + Intronic
1100330870 12:93580772-93580794 TCATTTTTATTTCTAGGTTGTGG + Intronic
1100395578 12:94183705-94183727 TCATAATGGTTCCCAGCCTGGGG - Intronic
1100824816 12:98464680-98464702 ACATTGCTGTTTGCAGCCTGTGG - Intergenic
1103318169 12:120073855-120073877 TCACTTTTGTTTCAGGCTTGGGG - Intronic
1103611468 12:122126799-122126821 TCATTCTTGTTTCCAGAGAGGGG - Intronic
1103723139 12:122985324-122985346 CCAGTGTTGTTTCCAGCCTCAGG - Exonic
1104107039 12:125672658-125672680 ACATTTTTCTTTCAATCCTGGGG + Intergenic
1104265144 12:127225225-127225247 TCCTTCTGGTTTCCAGGCTGTGG - Intergenic
1104370003 12:128216023-128216045 TCCTTTCTGTTTCCAGCCTCTGG - Intergenic
1104537552 12:129632439-129632461 TCTTTTTTGCTTCCTTCCTGTGG + Intronic
1105370203 13:19795555-19795577 ACATTTTTCTTTCCTGCCAGTGG - Intergenic
1106431729 13:29687280-29687302 TCATTCTTTCTTCCATCCTGTGG - Intergenic
1106978172 13:35247152-35247174 TCAAGTTTGTTTCCAGGCAGTGG + Intronic
1107052009 13:36060900-36060922 TCACTTTTTCTTCCAGCCTATGG - Intronic
1108926142 13:55748271-55748293 TTTTTTTTTTTTCCAGCCTGGGG + Intergenic
1109921452 13:69066734-69066756 TCTTTTTTGTTTCCCTTCTGAGG + Intergenic
1110938326 13:81319389-81319411 TCATTTTTTTTTCCTGGATGAGG + Intergenic
1111611258 13:90610919-90610941 TCATTTTTTTTTTCATCCTTAGG + Intergenic
1111894570 13:94125395-94125417 GCATTTTTTTTCCCAGACTGAGG + Intronic
1112422727 13:99267894-99267916 TCACTTTTGTAACCACCCTGTGG + Intronic
1113294302 13:108941066-108941088 TCATTTTTGTTTCCAGCCTGTGG - Intronic
1113919903 13:113901415-113901437 TCTTATTTCTCTCCAGCCTGCGG - Intergenic
1116256986 14:42569960-42569982 TCAATTTTGTTTTCCCCCTGTGG - Intergenic
1116567593 14:46469531-46469553 TCATATTTTTTTCTAGTCTGGGG + Intergenic
1117095154 14:52289905-52289927 TCCTTATGATTTCCAGCCTGGGG - Intergenic
1117283971 14:54268120-54268142 TCATTTTTGGTACCAGTCTTTGG - Intergenic
1118010966 14:61610099-61610121 CATTTTTTATTTCCAGCCTGTGG + Intronic
1121633416 14:95437860-95437882 TGATTTTAGTTTCCATTCTGGGG + Intronic
1122192914 14:100061450-100061472 TTTTTTTTTTTTGCAGCCTGAGG - Intronic
1202893935 14_KI270722v1_random:185047-185069 TTATTATTTTTTCCAGCGTGAGG - Intergenic
1123966489 15:25465081-25465103 GCATTTTTTTTTCAAGGCTGTGG + Intergenic
1125213878 15:37246822-37246844 TCATTTGTGTTTCCAGCAATAGG - Intergenic
1128062732 15:64745549-64745571 TCATTTTACGTTCCAACCTGAGG - Intronic
1128386409 15:67152230-67152252 TCATTTTTGTTTCCACCAAATGG + Intronic
1129176854 15:73846563-73846585 TCATTTTCGTTTGCCGCCTTGGG - Intergenic
1130793701 15:87185839-87185861 TCATGTTTCTTTCCAGTCTGGGG - Intergenic
1131462908 15:92632158-92632180 TCAATTTTGTTTCCATCATGAGG + Intronic
1131989652 15:98080739-98080761 TCATTATTCTCTCCAGTCTGTGG - Intergenic
1132723020 16:1326230-1326252 TCAGTTTCGTTTCAAGCCTTGGG + Exonic
1132781646 16:1629830-1629852 TCATTTTTGCACCCAGACTGGGG + Intronic
1134335025 16:13290677-13290699 TCTCTCTGGTTTCCAGCCTGTGG + Intergenic
1135477167 16:22786783-22786805 TCATTCATCTTTCTAGCCTGGGG + Intergenic
1135799789 16:25482083-25482105 TCCTTTTTGTTTACTACCTGTGG - Intergenic
1136267984 16:29132030-29132052 TGATTTGTGTTTCCTGCTTGGGG - Intergenic
1137021724 16:35434458-35434480 TCATTTTTATTTACAGTGTGAGG - Intergenic
1139146555 16:64331860-64331882 TCATTCATGTTACCAGCCTCTGG + Intergenic
1139555494 16:67706757-67706779 TCATATTTTTTCCCAACCTGTGG - Intronic
1140483279 16:75274336-75274358 TGATTTTAGTGTGCAGCCTGGGG - Intergenic
1140869391 16:79092712-79092734 TCATTTTTGTGTTCAGTCTTGGG - Intronic
1141345276 16:83239254-83239276 TCTTTTTTATTTCCAACTTGAGG - Intronic
1142071291 16:88092368-88092390 TGATTTGTGTTTCCTGCTTGGGG - Intronic
1146118099 17:30161354-30161376 TCATTTTTGTCTCTTGTCTGTGG + Intronic
1149218007 17:54380890-54380912 TAATTTTTGTTTCATGGCTGAGG - Intergenic
1149499790 17:57143713-57143735 TCATTTTTGTTTTCCTCTTGGGG + Intergenic
1150036702 17:61808523-61808545 TCATACTTGTGTCCATCCTGAGG - Exonic
1151361127 17:73589693-73589715 CCACTTTGGGTTCCAGCCTGTGG - Intronic
1151380480 17:73722269-73722291 TCATGTGTCTTTCCAGCCAGCGG - Intergenic
1152846346 17:82602051-82602073 TTGTTTTTGTTTTCAGCCTATGG + Exonic
1152895732 17:82910065-82910087 TCATCTGGGTTTCCAGCCTTTGG + Intronic
1153225026 18:2893363-2893385 TCATATTTGTTTCCAGACACAGG + Intronic
1155196687 18:23481730-23481752 TCAATTATGTTTCCAGACTGTGG + Exonic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155398953 18:25417231-25417253 GAATTCTTGTTTCCATCCTGAGG - Intergenic
1157108597 18:44798545-44798567 TGGTTTTTCTTTCCACCCTGGGG - Intronic
1157305578 18:46514763-46514785 TCCTTTTTGTGTCCAGTCTAAGG + Intronic
1158670182 18:59467615-59467637 ACGTTTTTGTTTCCACCATGCGG - Intronic
1159886231 18:73909950-73909972 TCATTGATGTTTCCTGCCTGTGG - Intergenic
1160421776 18:78752998-78753020 TCATTTTGCTTTGCAGTCTGGGG - Intergenic
1164856549 19:31529176-31529198 ACATTTTTCATTCCATCCTGAGG - Intergenic
1168102607 19:54149015-54149037 CCATTTCTGTTACCTGCCTGAGG + Intronic
1168614336 19:57825728-57825750 TTATTTTTTTTTCCATCCTGTGG - Intronic
925423214 2:3728189-3728211 TCTTTCTCGTTCCCAGCCTGAGG - Intronic
925775403 2:7330334-7330356 TCATTTTTCTTTCCAGTCTTGGG + Intergenic
926243863 2:11107722-11107744 GCATTTTTATTTCCAGCAAGAGG + Intergenic
927176092 2:20409468-20409490 TCATATTTGTTCCCAGACTTGGG + Intergenic
928046022 2:27933044-27933066 TTATTTTTGTCTCAAGACTGTGG - Intronic
928620690 2:33084875-33084897 TGTTTTTGGTTTCCAGCCTTTGG + Intronic
928844389 2:35652198-35652220 TAATTTTTGTGTACAGTCTGAGG - Intergenic
928884624 2:36134237-36134259 TTAATTTTGTTTCCTCCCTGAGG + Intergenic
929728078 2:44453802-44453824 TCATTTTTCTTTCCTGCCATGGG + Intronic
929872410 2:45770306-45770328 TCAGTGTTGTTTCCAGACAGAGG - Intronic
930351915 2:50267481-50267503 TCATTTTTGTTTTCAACTTTGGG - Intronic
931227601 2:60346801-60346823 AAATATTTGTTTCCAGTCTGTGG - Intergenic
931802924 2:65776388-65776410 TCATTGTTGTTGCCATGCTGGGG + Intergenic
932551790 2:72777578-72777600 TGTTTTTTCTTTCCAGCCTGAGG - Intronic
932966627 2:76483206-76483228 TCATTTTTTATACCAGCTTGTGG - Intergenic
933073000 2:77885650-77885672 TTATTTATGTTTCCACCATGAGG - Intergenic
933389800 2:81655013-81655035 ATATTCTTGTTTCCACCCTGAGG + Intergenic
935814235 2:106831465-106831487 TCAACTTCCTTTCCAGCCTGAGG - Intronic
936073502 2:109386732-109386754 GCAGTTTTGTTTCCAGCCCTAGG - Intronic
936653264 2:114454709-114454731 CCCTTTTTTTTTCCAGCCTCAGG + Intronic
936988191 2:118332147-118332169 GCATTTTTTTTTCCACCCAGTGG + Intergenic
940433018 2:153616136-153616158 TCATTTTTTTTTTCTGCATGTGG + Intergenic
940497331 2:154448944-154448966 TCATTTTTGTTACGTACCTGTGG - Intronic
941378221 2:164757457-164757479 TCATTTTTGTTTCTTTCATGAGG - Intronic
941482060 2:166028297-166028319 GCATTTTGGTTTCTAGCTTGGGG - Intronic
944202147 2:197119205-197119227 TCCTTTTTTTTTCCTGCCTTTGG + Intronic
944586958 2:201181052-201181074 TCATTATTTGTCCCAGCCTGGGG - Intergenic
945930487 2:215850049-215850071 TCATTTTCATTTCCTTCCTGAGG + Intergenic
946616084 2:221511998-221512020 TCATTTTTATTTCAGGCATGAGG - Intronic
947316315 2:228863119-228863141 TAATTTTTTTTTCCAGCAAGAGG - Intronic
948538906 2:238671218-238671240 TTTTGTTTGTTTCCAGCTTGAGG + Intergenic
1169987429 20:11461002-11461024 TCATTTGCTTTGCCAGCCTGGGG + Intergenic
1170231885 20:14057748-14057770 CCATTTTTGTTTCCAGGTTTCGG - Intronic
1173539516 20:43840954-43840976 TTATTTGTGCTCCCAGCCTGTGG + Intergenic
1175475932 20:59274355-59274377 TCACTTTTGTTTCCTCTCTGCGG - Intergenic
1177218410 21:18159123-18159145 ACATTTTTGTCACCAGCTTGTGG + Intronic
1177715193 21:24831487-24831509 TGATTTTTGTTTCTATTCTGAGG + Intergenic
1177717724 21:24861536-24861558 TGATTTTGGTTTCCAGCTAGTGG - Intergenic
1178122810 21:29486138-29486160 TCTTTTTTCTTTCCATCATGCGG + Intronic
1178249198 21:30985839-30985861 TCATTTTTCTTTTCAGTCTATGG + Intergenic
1178836247 21:36100082-36100104 TTAATTTCGTTTCCATCCTGTGG + Intergenic
1179590228 21:42403237-42403259 ACATTTTTGTTTCCAAAATGAGG - Intergenic
1180566797 22:16675725-16675747 CCATTTCTGTTTCCAGTCTTGGG + Intergenic
1181145726 22:20845106-20845128 TCATATTTGTTGCCTCCCTGTGG - Intronic
1184793339 22:46715736-46715758 TCATCTTTGTGTCCAGTGTGAGG - Intronic
949347325 3:3088971-3088993 TCGTATTTGTTTCCCTCCTGGGG + Intronic
949621581 3:5818711-5818733 TCACTTGTGTTTTCAGCCTGGGG + Intergenic
949822343 3:8128981-8129003 TCAATTTGGTTTCCAGGGTGTGG - Intergenic
951093744 3:18604270-18604292 TCATTTTTGGTGTCAGGCTGAGG + Intergenic
951285383 3:20806091-20806113 TGATTTTAGTTTCCAGCCATAGG + Intergenic
955441425 3:58959429-58959451 TTATTTTTGTTTACAGTGTGAGG + Intronic
956261419 3:67347135-67347157 TCATTTTACATTCCAACCTGTGG - Intergenic
956292776 3:67679080-67679102 TAATTTGAGTTTCCAACCTGTGG - Intergenic
956401683 3:68886515-68886537 TCATTTTGGTTTCCAATATGTGG - Intronic
957460755 3:80516584-80516606 TTATTTTTGTTTGCAACTTGGGG + Intergenic
957548658 3:81674851-81674873 TCATGTTTATTTCCATCCTCAGG - Intronic
959618767 3:108377706-108377728 TCATCTTGGTTTCCAGGCTCTGG - Exonic
960486881 3:118263354-118263376 TCTTTTTTGTTTCCTGCTTTAGG - Intergenic
960490047 3:118306252-118306274 TAGCTTTTCTTTCCAGCCTGTGG - Intergenic
960584744 3:119310430-119310452 TCATACCTGTTTGCAGCCTGAGG - Intronic
963045739 3:141101376-141101398 GCACTTTTGTCTTCAGCCTGGGG + Intronic
963438976 3:145312561-145312583 TTATTTTTGTTTCCAACCCAGGG + Intergenic
963777622 3:149455152-149455174 TCATTTGTGTTTCCAGTTTGGGG - Intergenic
963778356 3:149462994-149463016 TTATTTATTTTTCCATCCTGTGG - Intergenic
963779426 3:149472302-149472324 TCAGTTTTCTTTCAAGCCTGAGG - Intergenic
965637268 3:170795523-170795545 TCATTATTGCTTCCAGTTTGGGG + Intronic
965730702 3:171769184-171769206 TTATTTTTGTTTCGAATCTGTGG + Intronic
965750100 3:171966842-171966864 TCAATTCTGTTTCCATCCTGGGG - Intergenic
966038279 3:175447318-175447340 TCATTTTTGGTTCTAGCTTTTGG - Exonic
967300267 3:188005578-188005600 TCATTTGGATGTCCAGCCTGAGG - Intergenic
970168437 4:13264271-13264293 ACATGTTTGTTCCCTGCCTGAGG + Intergenic
970305951 4:14733086-14733108 TCTTTTTTCTTTCCAGTCTTGGG - Intergenic
970573066 4:17401525-17401547 TCTTTTATGTTTCCTGTCTGTGG - Intergenic
971049279 4:22842367-22842389 GTATTTTTGTTTCCAGACTGAGG + Intergenic
972126657 4:35775472-35775494 TCATTTTGGTTTTCAGCATATGG - Intergenic
972458933 4:39281338-39281360 TGATTTTTGTTTCCAGTGTGAGG + Intronic
974189031 4:58479167-58479189 TGTTTCTTGTTTCCAGTCTGAGG + Intergenic
974369474 4:60996443-60996465 TTATTTTTGTTTCAAGCATCAGG - Intergenic
975496420 4:75040431-75040453 TCCTTTTTTTTTCCAGACTCTGG - Intronic
975797414 4:78022701-78022723 TTATTCTTGTTTCCAGCAGGAGG + Intergenic
976600425 4:86933455-86933477 TCATTTTATTTTCCTGCCTTTGG - Exonic
976601566 4:86942580-86942602 TCATGTTTGTTCTCAGCCAGTGG + Intronic
976733453 4:88286663-88286685 TCATTTTGTTTTCCATTCTGTGG + Intergenic
977022324 4:91773471-91773493 TCTTTTTTTTTTCCAGTCTCAGG - Intergenic
978265599 4:106820905-106820927 TAATTTTTGTTTACAGAGTGAGG + Intergenic
979046709 4:115875164-115875186 TCATTTTTTTTTCCACTATGAGG - Intergenic
979093416 4:116516485-116516507 TAGTTTTTGTTTTAAGCCTGGGG + Intergenic
982047191 4:151460297-151460319 TCATTTTTTTGTCCAGCCATGGG - Intronic
982973149 4:162016648-162016670 TCATTCTTATTTGAAGCCTGGGG - Intronic
984096728 4:175443990-175444012 TCAGTTTTGTATCCTGTCTGTGG - Intergenic
984704640 4:182838879-182838901 TCATTTTTGCCTCAAGCCTGGGG - Intergenic
986415069 5:7520061-7520083 ACATTTGTGTTTCCACCTTGGGG + Intronic
987164091 5:15175075-15175097 TCATCTGTATTTCCAGCCAGAGG - Intergenic
987463086 5:18237761-18237783 TCTCTTTTATTTCCAGCCTCTGG + Intergenic
987480767 5:18454554-18454576 TCATGTATATTTCCATCCTGGGG + Intergenic
988754159 5:34227981-34228003 TTTTTTTTTTTTTCAGCCTGGGG + Intergenic
989705647 5:44327099-44327121 TCAGCGTGGTTTCCAGCCTGAGG + Intronic
989960173 5:50403915-50403937 TCATCTTCATTTCTAGCCTGGGG - Intronic
990965758 5:61445854-61445876 TCATTTGTGTTTCTAGGCTCTGG - Intronic
991741934 5:69688823-69688845 TTTTTTTTTTTTTCAGCCTGGGG + Intergenic
991755759 5:69866385-69866407 TTTTTTTTTTTTTCAGCCTGGGG - Intergenic
991793508 5:70268563-70268585 TTTTTTTTTTTTTCAGCCTGGGG + Intergenic
991821320 5:70564126-70564148 TTTTTTTTTTTTTCAGCCTGGGG + Intergenic
991835086 5:70741533-70741555 TTTTTTTTTTTTTCAGCCTGGGG - Intergenic
991885885 5:71268095-71268117 TTTTTTTTTTTTTCAGCCTGGGG + Intergenic
992028812 5:72699809-72699831 TTATAATTGTTTCCAGCTTGGGG + Intergenic
993013612 5:82511076-82511098 TTATGTGTCTTTCCAGCCTGAGG + Intergenic
993861510 5:93142353-93142375 TCTTTTTTGTTTAAATCCTGTGG - Intergenic
995149718 5:108828443-108828465 TCATTTTTGTTGGTATCCTGTGG + Intronic
996835803 5:127790611-127790633 TCCTTTTTCTTCCCAGCCTCTGG + Intergenic
997515783 5:134488746-134488768 CAATTTTTTTTTCCAGTCTGTGG + Intergenic
998003969 5:138645013-138645035 TCATTTCTGTCTCAAGCCTGAGG - Intronic
999159823 5:149485964-149485986 TCATCTGAGTTTACAGCCTGAGG + Intergenic
1000479834 5:161758414-161758436 TCCTTTTTGTCTCCAATCTGAGG - Intergenic
1000582753 5:163054175-163054197 TCATTTTTCTTCCCATCCTCTGG - Intergenic
1001063396 5:168514199-168514221 TCATTTTTGTTTTTACCCTTTGG + Intronic
1001685831 5:173594165-173594187 CCATTTTTGTCTTCACCCTGGGG + Intergenic
1001806933 5:174594702-174594724 TCATTTTTAGTTCTAGCCTGAGG - Intergenic
1002397912 5:178972365-178972387 TCATTTTTCTTTCCAATTTGGGG + Intergenic
1002760263 6:196479-196501 ACATTTTTATTTCATGCCTGTGG - Intergenic
1002829935 6:810921-810943 TCATTTTCATTTTCAGCCTGAGG + Intergenic
1002968842 6:1993556-1993578 ACTTTTTTGTTTCTTGCCTGAGG - Intronic
1003135748 6:3433636-3433658 GCAGGGTTGTTTCCAGCCTGTGG - Intronic
1004410144 6:15373901-15373923 TCATTCTTTTTAACAGCCTGTGG + Intronic
1004444534 6:15685962-15685984 TTTTTTTTGTTTACAGTCTGTGG + Intergenic
1004988624 6:21111744-21111766 TCATTTTTGTTTGTTGCCTCTGG + Intronic
1005552337 6:26934822-26934844 TTTTTTTTTTTTTCAGCCTGGGG + Intergenic
1005793242 6:29329187-29329209 CCATTTTTTTTTTAAGCCTGAGG - Intergenic
1006905957 6:37533763-37533785 TCCTCTTTGATGCCAGCCTGGGG - Intergenic
1006913076 6:37576740-37576762 TCATCTCAGTCTCCAGCCTGCGG - Intergenic
1007026854 6:38584884-38584906 TCTTTTTTATTTCCATTCTGTGG - Intronic
1007616274 6:43181490-43181512 TCATTTTTGTGCACAGACTGTGG + Exonic
1008028394 6:46665297-46665319 ACATTGAGGTTTCCAGCCTGGGG - Intronic
1008145268 6:47884318-47884340 TCACTTTGGTTTCCATTCTGAGG + Intronic
1008211769 6:48733258-48733280 TCAGTTTTGTTCCCAGGCTTAGG + Intergenic
1008767246 6:54933869-54933891 ACTCTTTTGTTTCCATCCTGAGG + Intronic
1009721912 6:67482669-67482691 TCCTTCTTTTTTCCAGGCTGGGG + Intergenic
1010101342 6:72111873-72111895 TCATACTTGTCTCCAGCCTCTGG + Intronic
1010185500 6:73139098-73139120 GCCATTTTGCTTCCAGCCTGAGG - Intronic
1012331976 6:98002722-98002744 TTATTCTGGTTTCCAGGCTGAGG + Intergenic
1013328807 6:109076604-109076626 TCATTTTTGTTTCCTTTTTGTGG - Intronic
1013560505 6:111299324-111299346 ACATTTTTGTTACAAACCTGTGG - Exonic
1013746843 6:113355821-113355843 TAATTTTTGCTTCCTTCCTGTGG + Intergenic
1014061410 6:117076096-117076118 GCATTTTTTTTTCCAGAATGGGG - Intergenic
1017175860 6:151504280-151504302 TCATTTTTATTTCAATCCTACGG - Intronic
1017984139 6:159427710-159427732 TCATTTTTGTTCCTAGTATGGGG + Intergenic
1019861795 7:3665772-3665794 TCACTTTTGTCTCCAGACTTTGG - Intronic
1019941726 7:4297462-4297484 CCATTGTTTTTTTCAGCCTGAGG - Intergenic
1021510165 7:21426472-21426494 GCATTTTTGTCTCCTGCCTGAGG - Intergenic
1022184991 7:27958641-27958663 TCGTTCTTGTTTCGAGCCAGGGG + Intronic
1022532463 7:31075632-31075654 TCACTTTTCCTTCCAGCCTGTGG - Intronic
1023177563 7:37448528-37448550 ACACTTTTGTTTCCTCCCTGGGG - Intronic
1023869615 7:44255987-44256009 CCATTTTTCTGTCCAGGCTGGGG + Intronic
1024798207 7:53044542-53044564 TCATTTTTGTTTCAAAGCTGCGG - Intergenic
1026388451 7:69875546-69875568 CCATTTTTGTGTAGAGCCTGTGG + Intronic
1026655518 7:72253159-72253181 TCATTTTGGTTTTCAGCATCTGG + Intronic
1027267398 7:76501859-76501881 TCACCTGTGTCTCCAGCCTGTGG + Intronic
1027319211 7:77001724-77001746 TCACCTGTGTCTCCAGCCTGTGG + Intergenic
1027488546 7:78792472-78792494 TCACACTTATTTCCAGCCTGAGG - Intronic
1027958754 7:84916893-84916915 TGTTCTTTGTTTCGAGCCTGTGG + Intergenic
1028292207 7:89079266-89079288 TCATTTTTTTTTCTACCCAGGGG + Intronic
1028380418 7:90193432-90193454 TTCTTTTTCTTTCCAGACTGTGG + Intronic
1031099088 7:117456493-117456515 TCCTTTTACTTTCCAGCCTAGGG + Intergenic
1031708318 7:125011196-125011218 TAATTTTTTTTTCAATCCTGTGG + Intergenic
1031774514 7:125890730-125890752 TCATTTTTTTTTCCTTTCTGAGG + Intergenic
1032766460 7:134998822-134998844 TTCTTTTTTTTTCCAGCCTGGGG - Intronic
1034232807 7:149545998-149546020 TCAGTTGTGCTTCTAGCCTGAGG + Intergenic
1034511881 7:151542345-151542367 TCCTTTCTGTCTCCAGGCTGTGG - Intergenic
1035119538 7:156554766-156554788 TCATTGTTCTTTCCCGCCTGTGG - Intergenic
1035746380 8:1964385-1964407 TCCCTTTTGTTGCCAGCATGTGG + Intergenic
1035964352 8:4173937-4173959 TTGTTTTTGTTTCAAGGCTGAGG - Intronic
1035966866 8:4201954-4201976 TCATTTTTGTTTTCTGTCTCAGG - Intronic
1036517872 8:9461698-9461720 TCACTTTTGCATCCACCCTGTGG + Intergenic
1037531683 8:19781937-19781959 TTATTTTTGTTTGTTGCCTGTGG - Intergenic
1038913895 8:31998187-31998209 AAATTTTTGATTCCAGCCTAGGG + Intronic
1039195809 8:35030340-35030362 CCATTCTTGTTTCCAGTCTTGGG - Intergenic
1040544322 8:48385172-48385194 TCTTTTTTTTTTCCTGCCTCCGG - Intergenic
1040995280 8:53394876-53394898 TTAATTTTGTTTTCAGCCAGTGG - Intergenic
1042132681 8:65604033-65604055 TCATTTTCTTTTCAAGCCTCAGG - Exonic
1043489250 8:80731884-80731906 TCATTCTTGTTTCTAGCCCTTGG - Intronic
1043753862 8:83977229-83977251 TAATTTTTGTTTATAGCATGAGG - Intergenic
1044277950 8:90323732-90323754 TCTGTTTTCTTTACAGCCTGTGG + Intergenic
1044298938 8:90561371-90561393 TCATTTTAGTTTACAGCAGGAGG + Intergenic
1044518388 8:93167234-93167256 TCTTTTTTGTCTCCAGCTTGAGG + Intergenic
1045115923 8:98979665-98979687 TTCTTTTTATATCCAGCCTGTGG - Intergenic
1045242130 8:100411850-100411872 TGGTTTTTGTTTCCAGCCTTCGG + Intergenic
1045667255 8:104501754-104501776 TAATATTTTCTTCCAGCCTGTGG + Intronic
1050221688 9:3398325-3398347 TTTTTTTTGTTTCCTGTCTGTGG - Intronic
1050412616 9:5382481-5382503 TCATTCTTCTTTCCAGGCTTTGG - Intronic
1051628480 9:19121186-19121208 TCATTTTTCTCACCAGCCAGGGG - Intronic
1053243140 9:36513183-36513205 TCTTTTTTTTTTCCAGACAGGGG - Intergenic
1055575151 9:77653731-77653753 TCATTTTTGTTTCCAGTTTGGGG + Intergenic
1055637669 9:78294850-78294872 AGTTTTTTGTTTTCAGCCTGTGG + Intergenic
1056059666 9:82870994-82871016 TCAGGTTTGTTTCCAGTTTGGGG - Intergenic
1056480446 9:86998172-86998194 TTATTTATCTTTCCATCCTGGGG - Intergenic
1057513798 9:95703979-95704001 TCATTTTTGATTGCTGCGTGAGG + Intergenic
1058233842 9:102464337-102464359 TCACTTTTGTTCCCAGGCTGGGG - Intergenic
1058344042 9:103937377-103937399 CAATTTTTGTTTCCTGTCTGTGG - Intergenic
1059128623 9:111720334-111720356 TTATCTTTGTTTCCTGCATGTGG + Intronic
1059422295 9:114199765-114199787 TCATCTTTGTTTCCCACGTGGGG + Intronic
1060840242 9:126787249-126787271 TAATTTTTGTTTACAGTGTGAGG - Intergenic
1060868501 9:127019709-127019731 ACATTTGTGTTTCCAGGTTGAGG + Intronic
1061004244 9:127919425-127919447 TCACTTTCCTTTCCAGCCTGAGG + Intergenic
1189258443 X:39658963-39658985 TCATTTTTTATTTCAGCCTGGGG - Intergenic
1190034881 X:47012783-47012805 TCATTTTTGTATCTGGCTTGAGG + Intronic
1190271598 X:48868313-48868335 TCATTTTTGTATCCATTCTTTGG + Intergenic
1190382457 X:49853033-49853055 GGATTTCTGTTTCCAGCCTGAGG + Intergenic
1191600959 X:63005987-63006009 TCATTTTATTTTTCTGCCTGCGG + Intergenic
1192308438 X:69988241-69988263 TCATTATCCTTTCCAGCCTCTGG - Intronic
1194534663 X:95091466-95091488 TGATTTTTGTTTGCAGCAAGAGG - Intergenic
1195116438 X:101703667-101703689 TCACTTCTCTTTCCAGCCTCTGG - Intergenic
1195490396 X:105462095-105462117 TCATTAATTCTTCCAGCCTGGGG + Intronic
1196148543 X:112346242-112346264 TCATTTTAGTTTCCTTACTGTGG + Intergenic
1196527505 X:116743660-116743682 CCATTCTTGATTCCAGCCTTGGG - Intergenic
1197634944 X:128904201-128904223 TCATTTTTCTTTCCTCCCTGGGG - Intergenic
1197981894 X:132226065-132226087 TCATTTTTGGTTCCCTGCTGGGG - Intergenic
1198297354 X:135300841-135300863 TGCTTTTTGTTTGCAGCCAGAGG - Intronic
1199317973 X:146402328-146402350 TTATGTTTGTTTCCAGGCTCAGG - Intergenic
1200705936 Y:6442443-6442465 TCAAATTTGTTTCCCACCTGAGG - Intergenic
1201028174 Y:9722265-9722287 TCAAATTTGTTTCCCACCTGAGG + Intergenic
1201983824 Y:19939278-19939300 TCCTTTCAGTTTCCAGCCTCTGG + Intergenic