ID: 1113295319

View in Genome Browser
Species Human (GRCh38)
Location 13:108953414-108953436
Sequence CATTGCAACCTGAGTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113295315_1113295319 29 Left 1113295315 13:108953362-108953384 CCTGCATAGGCAAGATGTAGTCA 0: 1
1: 0
2: 1
3: 3
4: 90
Right 1113295319 13:108953414-108953436 CATTGCAACCTGAGTGTAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113295319 Original CRISPR CATTGCAACCTGAGTGTAGG AGG Intronic
902460699 1:16574246-16574268 CATAGTCACCTGAGTGCAGGAGG - Intronic
902866292 1:19282167-19282189 CATTGCAACATGAGATTTGGAGG - Intergenic
903159315 1:21473804-21473826 CATAGTCACCTGAGTGCAGGAGG + Intronic
904869921 1:33610451-33610473 CAGGGGAACCTGAGTGTAGATGG + Intronic
904887509 1:33752207-33752229 CATTTCAACCTGAGATTTGGAGG - Intronic
905512808 1:38536132-38536154 CATTTCAACCTGAGTTTTGGAGG - Intergenic
911393323 1:97274201-97274223 CATTTCAACCTGAGATTTGGAGG - Intronic
912762887 1:112384882-112384904 CATTTCAACCTGAGATTTGGAGG - Intergenic
912788498 1:112627546-112627568 CACTTGAACCTGAGAGTAGGAGG + Intronic
913454079 1:119013207-119013229 AATTTCAACATGAGTTTAGGAGG - Intergenic
913604718 1:120454333-120454355 CATAGTCACCTGAGTGCAGGAGG + Intergenic
913641589 1:120817045-120817067 CATAGTCACCTGAGTGCAGGAGG + Intronic
913990356 1:143606268-143606290 CATAGTCACCTGAGTGCAGGAGG - Intergenic
914083823 1:144434870-144434892 CATAGTCACCTGAGTGCAGGAGG - Intronic
914189843 1:145400148-145400170 CATAGTCACCTGAGTGCAGGAGG - Intronic
914211692 1:145585850-145585872 CATAGTCACCTGAGTGCAGGAGG - Intergenic
914276895 1:146133282-146133304 CATAGTCACCTGAGTGCAGGAGG - Intronic
914537939 1:148584230-148584252 CATAGTCACCTGAGTGCAGGAGG - Intronic
914586855 1:149070694-149070716 CATAGTCACCTGAGTGCAGGAGG - Intronic
914627984 1:149481103-149481125 CATAGTCACCTGAGTGCAGGAGG + Intergenic
915006128 1:152638760-152638782 AATTGCAACATGAGTGTTGGAGG - Intergenic
915374923 1:155385828-155385850 CACTGAAACCTGAGTGTTGGGGG + Intronic
916475667 1:165166349-165166371 CATTCCACCCAGAGTGTTGGTGG + Intergenic
917565892 1:176211009-176211031 CATTTCAACCTGAGTTTTGGTGG - Intergenic
918297465 1:183170432-183170454 CATTTCAACATGAGTTTTGGAGG + Intergenic
919773574 1:201178655-201178677 CATTTCAACATGAGTTTTGGAGG - Intergenic
923034812 1:230278410-230278432 CCTTTCAGCCTGAGTGCAGGCGG - Intronic
924278064 1:242408362-242408384 CATTTCAACCTGAGATTTGGAGG - Intronic
1065911120 10:30306943-30306965 CATTTGAACCTGAGGGTTGGAGG - Intergenic
1071026282 10:81117807-81117829 CATGGCAATCTGAGAGGAGGTGG + Intergenic
1071934326 10:90509891-90509913 CATTTCAACATGAGTTTTGGAGG + Intergenic
1072667510 10:97405009-97405031 CATTTCAACCTGAGTGACAGAGG - Intronic
1073961859 10:108940787-108940809 CGTTGCAAGCTGAGTTTAGAAGG - Intergenic
1075658728 10:124178615-124178637 CATTTCAACATGAGTTTGGGAGG + Intergenic
1076657510 10:132034695-132034717 CATGGCAATCTGAGTGTCTGAGG + Intergenic
1077427159 11:2486879-2486901 CATTTCAACATGAGAGTTGGAGG + Intronic
1080414129 11:32053722-32053744 CAGTGCAACTGCAGTGTAGGGGG + Intronic
1080622471 11:33998062-33998084 GATAGCAACCTGAGAGTATGGGG + Intergenic
1080745727 11:35106971-35106993 CAGTGCAACTTGAGTGTTGGAGG + Intergenic
1082947673 11:58776941-58776963 CCTTGTAACTTGAGTGTAAGGGG - Intergenic
1083140510 11:60717546-60717568 AATTGCAACATGAGTTTTGGAGG - Intergenic
1083716674 11:64581446-64581468 CATTGCAGCCTCCGTGTGGGCGG + Intergenic
1083919986 11:65777387-65777409 CATTTCAACGTGAGCGTGGGAGG - Exonic
1085847272 11:80080421-80080443 AATTTCAACCTGAGTTTGGGAGG + Intergenic
1087513070 11:99122710-99122732 CATTGCAGCCTAGTTGTAGGTGG - Intronic
1087537880 11:99474933-99474955 CATTTCAACGTGAGTTTTGGAGG - Intronic
1087781056 11:102301935-102301957 CATTTCAACATGAGATTAGGAGG + Intergenic
1088391325 11:109318214-109318236 CATTTCAACGTGAGTGTTGGAGG - Intergenic
1088870896 11:113889703-113889725 AATTTCAACCTGAGTTTTGGAGG + Intergenic
1089347430 11:117799425-117799447 TCCTACAACCTGAGTGTAGGAGG + Intronic
1089669400 11:120043076-120043098 CATTGCAACATGAGATTTGGAGG + Intergenic
1089926683 11:122265901-122265923 CATTGCAGCCACAGTGTACGTGG + Intergenic
1090030339 11:123200889-123200911 CTTTGCATCCTGAGTGCTGGTGG - Intergenic
1090169016 11:124581982-124582004 AATTTCAACATGAGTGTTGGTGG - Intergenic
1092742176 12:11640520-11640542 CACTGGAACCTGAGAGTTGGAGG - Intergenic
1093056801 12:14564128-14564150 CATTGCAGCCTCAGAGTAGATGG - Intronic
1093536945 12:20233285-20233307 CATTTCAACTTGAGAGTTGGAGG + Intergenic
1093638002 12:21494302-21494324 CATTTCAACATGAGATTAGGAGG + Intronic
1098028359 12:66229775-66229797 GGTTGCAAGCTGAGTGGAGGAGG - Intronic
1099360798 12:81698204-81698226 CATTTCAACATGAGTTTTGGAGG - Intronic
1100175783 12:92029386-92029408 CAATGCAACATGTATGTAGGTGG - Intronic
1100983919 12:100187187-100187209 CATTTCAACATGAGTTTTGGAGG - Intergenic
1104644512 12:130487254-130487276 CATTTCAACCTGAGGTTTGGAGG - Intronic
1104696289 12:130866606-130866628 CATTTCAGCCTGAGAGTTGGAGG - Intergenic
1104773196 12:131377392-131377414 CATGTCAACCTGAGTTTTGGTGG + Intergenic
1105602404 13:21899231-21899253 CATTTCAATCTGCTTGTAGGAGG + Intergenic
1106994128 13:35461146-35461168 AATTTCAACCTGAGTTTTGGAGG + Intronic
1107182550 13:37478433-37478455 CATTTCAACATGAGTTTTGGAGG - Intergenic
1107724218 13:43281580-43281602 AATTGCCAACTGAGAGTAGGGGG - Intronic
1108972619 13:56396084-56396106 CATTTCAACATGAGTTTTGGAGG + Intergenic
1109058520 13:57582571-57582593 CATTGGATCCTCAGTGTAGCTGG - Intergenic
1110829439 13:80013308-80013330 CATTTCAACATGAGTTTGGGTGG - Intergenic
1111562853 13:89974605-89974627 AATTGTAATCTCAGTGTAGGAGG - Intergenic
1111968135 13:94881632-94881654 CATTGCAACATGAGATTTGGAGG + Intergenic
1111987551 13:95080254-95080276 CATTGCCAAATGAGTGGAGGTGG + Intronic
1112932868 13:104763367-104763389 CATTTCAACCTGAGGTTTGGAGG - Intergenic
1113295319 13:108953414-108953436 CATTGCAACCTGAGTGTAGGAGG + Intronic
1115843551 14:37500525-37500547 CATTGCAACCTGAGACTTGTAGG + Intronic
1116688867 14:48079279-48079301 CATTTCAACATGAGTTTTGGAGG + Intergenic
1117034853 14:51717520-51717542 GATTTCAACCTGAGTTTAGGAGG + Intronic
1118908787 14:70044100-70044122 CATTGGCACCTGAGTGTGAGAGG + Intergenic
1119369692 14:74128864-74128886 CATTGCAACCTCAGTCTCGCAGG - Intronic
1119508666 14:75194147-75194169 CATTTCAACATGAGTTTTGGAGG - Intergenic
1119658233 14:76432526-76432548 CACTGCAGGCTGAGTGGAGGTGG + Intronic
1120356075 14:83435722-83435744 CACTCCAACCTGAGTGACGGAGG - Intergenic
1121372713 14:93375042-93375064 AATTGCAACATGAGTTTTGGAGG - Intronic
1121615310 14:95310057-95310079 CATTTCAACCTGAGATTTGGAGG - Intronic
1121900171 14:97686640-97686662 CATTTCAACATGAGTTTTGGAGG + Intergenic
1123400165 15:19976471-19976493 CATTTCATATTGAGTGTAGGTGG + Intergenic
1127890258 15:63244102-63244124 AATTTCAACCTGAGTTTTGGAGG + Intronic
1128467492 15:67925067-67925089 CATTTCAACTTGAGTTTTGGAGG + Intergenic
1129747698 15:78036368-78036390 CATTTCAACATGAGTTTTGGAGG - Intronic
1130555511 15:84919811-84919833 AATTTCAACATGAGTTTAGGTGG + Intronic
1132128064 15:99247201-99247223 CATTTCCACCAGAGTGTATGAGG - Intronic
1134043623 16:11085900-11085922 CATTTCAACCTGAGATTGGGCGG + Intronic
1135606597 16:23831301-23831323 CATTTGAACCTGAGAGTTGGGGG - Intergenic
1135816623 16:25640104-25640126 CATTTCAACATGAGATTAGGAGG + Intergenic
1137025662 16:35471526-35471548 CATTCAAACCTGTGTGTAGAGGG + Intergenic
1137541247 16:49363489-49363511 CATTTCAACCTGAGATTTGGCGG - Intergenic
1137700727 16:50495955-50495977 CATTTCAACCTGAGATTTGGAGG - Intergenic
1138830400 16:60367801-60367823 TAATTCAACCTGAGTGGAGGCGG + Intergenic
1139453562 16:67052540-67052562 CAATCCAACCTGGGTGAAGGAGG + Intronic
1140101693 16:71923278-71923300 CATTGAAATCTGACTGTAAGAGG - Exonic
1144091387 17:11859897-11859919 CATTTCAACCTGAGATTTGGAGG + Intronic
1144721039 17:17470131-17470153 CATTTCAACATGAGAGTTGGAGG + Intergenic
1147777580 17:42913661-42913683 AATTGCAACTTGAGAGTAGATGG + Intergenic
1149580419 17:57746354-57746376 AATTGCAACATGAGTTTGGGAGG - Intergenic
1152161661 17:78672512-78672534 CATTTCAACATGAGTTTTGGAGG + Intergenic
1152342733 17:79734146-79734168 CATTGCAAACTGGGGGTGGGTGG - Intronic
1153224379 18:2887361-2887383 CATTGCAACATGAGATTTGGAGG - Intronic
1153697145 18:7655355-7655377 CATTCTAACATGTGTGTAGGTGG - Intronic
1154128967 18:11719414-11719436 TATTTCAGCCTGAGTTTAGGTGG + Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1158398155 18:57095861-57095883 CAAGGCAAACTGAGTGTGGGGGG - Intergenic
1161914852 19:7220831-7220853 CATTTCAACATGAGTTTTGGAGG - Intronic
1162680944 19:12340691-12340713 CACTGGAACCTGAGAGGAGGAGG + Intergenic
1163698723 19:18776692-18776714 ACCTGGAACCTGAGTGTAGGTGG + Intronic
1165286242 19:34844696-34844718 CATTGCAACATGAGATTTGGAGG - Intergenic
1167496179 19:49819759-49819781 CATTGTAGCCTCAGTGCAGGGGG + Intronic
1167963324 19:53124549-53124571 CATTTCAACATGAGAGTTGGTGG + Intronic
1202677133 1_KI270711v1_random:17986-18008 CATAGTCACCTGAGTGCAGGAGG - Intergenic
926159497 2:10477653-10477675 CGTTGAAAACTGAGTGTGGGAGG - Intergenic
926388904 2:12367147-12367169 CATGGCAGCCTCATTGTAGGTGG + Intergenic
926461437 2:13134840-13134862 CATTTCAACCTGAGTTTTGATGG - Intergenic
929875384 2:45792371-45792393 CATTTCAACATGAGTTTTGGCGG + Intronic
930842409 2:55862035-55862057 CATTGCAACATGAGATTTGGAGG + Intergenic
933610859 2:84433836-84433858 CATTTCAACCTGAGATTTGGAGG - Intronic
935615824 2:105080774-105080796 CACTGCAATCTGACTGTAGATGG - Intronic
936263815 2:110984344-110984366 CATTGCACACTCAGTCTAGGTGG + Intronic
936672303 2:114671371-114671393 CATTTCAACATGAGGTTAGGAGG - Intronic
937104891 2:119301492-119301514 CATTGCTCCCTGAGTGCCGGAGG - Intergenic
937263886 2:120604052-120604074 CATTTCAACATGAGATTAGGAGG - Intergenic
937615794 2:123920872-123920894 CATTTCAACATGAGTTTTGGTGG + Intergenic
940153252 2:150626188-150626210 CATTTCAACATGAGTTTTGGAGG - Intergenic
940202259 2:151164606-151164628 TATTGCAGCATGAGTGTTGGGGG - Intergenic
940753396 2:157653979-157654001 CATTTCAACATGAGTTTTGGAGG + Intergenic
940977064 2:159958081-159958103 CATTTCAACATGAGAGTTGGAGG - Intronic
942205591 2:173617324-173617346 CATTTCAACATGAGTTTTGGAGG + Intergenic
942347289 2:175016805-175016827 CATTTCAACCTGAGATTTGGAGG - Intergenic
943025260 2:182620048-182620070 CATTTCAACATGAGTTTTGGAGG + Intergenic
944100683 2:196023030-196023052 CATTTCAACCTGAGATTTGGAGG - Intronic
945985687 2:216351832-216351854 CTTTCCAACATGAGGGTAGGTGG + Intronic
946453595 2:219801996-219802018 CATTTCAACATGAGTTTTGGAGG + Intergenic
948783400 2:240338649-240338671 CATTTCAACATGAGTTTTGGAGG - Intergenic
1170051576 20:12151334-12151356 AATTTCAACATCAGTGTAGGAGG + Intergenic
1170530968 20:17291051-17291073 AATTTCAACCTGAGTTTAGGAGG + Intronic
1171164290 20:22957010-22957032 CAGTGCTACCTGAAGGTAGGGGG - Intergenic
1171185718 20:23122761-23122783 CATGGCAAGCTGACTGTTGGTGG - Intergenic
1172729183 20:37071341-37071363 CATTGCAACATGAGATTTGGAGG - Intronic
1173912201 20:46678769-46678791 CATTTCAACCTGAGATTTGGAGG - Intronic
1174457579 20:50660620-50660642 AATTGCAACATGAGTTTTGGTGG + Intronic
1175245810 20:57581325-57581347 CATTGCATCCTGAGAGCAGTGGG - Intergenic
1177592829 21:23194476-23194498 CACTGTAACTTGAGTGTAGAGGG - Intergenic
1178100265 21:29260432-29260454 CATTTCAACATGAGTTTTGGAGG + Intronic
1181815815 22:25436126-25436148 CATTCCAACCTGGGTGAAAGAGG + Intergenic
1182234238 22:28863100-28863122 CACTCCAACCTGAGTGTCAGAGG + Intergenic
1183049446 22:35248855-35248877 CATTGCAACATGAGATTTGGAGG + Intergenic
1183622389 22:38982106-38982128 CATTGCAGCCTGAGCCTGGGAGG - Intronic
949667406 3:6356071-6356093 AATTTCAACATGAGTGTTGGAGG + Intergenic
951247720 3:20360415-20360437 CATTTCAACCTGAGTTTTGAAGG - Intergenic
952562230 3:34608592-34608614 CATTTGAACCTGAGTGGTGGAGG - Intergenic
955105868 3:55897464-55897486 CATTCCATCCTGAGTGCAAGAGG + Intronic
955591055 3:60536044-60536066 CATGGCAAACTAAGTGAAGGAGG + Intronic
956764575 3:72473648-72473670 CATTTCAACATGAGTGTTGGAGG - Intergenic
957771286 3:84695797-84695819 CATTGGAATCTCAGTCTAGGTGG + Intergenic
958652245 3:96952289-96952311 CATTGCAACATGAGTTTCAGTGG - Intronic
958871143 3:99560601-99560623 AATTGCAACATGAGTTTTGGAGG - Intergenic
960722400 3:120637884-120637906 CATTTCAACATGAGAGTTGGAGG - Intronic
964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG + Intergenic
965433793 3:168621594-168621616 CATTGCAACATGAGAATTGGAGG + Intergenic
965677374 3:171212179-171212201 CAGTGCAGCCGGAGTGGAGGAGG - Intronic
965795500 3:172434444-172434466 AATTTCAACCTGAGTTTTGGTGG + Intergenic
966408846 3:179627786-179627808 CATTTCAACATGAGAGTTGGGGG + Intergenic
966469810 3:180276380-180276402 CATTTCAACCTGAGATTTGGAGG + Intergenic
968984624 4:3868422-3868444 AATTGCAACCTGAGGTTTGGAGG + Intergenic
969011775 4:4070972-4070994 CATAGCAACCTGGGTGGAGTTGG - Intergenic
970719307 4:18967865-18967887 CATTTCAACATGAGTTTTGGAGG - Intergenic
970786109 4:19798122-19798144 CATTTCAACCTGAGATTTGGAGG + Intergenic
971229470 4:24788942-24788964 CATTGCAACATGAGATTTGGAGG + Intergenic
973595438 4:52484029-52484051 CATTTCAACATGAGTTTTGGAGG - Intergenic
973941052 4:55911015-55911037 CCTTGCAATCTAAGTGTGGGAGG - Intergenic
975260252 4:72289603-72289625 AATTTCAACCTGAGTTTTGGAGG - Intronic
975522049 4:75311682-75311704 CATTGCAACATGAGATTTGGAGG - Intergenic
979677979 4:123430329-123430351 CATTTCAACCTGAGATTTGGAGG + Intergenic
981849374 4:149210622-149210644 CATTTCAACATGAGTTTTGGAGG + Intergenic
982777719 4:159459124-159459146 CATTGCAACATGAGACTTGGAGG - Intergenic
983058021 4:163122625-163122647 AATTGCAACATGAGTTTTGGAGG - Intronic
984614903 4:181886084-181886106 CATTTCAGCCTGAGTGATGGAGG - Intergenic
984757883 4:183340853-183340875 CATTCCCACCAGAGTGTATGCGG + Intergenic
986178112 5:5369104-5369126 CATTTCAACATGAGTTTTGGTGG + Intergenic
988548728 5:32181365-32181387 CATTTCAACATGAGTTTTGGAGG - Intergenic
989470109 5:41806440-41806462 CATTTCAACCTGAGATTTGGAGG - Intronic
991007526 5:61844554-61844576 AATTTCAACATGAGTTTAGGAGG - Intergenic
991276516 5:64853813-64853835 CATTTCAACATGAGAGTTGGAGG + Intronic
992353196 5:75952455-75952477 CATTTCAACCTGAGATTTGGAGG - Intergenic
992780395 5:80121966-80121988 CATTTCAACCTGAGATTTGGAGG + Intronic
994053571 5:95389986-95390008 CATTTCAACATGAGTTTTGGTGG + Intergenic
994221397 5:97199131-97199153 CATTGCAAGAGGAGTATAGGTGG - Intergenic
996255756 5:121401555-121401577 GAATGCAAGCTGAGTGAAGGGGG - Intergenic
997431604 5:133844765-133844787 CCCTGCCACCTGAGTTTAGGGGG - Intergenic
1001654607 5:173340000-173340022 CATTTCAACATGAGTTTTGGAGG - Intergenic
1001714384 5:173802958-173802980 CATGGCAAGCTGAGTGAATGAGG - Intergenic
1001719844 5:173847877-173847899 CATTTCAACATGAGATTAGGAGG + Intergenic
1003219479 6:4145831-4145853 CATTTCAACCTGAGATTTGGAGG + Intergenic
1004601960 6:17158856-17158878 CACTCCAACCTGAGTGAAAGAGG - Intergenic
1004927659 6:20431492-20431514 TATTGCAACCTGTGAGTCGGAGG + Intronic
1005133081 6:22534733-22534755 CAGTGCAACCAGTGTGTGGGGGG + Intergenic
1008889450 6:56470349-56470371 CATTTCAATCTCAGTGTAGCTGG + Intronic
1010012870 6:71069365-71069387 CATTTCAACATGAGTTTGGGAGG + Intergenic
1010964139 6:82183752-82183774 CATTTCAACATGAGTTTTGGAGG - Intronic
1013386178 6:109634072-109634094 AATTTCAACCTGAGTTTTGGAGG - Intronic
1014159838 6:118155300-118155322 CATTTCAACATGAGTTTTGGAGG - Intronic
1014713716 6:124839901-124839923 CATTGCTCCCTGAGAGTAAGTGG - Intergenic
1014805741 6:125827388-125827410 CATTTCAACATGAGTTTTGGAGG + Intronic
1016584816 6:145672775-145672797 TACTGGGACCTGAGTGTAGGAGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017269264 6:152487668-152487690 GATTGCAACATGAGTATTGGAGG - Intronic
1017772927 6:157656977-157656999 CATGCATACCTGAGTGTAGGTGG + Intronic
1017925252 6:158906342-158906364 CATTTCAACCTGAGATTTGGTGG - Intronic
1020402822 7:7797327-7797349 CATTTCAACATGAGTTTTGGAGG + Intronic
1020668473 7:11075670-11075692 CATTTCAACCTGAGATTTGGAGG + Intronic
1021137177 7:16979501-16979523 CATTGCAACCTCAGTGAAAATGG + Intergenic
1021403891 7:20241759-20241781 CATTTCAACATGAGTTTTGGTGG - Intergenic
1021539601 7:21742601-21742623 CATTTCAACCTGAGATTTGGAGG + Intronic
1023586076 7:41731145-41731167 CTTTGCATCCTGAGTGTAACAGG + Intergenic
1026102645 7:67395634-67395656 CATTTCAACATGAGATTAGGAGG + Intergenic
1027160602 7:75799628-75799650 CATTGTAACCCGAGGCTAGGAGG - Intergenic
1027174944 7:75897290-75897312 CATTGCAACCAGGCTGTGGGTGG - Intergenic
1027778553 7:82496120-82496142 CATTTCAACATGAGTTTTGGAGG + Intergenic
1028444637 7:90907145-90907167 CATTGCAACCAGTTTGTAGATGG + Intronic
1029167382 7:98602315-98602337 CATTTCAACATGAGTTTTGGAGG - Intergenic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1031043261 7:116861280-116861302 CATTGCAACCCGAGAGGCGGAGG - Intronic
1031308734 7:120166737-120166759 CATTTCAACATGAGAGTTGGAGG + Intergenic
1031429104 7:121644112-121644134 CATTGCAACATGAGATTTGGAGG + Intergenic
1031799793 7:126228020-126228042 CATGGCAACTTGAATGTAAGTGG - Intergenic
1032892668 7:136216014-136216036 AATTGCAACATGAGTTTTGGAGG + Intergenic
1033149451 7:138900579-138900601 CATTTCAACCAGAGAGTTGGAGG - Intronic
1035267515 7:157699516-157699538 CATTTGAACCTGGGTGTCGGCGG - Intronic
1036021515 8:4852220-4852242 CATTTCAACCTGAGATTTGGAGG - Intronic
1036510074 8:9392006-9392028 CATTTCAACCTGAGATTTGGAGG - Intergenic
1039675365 8:39658854-39658876 CATTATAACCTGAATGTTGGAGG + Intronic
1041316201 8:56564984-56565006 CATTTCAACATGAGTTTTGGAGG - Intergenic
1041723531 8:60997763-60997785 CACTGCAGCCTGAGTGATGGTGG - Intergenic
1042101815 8:65282375-65282397 CATGGCAACAGGAGAGTAGGGGG - Intergenic
1042128380 8:65561758-65561780 TATTGGAGCCTGAGTTTAGGTGG - Intergenic
1042800154 8:72709734-72709756 CATTTCAACATGAGAGTTGGAGG + Intronic
1042805180 8:72763629-72763651 CATTGGAAACTGAGTGTCTGTGG + Intronic
1043920679 8:85980097-85980119 CATTTCAACCTGAGATTTGGAGG - Intergenic
1044118160 8:88360053-88360075 AATTTCAACCTGAGTTTTGGAGG + Intergenic
1046137916 8:110054489-110054511 CATTGTAACCAGAGGGTATGAGG - Intergenic
1047330940 8:123886228-123886250 AATTTCCACTTGAGTGTAGGTGG - Intronic
1047435631 8:124833566-124833588 CATTTCAACATGAGGGTTGGAGG - Intergenic
1047770295 8:128025243-128025265 CATTGCACCCTGGGTGTTCGGGG + Intergenic
1050496313 9:6246224-6246246 CATTTCAACATGAGTTTTGGAGG - Intronic
1051442271 9:17098077-17098099 CATTTCAACCTGAGATTTGGAGG + Intergenic
1051852704 9:21528062-21528084 CATTGCAGTCAGAGTGTTGGTGG - Intergenic
1056470251 9:86898534-86898556 CTTTGCAATCTGAGGGTAGTGGG + Intergenic
1057088424 9:92233582-92233604 CATTTTAACCTGAGTTTTGGAGG + Intronic
1057088894 9:92238267-92238289 CATTTCAACATGAGAGTTGGAGG - Intronic
1057859016 9:98625034-98625056 CTGTGCTTCCTGAGTGTAGGTGG - Intronic
1059567801 9:115400614-115400636 CATTTCAACATGAGTTTCGGAGG + Intronic
1061197060 9:129112116-129112138 CACTGGAACCAGAGAGTAGGAGG - Intronic
1185963757 X:4576681-4576703 CATTTCAACATGAGTTTTGGAGG - Intergenic
1186557328 X:10573569-10573591 CATTTCAACATGAGTTTTGGTGG + Intronic
1189735737 X:44067757-44067779 CATTGCAACATGAGATTTGGAGG + Intergenic
1190523617 X:51305768-51305790 AATTGCAACATGAGTTTTGGTGG - Intergenic
1192463469 X:71338073-71338095 AATTTCAACATGAGTGTTGGTGG - Intergenic
1192791756 X:74388813-74388835 CATTGAAACCTCAGTTTAGGGGG + Intergenic
1193231090 X:79047567-79047589 CATTTCAACATGAGTTTTGGAGG - Intergenic
1194354613 X:92867028-92867050 CATTTCAACATGAGTTTTGGAGG - Intergenic
1195163993 X:102199153-102199175 CATTGCCACATGAAAGTAGGAGG + Intergenic
1195194868 X:102487942-102487964 CATTGCCACATGAAAGTAGGAGG - Intergenic
1195436639 X:104852033-104852055 AATTTCAACCTGAGTTTTGGTGG + Intronic
1195458759 X:105099902-105099924 CATTTCAACCTGAGGTTTGGAGG + Intronic
1195580560 X:106496497-106496519 CATTTCAAGCTGAGTTTTGGTGG - Intergenic
1198183080 X:134228969-134228991 CATTCCAACCTGAGTGACGGAGG - Intergenic
1198777165 X:140192162-140192184 GATTTCAAACTGAGTTTAGGAGG - Intergenic
1200662977 Y:5984058-5984080 CATTTCAACATGAGTTTTGGAGG - Intergenic
1200695412 Y:6354333-6354355 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1200908202 Y:8507454-8507476 CATTTCAACCTGAGGCTTGGTGG - Intergenic
1201039865 Y:9820377-9820399 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1201563242 Y:15340367-15340389 CATTGAAAGCAGTGTGTAGGGGG - Intergenic
1202198735 Y:22325135-22325157 CATTTCAACCTGAGGCTTGGAGG - Intronic
1202231381 Y:22662703-22662725 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1202311777 Y:23533462-23533484 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1202559025 Y:26137132-26137154 CATTTCAACCTGAGGCTTGGAGG - Intergenic