ID: 1113295506

View in Genome Browser
Species Human (GRCh38)
Location 13:108955124-108955146
Sequence TGGTGCCATCTCAGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113295506_1113295516 28 Left 1113295506 13:108955124-108955146 CCTGCTCCCCTGAGATGGCACCA 0: 1
1: 0
2: 3
3: 19
4: 209
Right 1113295516 13:108955175-108955197 CTGTGTCGTCCTAGAAAGTCAGG 0: 1
1: 0
2: 2
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113295506 Original CRISPR TGGTGCCATCTCAGGGGAGC AGG (reversed) Intronic
900987900 1:6083662-6083684 CAGTGCCCTCACAGGGGAGCTGG + Intronic
901739258 1:11331556-11331578 TCCTGTCATCACAGGGGAGCAGG - Intergenic
903180371 1:21602175-21602197 TGGAGCCCTCTCAGGGGACCTGG + Intronic
904921295 1:34010294-34010316 TGGTGCCACCTCCAGGAAGCAGG + Intronic
905657980 1:39698295-39698317 TGGTAGCATCTCAGGGTAGAAGG - Intronic
906271435 1:44482324-44482346 GGCTCCCTTCTCAGGGGAGCAGG + Intronic
906521113 1:46467458-46467480 TGGGGCCTTCTCAGGGTAGGTGG + Intergenic
909187626 1:72508540-72508562 TGCTGGCAACTCAGGGCAGCAGG + Intergenic
912748954 1:112269627-112269649 TCCTGCCATCTAAGTGGAGCAGG + Intergenic
914192866 1:145425982-145426004 AGGTCACCTCTCAGGGGAGCTGG - Intergenic
914916452 1:151822275-151822297 GGGTGCCACCACAGGGGAGCAGG + Intronic
918019932 1:180677522-180677544 TGGTGCCAGCTCAGAGGACAGGG + Intronic
918292618 1:183123338-183123360 TGGAGCCATTGTAGGGGAGCAGG - Intronic
920828696 1:209446377-209446399 TAGTGCCATCTCAGGGGATGTGG - Intergenic
1063929474 10:11014950-11014972 TGTTGCCATCACTGGGGACCAGG - Intronic
1066080554 10:31927875-31927897 GCCTCCCATCTCAGGGGAGCTGG - Intronic
1068523847 10:58106099-58106121 TGGTGCCCACTCAGGGGGACCGG - Intergenic
1069564478 10:69454079-69454101 TGGTGCCATCTCTGGGGTTGAGG + Intronic
1069725738 10:70576721-70576743 TGCTGCCATCTCAAGAGAGGGGG + Intergenic
1070232589 10:74585565-74585587 TGCTGTACTCTCAGGGGAGCAGG + Intronic
1070752881 10:78974190-78974212 GGGAGCCATCTCTGGGGAGGGGG - Intergenic
1070787449 10:79170201-79170223 TGGTGCCTGCAAAGGGGAGCTGG + Intronic
1072711284 10:97717255-97717277 TGTTGCCAGCCCAGGGCAGCGGG - Exonic
1072977794 10:100074371-100074393 TAGAGCCATCTCTGGGAAGCTGG - Intronic
1075479507 10:122767958-122767980 TGCTGCCATTTCAGGGAAACAGG + Intergenic
1075815487 10:125261535-125261557 TGGTGCCATCCCAGTGGCTCTGG + Intergenic
1077295729 11:1825464-1825486 TGGAGCCAACTCAGGGGAGCTGG + Intergenic
1079185406 11:18231709-18231731 TGGAGCTGTCTCAGGTGAGCAGG - Intronic
1085322355 11:75583093-75583115 TTGTGCCATATTGGGGGAGCGGG - Intergenic
1085635501 11:78156488-78156510 TGGTCCCATCTCTGAGGAGCTGG + Intergenic
1087139340 11:94750246-94750268 TAGTGTCTTGTCAGGGGAGCTGG + Intronic
1087223783 11:95575589-95575611 TGCTACCATCTCAGGGGAGGAGG - Intergenic
1088239192 11:107756513-107756535 TTGTGCCATTTCTGGGGAGTTGG + Intergenic
1088697910 11:112384313-112384335 TGGTACCATCTCTGAGGAACAGG - Intergenic
1089053267 11:115564476-115564498 TGCTGCCCTCCCAGGGGTGCTGG + Intergenic
1094855867 12:34402558-34402580 AGGTGCCAGCTCAAGGTAGCAGG + Intergenic
1096659547 12:53115698-53115720 TGGGGCCATCTCAGCAGAGGGGG + Intronic
1099070000 12:78034207-78034229 TGGTGACATCTAAGGGGAAGTGG - Intronic
1099921437 12:88962170-88962192 AAATGCCATCTCAGGGAAGCGGG - Intergenic
1099957207 12:89362394-89362416 TCGTGTCATCTCATGGGGGCAGG - Intergenic
1101986696 12:109452730-109452752 TGGTGCCATTTCAGGGTTTCAGG - Intronic
1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG + Intergenic
1102457300 12:113078620-113078642 TGGTGCCTTCTCAGGGTCACCGG + Intronic
1103741802 12:123096186-123096208 AGCTGCCATCACATGGGAGCGGG - Intronic
1105520057 13:21123572-21123594 AGGTGCCATCTAAGAGGAACGGG + Intergenic
1106141312 13:27014626-27014648 TGGTGCACTCTGAGGGCAGCAGG - Intergenic
1106411514 13:29514449-29514471 TGCTGCCACCTCCGGGGGGCGGG + Exonic
1107556454 13:41520245-41520267 TTGTGCCAACTCAGGGCTGCTGG - Intergenic
1107877024 13:44799907-44799929 TGGTGCCATCCCAGGCCATCTGG + Intergenic
1110663415 13:78086160-78086182 TGATGCCATCTTTGGGGGGCAGG + Intergenic
1111922550 13:94427481-94427503 CGCTGCCTTCTCAGGGGTGCTGG - Intergenic
1113295506 13:108955124-108955146 TGGTGCCATCTCAGGGGAGCAGG - Intronic
1113812714 13:113152115-113152137 TGGAGCCATCTCAGCAGGGCTGG + Intergenic
1115973655 14:38973551-38973573 AGGAGTCACCTCAGGGGAGCTGG + Intergenic
1116831961 14:49729830-49729852 TGGGGTCATCTCAGGTGAACAGG + Intronic
1119302320 14:73581302-73581324 TGGTGCCATCTATGAGGAACAGG - Intergenic
1119388675 14:74275619-74275641 TGGTGCTGTCCCAGGGGACCTGG - Intergenic
1119876741 14:78066311-78066333 TGATGCCATCCCAGGAGGGCTGG - Intergenic
1121387813 14:93545048-93545070 TGGTGCCATGTCAGGTGGGTAGG + Intronic
1122630354 14:103104764-103104786 CGGCGCCATCTCCGCGGAGCTGG + Exonic
1122722184 14:103728294-103728316 TTGAGCCATCTCTGGGGACCTGG + Intronic
1123683333 15:22779326-22779348 TGCAGCCATCTCAGGGTAGGTGG - Intronic
1124136980 15:27043474-27043496 TGATACCAGCTCAGGTGAGCTGG - Intronic
1125502777 15:40249860-40249882 TGGTGCCATCTCAGAGGCATTGG - Intronic
1125540093 15:40465226-40465248 TGGAGTCATCTCAGGTCAGCAGG + Intronic
1125546133 15:40507111-40507133 GGGGGCCGTGTCAGGGGAGCAGG + Intergenic
1125726646 15:41871641-41871663 TGGGGCCTCCTCAGTGGAGCGGG - Intronic
1127459291 15:59183186-59183208 TGCTGCCATCTCAGGAGAGCAGG - Intronic
1128452383 15:67813238-67813260 TGCTGCCCTTGCAGGGGAGCTGG - Intergenic
1129163536 15:73761594-73761616 AGGTACCATCTCTGGCGAGCAGG + Intergenic
1130605207 15:85309644-85309666 TGGTTTCATCCCAGGGGTGCAGG + Intergenic
1130885300 15:88087670-88087692 TGGTGACATCTCTGGGGCTCTGG - Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1135415557 16:22265898-22265920 TGGTGCCTTATATGGGGAGCTGG + Intronic
1138022165 16:53494545-53494567 TGATCCCACCTCAGGTGAGCTGG - Exonic
1138344544 16:56311945-56311967 TGGTGCCCACCCAGGGGAACCGG - Intronic
1140648007 16:77054803-77054825 TGGTTGCCTCTCAAGGGAGCAGG + Intergenic
1142620231 17:1160971-1160993 CGGTGCCTTCTGAGGGAAGCGGG + Intronic
1143621959 17:8085940-8085962 GGGTGCCATGCCAGGGTAGCAGG + Intronic
1143849556 17:9800126-9800148 TGGAGCCATGTGAGGGCAGCTGG - Intronic
1144766905 17:17738000-17738022 CAGTGCCATCCCAGGGGGGCAGG + Intronic
1144769073 17:17749168-17749190 TGGAGGCAGCTCAGGCGAGCTGG - Intronic
1146139958 17:30357257-30357279 TGCTGCCTTCTCAGGGGCACAGG - Intergenic
1148104538 17:45112370-45112392 TGGGGCCATCTCAGGGCCCCAGG + Exonic
1148353570 17:46958615-46958637 ATGTGCCAGCTCAGGGGAGGGGG + Intronic
1150127808 17:62649640-62649662 TGTTGCCATGTCAGGAGGGCAGG + Intronic
1151239771 17:72748823-72748845 TGGTGCAAGGTCAGGGGAGTTGG - Intronic
1151548051 17:74805478-74805500 AGATGCCCTCTCCGGGGAGCTGG - Intronic
1151869480 17:76826776-76826798 TGGTTCCATCTCCTGGAAGCTGG - Intergenic
1152918689 17:83054796-83054818 AGGTACCATCTCTGGGGAACAGG + Intergenic
1203166200 17_GL000205v2_random:97992-98014 TGGTACCATCTATGGGGAACAGG + Intergenic
1153262497 18:3238146-3238168 CGGTCCCATCTCAGGGGTGATGG + Intergenic
1158478585 18:57802312-57802334 TGCAGCCATCTCAGCGGGGCTGG + Intronic
1161382930 19:3976014-3976036 CGGTGTCTTCGCAGGGGAGCGGG - Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162736284 19:12748760-12748782 TGATGCCATCCCATGGGGGCAGG - Intergenic
1163355242 19:16806359-16806381 TGGGGCCATTTCAGGGGCGGTGG - Intronic
1163362048 19:16852891-16852913 AGGTGTCATCTCAGGGGTCCTGG + Intronic
1163754294 19:19097285-19097307 AGGTGACATCTCAGAGCAGCAGG + Intronic
1167321092 19:48797453-48797475 GGATTCCATCTCAGGGGAACTGG - Intronic
925265485 2:2563685-2563707 TGGTGCCACCTTTGGGGAGGAGG - Intergenic
925332727 2:3071347-3071369 TGGTGGCATCACAGTGGAGAGGG + Intergenic
925926140 2:8672041-8672063 TGGTACCAGCTCAGGGGCCCTGG - Intergenic
930014998 2:46964176-46964198 TGGGGCCTTCACAGGCGAGCTGG + Intronic
933972844 2:87484084-87484106 TGTTCCCATCCCAGGGGTGCAGG + Intergenic
935820516 2:106887821-106887843 TGGGCCCATCTCAGGGGGACTGG + Intergenic
936089368 2:109490992-109491014 TGGAGCCACCTTCGGGGAGCAGG + Intronic
936293535 2:111247500-111247522 TCATGGCATCTCAAGGGAGCTGG - Intergenic
936320877 2:111466129-111466151 TGTTCCCATCCCAGGGGTGCAGG - Intergenic
938898510 2:135776980-135777002 TGCTTCCATTTCAGGGGAGTGGG - Intronic
940387393 2:153089958-153089980 TGGATCCATTTCTGGGGAGCTGG + Intergenic
940848657 2:158667466-158667488 TGGTGACAGGTCAGGGGAGAAGG + Intronic
940849018 2:158670936-158670958 TGGTGCCATCTCAGAACAGCAGG + Intronic
941051223 2:160736310-160736332 AGGTGGCTTCTCAGGGGAGGTGG - Intergenic
943616764 2:190101401-190101423 TGCTATCCTCTCAGGGGAGCAGG - Intronic
944217935 2:197274457-197274479 TGGTGTGATCTCAGGTGAGGTGG - Intronic
947860265 2:233353476-233353498 TGGTGCCATCCAGGTGGAGCAGG - Intergenic
948121974 2:235537380-235537402 TGGCGTCAGCTCAGGGAAGCAGG + Intronic
1169248745 20:4044576-4044598 CAGGGCCATCTCAGGGGAACAGG - Intergenic
1169974332 20:11306501-11306523 TGGCGCCATCTCAGCTGAGTGGG + Intergenic
1169976175 20:11330812-11330834 TGGTTCCATCTCATTGGAGAAGG + Intergenic
1172894617 20:38291768-38291790 TGGTCCCATCTCAGGGCATGTGG + Intronic
1173485648 20:43439108-43439130 TGGTCCCATCTGAGGGGCGAGGG - Intergenic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1174735159 20:52959303-52959325 GGGTGCCATCTCTGGAGAGCTGG + Intergenic
1175299832 20:57934870-57934892 TGGAGCCATCCTAGGAGAGCAGG + Intergenic
1175856469 20:62123137-62123159 AGGTGCCAGCTCCGAGGAGCAGG + Intronic
1176405555 21:6361104-6361126 TGGTACCATCTATGGGGAACAGG - Intergenic
1178247939 21:30972243-30972265 AGCTGCCATCTTGGGGGAGCTGG - Intergenic
1179564235 21:42236405-42236427 TGGGGCCACCTCAGTGGAGTCGG + Intronic
1181580300 22:23824506-23824528 TGGTGCCTCCCCAGGGGGGCAGG + Intronic
1182853939 22:33500929-33500951 AGGTGCTAGCTCAGGGGAGAGGG + Intronic
1183520721 22:38294778-38294800 TGGCTCCATCCCAGGAGAGCAGG - Intronic
1183521346 22:38297790-38297812 TGCTGCCATCTCTTGGGAACAGG + Intronic
1183734470 22:39636227-39636249 TGGGGCCATCTCATGGGGCCTGG - Intronic
1185072229 22:48662642-48662664 TGGTGCGAGCTCACCGGAGCAGG + Intronic
951033590 3:17908683-17908705 TGTTGCCATCTCAAGGGACCAGG - Intronic
951397842 3:22192020-22192042 TGGAGCCATTTCAGGGTAGATGG - Intronic
952828681 3:37545183-37545205 TGGAGCTTTCTCAGTGGAGCTGG + Intronic
955085383 3:55697695-55697717 TGGAGCCAAGTCAGGGGAGTAGG - Intronic
959563961 3:107815453-107815475 AGGTGCCATATCAGGTGGGCAGG - Intergenic
961008802 3:123422817-123422839 TGTGGCCATTTCAGGGGAGGGGG + Intronic
961048043 3:123722737-123722759 TGGAGACATCTAAGTGGAGCTGG - Intronic
961468389 3:127095902-127095924 TGTTGCCATGGCAGGGGATCTGG + Intergenic
962128459 3:132647654-132647676 TGGTGACAGCTCAGGTGAGAGGG + Intronic
962437533 3:135380654-135380676 TGGTGCCAGGTCAGGAGAGGGGG - Intergenic
963327988 3:143882893-143882915 TGGTGTCATGTCAGTGGAACTGG - Intergenic
965168411 3:165227363-165227385 TGCTGCCCACTCAGGGGAGCAGG - Intergenic
966807674 3:183819435-183819457 TGCAGCCACCTCAGGGCAGCGGG - Intronic
967271545 3:187737471-187737493 TGGTGCCAGCCCAGGGGAGGAGG - Intronic
968899759 4:3425732-3425754 TGGGGCCAGCGCAGGGGAGGGGG + Intronic
968899831 4:3425944-3425966 TGGGGCCAGCGCAGGGGAGGGGG + Intronic
973297876 4:48546107-48546129 GGTTGACATCTCAGTGGAGCAGG - Exonic
973741840 4:53926203-53926225 CGGTCTCATCTCAGGGGATCAGG - Intronic
979554393 4:122028447-122028469 TGTTGTCCACTCAGGGGAGCAGG + Intergenic
979962394 4:127036552-127036574 CTATACCATCTCAGGGGAGCAGG - Intergenic
982205634 4:152995471-152995493 TGGGGCCATCTGAGTGGAGACGG + Intergenic
984676983 4:182560686-182560708 TGGTGCTATCCCATGGGAACTGG - Intronic
985575106 5:670270-670292 TGGTGCCCTCTCTGAGGGGCGGG + Intronic
985812195 5:2098369-2098391 TGGTGCCAGGTGAGGGGACCAGG + Intergenic
985841248 5:2307677-2307699 TGTTGCTACCTGAGGGGAGCTGG - Intergenic
986107324 5:4672330-4672352 TGGTGCCATCTCAGAGACTCTGG - Intergenic
986116559 5:4780989-4781011 CGGTGGGATCTCAGGGGAGGAGG - Intergenic
987912845 5:24170823-24170845 TGATCCCACCTCAGGTGAGCTGG + Intronic
987979756 5:25067686-25067708 TGGTGCCAGCTCTTGGGAGAAGG - Intergenic
989176129 5:38528289-38528311 TTGTGACCTCCCAGGGGAGCAGG + Intronic
992293217 5:75302430-75302452 TGGTGCCAGCCTAGGAGAGCAGG - Intergenic
994814927 5:104573546-104573568 TGGTGACATGACATGGGAGCAGG - Intergenic
997378338 5:133415261-133415283 TGCTACCATCTCAGGAGAGCCGG - Intronic
999257895 5:150219999-150220021 TGGTGCCACCACAGGGCACCAGG - Intronic
1001295138 5:170493941-170493963 TGGTGCCATCGCAGGACAGGTGG + Intronic
1001367192 5:171154199-171154221 TGGTGCCAACTAAGAGGAGTAGG - Intronic
1002426020 5:179176408-179176430 TGGTGCCATCCCAGCGGAGGAGG - Intronic
1002595285 5:180318096-180318118 GGGTGACATTTCAAGGGAGCTGG + Intronic
1014818024 6:125956651-125956673 TGGTGACATCACAGAGGCGCGGG - Intergenic
1018391550 6:163345237-163345259 TGTGGCCATCCCAGGGGTGCAGG + Intergenic
1018531010 6:164763369-164763391 TGCTGCCATCTCAGTGGGCCTGG + Intergenic
1018834741 6:167474416-167474438 TGGAGGCATCTCAGGGCACCAGG - Intergenic
1019315232 7:381073-381095 TGCTCGCAGCTCAGGGGAGCTGG + Intergenic
1019708664 7:2508389-2508411 GGGAGCCATCTCGGGGCAGCCGG + Intergenic
1020124656 7:5526754-5526776 TGGGGCTGTCTCAGGGTAGCTGG - Intergenic
1022383071 7:29878751-29878773 TGGTCACTTTTCAGGGGAGCTGG + Intronic
1022748033 7:33192775-33192797 TGGTGCCATCTATGAGGAACAGG - Intronic
1022779320 7:33562415-33562437 TGGTGCCTTTTCAGAGAAGCAGG - Intronic
1023423549 7:40010196-40010218 TGGTCCCATCTCAGGGCAATGGG + Intronic
1024198776 7:47086129-47086151 TTTTTCCATCTCAGGGGAGAAGG + Intergenic
1025093542 7:56081492-56081514 TGAAGCCATCACAGGGCAGCTGG + Intronic
1026306157 7:69143653-69143675 GAGTGCCATCCCAGGGTAGCAGG - Intergenic
1026537936 7:71255720-71255742 TGGGGCTTTTTCAGGGGAGCTGG + Intronic
1026898150 7:74022268-74022290 TAGAGCCAGCTCAGGGGAGCAGG + Intergenic
1029629687 7:101742649-101742671 TTGTTCCTTCTCAGGGGAGGAGG - Intergenic
1031652875 7:124313296-124313318 GGCTGCCATCTCAGGGAAGCTGG - Intergenic
1032679208 7:134164666-134164688 TGGTGCCAGCTCAAGTGAGCTGG + Intronic
1033729923 7:144168020-144168042 TGGTGCCATCTCAGGGTGATGGG - Intergenic
1034085609 7:148319753-148319775 TGGTCCCATCTCAGGGGTGATGG - Intronic
1037919207 8:22792321-22792343 AGGTGACATCTCAGGGCTGCAGG + Intronic
1039850912 8:41364259-41364281 TGCTGCCATCTCAGGCTATCTGG + Intergenic
1040997852 8:53419871-53419893 TGGTGCCATCCCAGGCCATCTGG + Intergenic
1042114426 8:65415268-65415290 TGGTACCATCTGAGGGGAGCTGG + Intergenic
1044270913 8:90242318-90242340 TTCTCCCATCTCAGGGTAGCTGG - Intergenic
1044927814 8:97224195-97224217 GGGTGCCACCACAGGGGAGTAGG - Intergenic
1047756087 8:127919537-127919559 TGGTGACTGCTCAGGGGAGGGGG - Intergenic
1051306125 9:15711923-15711945 TGGTTCCATCTCTGGCGAGGTGG + Intronic
1051357547 9:16253621-16253643 TGGTGCTTCCTCAGGGGAGAAGG + Intronic
1052325635 9:27214420-27214442 TGGAGCCATCCCAGGAAAGCTGG - Intronic
1052648422 9:31268950-31268972 AGGTGCCATCTAAGAGGACCAGG + Intergenic
1053283289 9:36835381-36835403 TGTTGCCTCATCAGGGGAGCAGG + Exonic
1057631168 9:96720033-96720055 TGGTGCCGTCCCGGGGGTGCGGG + Intergenic
1057964362 9:99488835-99488857 TGAGGCCATTTCAGGGGATCAGG + Intergenic
1059353824 9:113684676-113684698 TGTTCAGATCTCAGGGGAGCTGG - Intergenic
1060401827 9:123354017-123354039 GGGGACCATCTCAGAGGAGCTGG + Intergenic
1060788085 9:126466175-126466197 TGGGGCCATCTCAGGCCATCCGG - Intronic
1061276924 9:129574307-129574329 TGGTGGGTTCTCATGGGAGCTGG - Intergenic
1061360701 9:130140447-130140469 TGCTGCCATTTGAGGGGAGATGG + Intergenic
1061388256 9:130303061-130303083 TGGAGGGATCTCAGGGGAGTGGG + Intronic
1061486756 9:130924178-130924200 GGGTCCCAGCTCTGGGGAGCGGG - Intronic
1061671121 9:132188703-132188725 TGGTGCCAGCTCATGGGTGAAGG - Intronic
1062361757 9:136191592-136191614 GGGTGCCATCTCAGGAGGGCTGG - Intergenic
1062744312 9:138201725-138201747 TGGTGCCGCCTCTGGGCAGCTGG + Intergenic
1203439937 Un_GL000195v1:180709-180731 TGGTACCATCTATGGGGAACAGG - Intergenic
1187220793 X:17323915-17323937 TGGTGCCAAGTCAGGAGAGTGGG - Intergenic
1187716458 X:22107190-22107212 TGGGATGATCTCAGGGGAGCTGG + Intronic
1187882735 X:23861738-23861760 AGGTTCTACCTCAGGGGAGCTGG - Intronic
1189004722 X:36983792-36983814 TTGTTCCATCTCCTGGGAGCAGG + Intergenic
1189044293 X:37574018-37574040 TTGTTCCATCTCCTGGGAGCAGG - Intronic
1189581110 X:42407486-42407508 TGGTGACATCCCAGGACAGCAGG + Intergenic
1189714705 X:43853445-43853467 TGCTGCCACCTCTGAGGAGCTGG + Intronic
1189885698 X:45542280-45542302 GGGTGCCATCTGTGAGGAGCAGG - Intergenic
1195627373 X:107018354-107018376 AGGTGCCATCTATGAGGAGCAGG - Intergenic
1196613644 X:117742855-117742877 TACTACAATCTCAGGGGAGCAGG - Intergenic
1198423947 X:136496929-136496951 GGGCGCCATCTTAGGGGAGTGGG - Intergenic
1199879837 X:151965139-151965161 AGACTCCATCTCAGGGGAGCTGG + Intronic