ID: 1113301554

View in Genome Browser
Species Human (GRCh38)
Location 13:109027207-109027229
Sequence GAGGCACAGATTGGGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 2, 2: 5, 3: 71, 4: 555}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113301554 Original CRISPR GAGGCACAGATTGGGGTGAT AGG (reversed) Intronic
901029143 1:6296492-6296514 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
901294672 1:8151811-8151833 GAGGCAGAGATTGCAGTGAGAGG - Intergenic
901359496 1:8684731-8684753 GAGGCAAAGATGGTGGTGACAGG - Intronic
901620876 1:10585823-10585845 GAGACAAAGATTGCGGTGAGTGG + Intronic
902422715 1:16294140-16294162 GAGGCATAGATTGGAGGGGTTGG - Intronic
902424414 1:16308568-16308590 GAGGCAGAGATTGTGGTGAACGG - Intronic
902590107 1:17467899-17467921 GAGGCAGAGATTGTAGTGAGCGG - Intergenic
902796975 1:18806389-18806411 GGAGCACAGACTGGGGTGAAGGG - Intergenic
903206773 1:21788384-21788406 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
903276850 1:22227690-22227712 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
903489795 1:23719600-23719622 GAGGCAAAGGCTGGAGTGATGGG - Intergenic
903490789 1:23726572-23726594 GAGGCAGAGGTTGCGGTGATCGG + Intergenic
903861451 1:26367193-26367215 GAGGCAGAGGTTGCGGTGACTGG + Intronic
904027125 1:27511310-27511332 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
904543329 1:31248870-31248892 GAGGCAGAGGTTGCGGTGAGAGG - Intergenic
904665519 1:32117992-32118014 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
905577403 1:39056276-39056298 GAGGCACAGGTTGCCGTGAGCGG + Intergenic
905601928 1:39259691-39259713 GAGGCAGAGGTTGCGGTGAACGG - Intronic
905942113 1:41872282-41872304 GAGGTACAGAGTGGCGGGATTGG + Intronic
906006442 1:42476617-42476639 GAGGCAGAGGTTGTGGTGAGCGG + Intronic
906119920 1:43382555-43382577 GGGGAACAGAATGGGGTGACTGG + Intergenic
906656430 1:47551837-47551859 GATGCTCAGAGTGGGGTGACCGG - Intergenic
907185693 1:52607477-52607499 GAGCCACAGAATGGGCTCATGGG + Intronic
907323736 1:53621879-53621901 GAGGCAGAGATTGCAGTGAGCGG - Intronic
907421060 1:54347729-54347751 GAGGCAGAGATTGGAGTCCTAGG + Intronic
907516429 1:54996195-54996217 GAGGAACAGATGGGGATGAGGGG - Intergenic
908196221 1:61748323-61748345 GAGGCAGAGGTTGGAGTGAGCGG - Intronic
909954829 1:81766757-81766779 GAGGCGGAGATTGTGGTGAGCGG + Intronic
910103949 1:83610450-83610472 GAGGCAAAGATTGGAGAGAGAGG + Intergenic
911404473 1:97419587-97419609 GAGGCAGAGGGTGGGGTTATAGG - Intronic
912587607 1:110780871-110780893 GGGGCACAGACTGGGGTGAGAGG + Intergenic
914998337 1:152564235-152564257 GAGGCACAGCTTTGGGCCATTGG - Intronic
915190998 1:154150301-154150323 GAGGCAGAGGTTGCGGTGAGTGG + Intronic
915317252 1:155035857-155035879 GAGGCAGAGATTGCAGTGAGTGG + Intronic
915398244 1:155602403-155602425 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
915400470 1:155618270-155618292 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
915677810 1:157547909-157547931 AAGGCACAGAAAGGGGAGATGGG - Intronic
915686956 1:157643463-157643485 AAGGCACAGAAAGGGGAGATGGG - Intergenic
916575616 1:166064036-166064058 GAGGCACAGTTTGGGGTATGGGG + Intronic
917919163 1:179735572-179735594 GAGGCAGAGCTTGCGGTGAGTGG - Intergenic
918477246 1:184938014-184938036 GAGGCAAAGGATGAGGTGATTGG + Intronic
918499972 1:185183359-185183381 GAGGCACAGGTTGCAGTGAGTGG - Intronic
919940976 1:202285969-202285991 GAGTAAGAGATTGGAGTGATGGG - Intronic
920109381 1:203576221-203576243 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
920134412 1:203757906-203757928 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
920228444 1:204454835-204454857 GACGCATAGGTTTGGGTGATTGG - Intronic
921208270 1:212868482-212868504 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
921475388 1:215601006-215601028 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
921527011 1:216229863-216229885 GAGGAACAGAATGGGGTAAAAGG + Intronic
922699025 1:227747397-227747419 GGGGCACAGAGTGTGGTGAGGGG + Intronic
922750832 1:228069349-228069371 GGGGGATAGATTGGGGGGATAGG + Intergenic
923288615 1:232521956-232521978 GAGGAACAGATTTGGGTGCAGGG - Intronic
924009339 1:239647594-239647616 GAGGCACAGATTTGAGTCATTGG - Intronic
924332216 1:242951589-242951611 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1062799937 10:371548-371570 GAGGCAGAGACTGGAGTGACAGG + Intronic
1062837159 10:643129-643151 GAGGCAGAGATTGCAGTGAGTGG + Intronic
1063102441 10:2962512-2962534 GAGACAGAGTTTGGGGTGATGGG - Intergenic
1063379956 10:5578123-5578145 GAGGCGGAGATTGCAGTGATCGG - Intergenic
1064072056 10:12238917-12238939 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1064243432 10:13650773-13650795 GATGCACAGATAAGGGTGAGGGG - Intronic
1064331760 10:14400855-14400877 GCGGCAGAGATGGGAGTGATAGG + Intronic
1064483240 10:15760488-15760510 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1065229839 10:23586777-23586799 GAGGCAAAATTTAGGGTGATTGG + Intergenic
1065248626 10:23786279-23786301 GGGGGAGAGTTTGGGGTGATGGG + Intronic
1066576529 10:36831804-36831826 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1068035985 10:51760540-51760562 GAGGCAGAGATTGTAGTGAGCGG - Intronic
1068611426 10:59064675-59064697 GAGGTACAGGTTGGGGTGTAGGG - Intergenic
1068874436 10:61981350-61981372 GAGGCAGAGATTGCGGTGAGTGG - Intronic
1069111757 10:64456255-64456277 GAGGCATACATTGAAGTGATTGG - Intergenic
1069964482 10:72102902-72102924 GAGGCACAGGTTGCAGTGAGCGG + Exonic
1070035770 10:72722243-72722265 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1070178157 10:73990169-73990191 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1070185170 10:74055227-74055249 GAGGCAGAGATTGCAGTGAGTGG + Intronic
1071228540 10:83560067-83560089 GAGGCAAATGTTAGGGTGATGGG - Intergenic
1071366536 10:84906149-84906171 GAGGCAGACATTGGGGCCATGGG - Intergenic
1072421580 10:95294363-95294385 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1072538489 10:96380904-96380926 GAGGCGGAGATTGCGGTGAGCGG + Intronic
1072561856 10:96583961-96583983 GAGGCAGAGATTGCAGTGAGTGG + Intronic
1073198232 10:101713041-101713063 GAGGCAGGGGTTGGGGTGATTGG - Intergenic
1073324705 10:102635538-102635560 GAGGCTCAGAGTGTGGTGAGGGG + Intergenic
1073467152 10:103700840-103700862 GAGTGACAAAATGGGGTGATGGG + Intronic
1073501376 10:103940974-103940996 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1073701583 10:105933825-105933847 TAGGCACTGTTTGGGGTGGTTGG + Intergenic
1074451275 10:113561691-113561713 GAGGCAGTGATGGGGGAGATAGG - Intronic
1075163396 10:120044170-120044192 GAGGGACATTTTGGAGTGATGGG - Intergenic
1075862558 10:125689525-125689547 GAGGCAGAGATGCAGGTGATGGG + Intergenic
1075943558 10:126411602-126411624 GAGGCAGAGATTGCAGTGAGTGG - Intergenic
1076232376 10:128832289-128832311 GAGGCACAGGTTGCAGTGAGCGG + Intergenic
1076282472 10:129260202-129260224 GATGCACTGATTGCGATGATGGG - Intergenic
1077064439 11:634157-634179 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1077636962 11:3848991-3849013 GACTCACAGATTGGGGTGTGTGG - Intergenic
1077895264 11:6448976-6448998 GGGACAGACATTGGGGTGATTGG - Exonic
1079429512 11:20375498-20375520 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1079684206 11:23336026-23336048 GAGGCAGAGATTGTGGTGAGCGG + Intergenic
1080214256 11:29823239-29823261 CAGGCAAAGAATGGGGTTATGGG - Intergenic
1080466877 11:32506036-32506058 GAGGCAGAGGTTAGGGTGAGCGG - Intergenic
1080494373 11:32801568-32801590 GAGGCAGAGGTTGTGGTGAGCGG + Intergenic
1080524435 11:33100282-33100304 GAGGCACAGCTTGCAGTGAGTGG + Intronic
1081544107 11:44057652-44057674 GAGGCTCAAATTCGGGTGGTAGG + Intronic
1081907277 11:46678021-46678043 GGGGCAGAGATTGTGCTGATAGG - Exonic
1081936247 11:46905779-46905801 GAGGCAGAGGTTGCGGTGAGGGG + Intronic
1081972168 11:47206928-47206950 GAGGCAGAGATTGGAATGACAGG + Intergenic
1083457845 11:62790924-62790946 AGGGCAGAGATTGGGGTGAGGGG + Intronic
1083825252 11:65198903-65198925 GAGGCAGAGGTTGCGGTGAGTGG - Intronic
1084618560 11:70252625-70252647 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1084683490 11:70680492-70680514 GAGGCAGAGAGTGGGGAGCTGGG - Intronic
1084864954 11:72048165-72048187 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1084892290 11:72242559-72242581 GAGGCCCAGGGTGGGGAGATTGG - Intronic
1086333720 11:85778905-85778927 GAGGCAGAGGTTGCGGTGAGAGG + Intronic
1086853550 11:91839527-91839549 GAGGCAGAGATTGGAGAGGTGGG - Intergenic
1087226841 11:95610681-95610703 GAGGCAGAGGTTGTGGTGAGCGG + Intergenic
1089494670 11:118902118-118902140 GAGGAACAGATTGGGCTGCATGG - Exonic
1090016053 11:123087436-123087458 GAGGCAGAGATTGCAGTGAGTGG + Intronic
1090816457 11:130301170-130301192 GAGGCCCAGGCTGGGGAGATGGG + Intronic
1090863956 11:130678813-130678835 GAGGCAGAGATTGAGGTTAAGGG + Intronic
1091463050 12:660409-660431 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1091841713 12:3626228-3626250 GAGAAACAGATTTGGGTGAAAGG + Intronic
1092208071 12:6628701-6628723 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1092300802 12:7248200-7248222 GAGGCAGAGGTTGCAGTGATTGG + Intergenic
1093075436 12:14753120-14753142 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1094181389 12:27595781-27595803 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1095174897 12:39080576-39080598 GAGGCAGAGATTGCTGTGAGCGG - Intergenic
1095560724 12:43561866-43561888 GAGGGACAGACTAGGGAGATAGG + Intergenic
1095567932 12:43648104-43648126 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1095908915 12:47405851-47405873 GATGGAAATATTGGGGTGATGGG - Intergenic
1096026339 12:48366372-48366394 GAGGCAGAGACTGGAGTGATTGG - Intergenic
1096165669 12:49421345-49421367 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1096359435 12:50970947-50970969 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1096715318 12:53487500-53487522 GAGGCACAGACTGGGGTGCTGGG + Intronic
1097159483 12:57036242-57036264 GAGGCACAGGTTTGGGAGAGGGG - Intronic
1097210082 12:57360979-57361001 GAGGCAGAGCTTGCGGTGAGCGG + Intronic
1097406032 12:59191425-59191447 CTAGCACAGATTGGGGTTATGGG + Intergenic
1097873040 12:64617626-64617648 GAGGCAGAGGTTGCGGTGAGTGG - Intronic
1098895218 12:76051941-76051963 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1099349514 12:81547444-81547466 GAGGCAGAGGTTGCGGTGAGTGG - Intronic
1099597538 12:84686351-84686373 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1100297768 12:93278682-93278704 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
1100516998 12:95338040-95338062 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1100541577 12:95562377-95562399 GAGGCAGAAGTTGGGGTGAGTGG - Intergenic
1100837537 12:98580699-98580721 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
1101484059 12:105133141-105133163 GAGGGAGGGAGTGGGGTGATGGG - Intronic
1102293344 12:111719032-111719054 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1102419778 12:112794404-112794426 GAGGCCCTGTTTGGGGTGATTGG + Intronic
1103040083 12:117687753-117687775 GAGACTCAGATTGGTCTGATTGG - Intronic
1103466432 12:121145575-121145597 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
1103598331 12:122037876-122037898 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1103788427 12:123451292-123451314 GAGGCAGAGGTTGTGGTGAGTGG - Intergenic
1104779652 12:131411814-131411836 AAGGCACAGAGTGGGGTGGGCGG - Intergenic
1105252573 13:18713168-18713190 GAGAATGAGATTGGGGTGATAGG + Intergenic
1106280123 13:28259707-28259729 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
1107829371 13:44360670-44360692 GAGGTTCAGTTTGGGATGATGGG + Intergenic
1108717974 13:53100644-53100666 GAAGCCCAGATAGTGGTGATAGG - Intergenic
1109089604 13:58024294-58024316 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1110454246 13:75672310-75672332 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
1110616185 13:77544611-77544633 GGGGCTCAGATTGGGCTGGTGGG + Intronic
1111086846 13:83386642-83386664 GAGGCAGAGATTTTGGTGAATGG + Intergenic
1111274156 13:85925993-85926015 CAGGAACAGATCAGGGTGATAGG + Intergenic
1112020452 13:95366854-95366876 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1112187685 13:97143912-97143934 GAGGCAGAGATTGCAGTGAGAGG - Intergenic
1112871808 13:103981343-103981365 GAGGCAGAGATTGCAGTGAGAGG - Intergenic
1112993695 13:105545963-105545985 GAGGCACAGACTGAAGTGTTTGG - Intergenic
1113055200 13:106260107-106260129 GAGGCGCAGATTGCGGTGACAGG + Intergenic
1113082052 13:106530486-106530508 CAGGCAGAGATTAGGCTGATAGG + Intronic
1113301554 13:109027207-109027229 GAGGCACAGATTGGGGTGATAGG - Intronic
1113584140 13:111451577-111451599 GAGCAACAGAATGAGGTGATAGG + Intergenic
1113634213 13:111908925-111908947 GAGGCAGAGGTTGGAGTGAGCGG + Intergenic
1113769456 13:112898930-112898952 GGGGCACAGGGTGGGGTGGTGGG - Intronic
1114370719 14:22084919-22084941 TAGGCACAGATTAGTGTGACTGG - Intergenic
1114645734 14:24255127-24255149 GAGGCACAGGACGCGGTGATGGG - Exonic
1114742620 14:25113709-25113731 GGGGCACAGATTGGAGGGAATGG + Intergenic
1116438239 14:44919381-44919403 GAGGCAGAGCTTGGAGGGATTGG + Intergenic
1116871297 14:50071144-50071166 GAGGCAGAGATTGGGGTGATGGG - Intergenic
1117146112 14:52838301-52838323 GAGTTTCAGTTTGGGGTGATGGG - Intergenic
1117650279 14:57897537-57897559 GAGCCACACATTGGGGTGGAGGG - Intronic
1118128568 14:62936908-62936930 GAGGCAGAGGTTGGGGTGAGTGG + Intronic
1119071781 14:71593280-71593302 GAGGCAAAGATTGCAGTGAGCGG - Intronic
1119311953 14:73654686-73654708 GAGGCAGAGGTTGTGGTGAGCGG + Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120101250 14:80448066-80448088 GAGGCAGAGATTGTAGTGAGCGG + Intergenic
1120359180 14:83475149-83475171 AAAGCACAAATTGTGGTGATGGG + Intergenic
1121610208 14:95273488-95273510 CAGCCACAGATTGGAGTGTTAGG - Intronic
1121787114 14:96670465-96670487 GAGGCACAAATTGGAGTCATGGG - Intergenic
1122056408 14:99101103-99101125 GAGGCCCAGAAGGGGGTGAGGGG - Intergenic
1124364833 15:29064054-29064076 GAGTCACTGATTTGGGAGATGGG + Intronic
1125036702 15:35133346-35133368 AAGGTGCAGATTGGGGTGAGAGG + Intergenic
1125576992 15:40763036-40763058 GAGGCGGAGATTGCGGTGAGCGG + Intergenic
1125628000 15:41124709-41124731 GAGGCAGAGGTTGCAGTGATCGG + Intergenic
1125955385 15:43787466-43787488 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1125977236 15:43965650-43965672 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1126066202 15:44828034-44828056 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1126260794 15:46688343-46688365 GAAGCAGAGACTGGAGTGATGGG - Intergenic
1126521564 15:49600969-49600991 GAGGCAGAGGTTGCGGTGAGTGG + Intronic
1127247214 15:57190318-57190340 GAGGCAGAGATTGGGCTATTAGG + Intronic
1128127265 15:65202266-65202288 GAAGTACAGATTGGTGAGATGGG - Intronic
1128292856 15:66491739-66491761 GAGTCACAGATAAGGGTGTTGGG - Exonic
1128605160 15:69031542-69031564 CAGGTACAGAGTGGGGTGCTGGG + Exonic
1129042491 15:72701906-72701928 GAGGCAAAGGTTGTGGTGAGCGG - Intronic
1129068797 15:72933799-72933821 AAGACAGAGATTGGAGTGATGGG + Intergenic
1129327965 15:74811917-74811939 GAGGCAGAGATTGTAGTGAGCGG - Intergenic
1129600228 15:76994480-76994502 AAGGCACAGAGTGGGGTGTTTGG - Intronic
1130299607 15:82669928-82669950 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1130795863 15:87208821-87208843 GAGGCAGGGATTGTGGTGAGAGG - Intergenic
1131124010 15:89843053-89843075 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1131263146 15:90899948-90899970 GAGGCAGAGGTTGTGGTGAGTGG + Intergenic
1131689114 15:94807278-94807300 GAGGCAGAGGTTGTAGTGATAGG + Intergenic
1132526148 16:415966-415988 GAGGCAGAGGTTGTGGTGAACGG + Intergenic
1132559023 16:584978-585000 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132559043 16:585030-585052 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132559063 16:585082-585104 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132559083 16:585134-585156 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132559103 16:585186-585208 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132559123 16:585238-585260 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132559143 16:585290-585312 GAGGCACAGGTTGGGGGTGTTGG - Intergenic
1132571044 16:644150-644172 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1132900249 16:2250186-2250208 GAGGCACAGGTTGCAGTGATCGG + Intronic
1133007297 16:2891196-2891218 CAGGGACAGAGTGGAGTGATGGG + Intronic
1133332095 16:4981185-4981207 GAGGCAGAGATTGCAGTGAGTGG - Intronic
1133412876 16:5582730-5582752 GAGGCAGAGGTTGAGATGATGGG - Intergenic
1133571219 16:7042267-7042289 GAGGCGCAGATTGGGGAGGAGGG + Intronic
1133759915 16:8790231-8790253 GAGGCAGAGATTGCAGTGAGCGG - Intronic
1133950885 16:10391348-10391370 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1134607087 16:15579793-15579815 GAGGCTCAGATAGGGGTGCTGGG - Intronic
1134824988 16:17277458-17277480 GAGGCAGAGGTTGCAGTGATTGG - Intronic
1135419443 16:22295717-22295739 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1136035388 16:27535775-27535797 GAGGCAGAGGTTGTGGTGAGCGG + Intronic
1137247788 16:46719629-46719651 GAGCCACTGAGTGGGGTGCTGGG + Intronic
1137855061 16:51786276-51786298 GAGGCAGAGCTTGCGGTGAGCGG - Intergenic
1140517949 16:75557758-75557780 GAGGCACAGATTACAGTGAGCGG + Intergenic
1141861844 16:86722420-86722442 GAGGCAGAGATTGCAGTGAGTGG + Intergenic
1142330014 16:89445896-89445918 GAGGCAGACATTGTGGTGAGCGG + Intronic
1142409656 16:89909438-89909460 GAGGCACAGGTTGCAGTGAGTGG + Intronic
1142603300 17:1068001-1068023 GAGGCAGAGGTTGGAGTGAGTGG - Intronic
1143046401 17:4083706-4083728 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1143081053 17:4381654-4381676 GAGGTAGAGATTGCGGTGAGCGG + Intergenic
1144126230 17:12205420-12205442 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
1144552543 17:16253967-16253989 GAGACATAGATTGGGGTACTGGG - Intronic
1144577478 17:16438063-16438085 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
1145296162 17:21593859-21593881 GAGGCACAGATGGGCCTGGTCGG - Intergenic
1146709430 17:35027960-35027982 GAGGCAGAGATTGCAGTGACGGG + Intronic
1146795984 17:35781313-35781335 GAGGTACAGATGGGGGTGCGTGG + Intronic
1146970948 17:37071996-37072018 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1147292958 17:39458638-39458660 GAGGCAGAGATTGCAGTGAGGGG - Intergenic
1147292964 17:39458676-39458698 GAGGCAGAGATTGCAGTGAGGGG - Intergenic
1147632327 17:41940136-41940158 GAGGCTCAGACTGGTGAGATGGG - Intronic
1147642765 17:42014660-42014682 GAGGCAGAGGTTGTGGTGAGGGG - Intronic
1147782607 17:42954503-42954525 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
1148552905 17:48561107-48561129 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1149107904 17:52991378-52991400 GAGGCAGAGATTGCAGTGAGTGG + Intergenic
1149224855 17:54457952-54457974 GAGGTACAGATTGGGTTGGTTGG - Intergenic
1149888461 17:60364448-60364470 GAGGCAAAGGTTGCGGTGAGTGG - Intronic
1149897122 17:60437052-60437074 GAGGCAGAGGTTGTGGTGAGTGG - Intergenic
1150703050 17:67464808-67464830 GAGGCAGACATTGCGGTGAGAGG - Intronic
1151330796 17:73406312-73406334 GAGGCAGAGATTGCAGTGAGCGG - Intronic
1151537404 17:74746734-74746756 GAGGCAGAGCTTGGGGTCAAAGG - Exonic
1151948284 17:77331311-77331333 GAGGAAGAGGCTGGGGTGATGGG + Intronic
1152043674 17:77921712-77921734 AAGGCAGAGATTGGAGTGAAGGG + Intergenic
1152388748 17:79990770-79990792 GAGGGAAAGATTGGGGTGCCAGG - Intronic
1152593351 17:81224456-81224478 GAGGCAGAGATTGCGGTGAGCGG + Intergenic
1153238557 18:3011614-3011636 GAGGCAGAGATTGCAGTGATCGG + Intronic
1153338262 18:3947401-3947423 GAGGCAGAGATTGAGGGGACAGG - Intronic
1153640386 18:7151719-7151741 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
1153685946 18:7545479-7545501 GAGGCAGAGATAGGAGTGATGGG - Intergenic
1154211255 18:12380371-12380393 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1155390352 18:25329212-25329234 CAGGCACAGCTTGGGGTGACTGG + Intronic
1155712304 18:28897739-28897761 GAGGCAGAGATTGTAGTGAGCGG + Intergenic
1156248774 18:35330552-35330574 GAGGCAAAGAATGGGAAGATGGG - Intergenic
1156584520 18:38417133-38417155 GAGGCACAGGTTGCAGTGAGAGG - Intergenic
1156757776 18:40549642-40549664 GAGGCACAGGTTGCAGTGAGCGG - Intergenic
1156852953 18:41749542-41749564 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1156994868 18:43452942-43452964 GAGGCAGAGATTGCAGTGAATGG - Intergenic
1157214326 18:45770182-45770204 GAGGCACAGCTTGGAGTGGTGGG + Intergenic
1157228088 18:45886727-45886749 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1157363799 18:47044688-47044710 GAGGCAGAGTTTGCAGTGATCGG + Intronic
1157722882 18:49938891-49938913 GAGACACAGACAGGAGTGATGGG - Intronic
1158227718 18:55218103-55218125 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1158456020 18:57608364-57608386 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1158969893 18:62656555-62656577 GAGGCAGAGGTTGGGGTGAGCGG + Intergenic
1160106547 18:75983385-75983407 GAGGCAGAGACTGGAGAGATGGG + Intergenic
1160107184 18:75989061-75989083 GAGGCTCAGAATTGGGTCATGGG - Intergenic
1161261166 19:3338644-3338666 GAGGCTCAGAGTGGGATGTTTGG - Intergenic
1161430377 19:4229131-4229153 GAGGCAGAGATGGGGGAGAGAGG - Intergenic
1162206649 19:9061180-9061202 GAGGCAGAGGTTGGAGTGAGCGG - Intergenic
1162272249 19:9625684-9625706 GAGGCGGAGGTTGGGGTGAGTGG + Intronic
1162647197 19:12058560-12058582 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
1163486799 19:17592530-17592552 GAGGCAGAGGTTGTGGTGAGCGG + Intergenic
1163503700 19:17691206-17691228 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1163554898 19:17986290-17986312 GAGGCAGAGGTTGTGGTGAGCGG + Intronic
1163878107 19:19893046-19893068 GAGGCAGAGATTGCAGTGAACGG - Exonic
1163929314 19:20373906-20373928 GAGGCATAGTTTGGTGTCATAGG - Intergenic
1164046231 19:21544412-21544434 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1164096527 19:22015097-22015119 GAGGCAAAGATTGCAGTGAGCGG - Intergenic
1164318768 19:24119039-24119061 GAGACAGAGATTGGAGTGATTGG + Intronic
1164419517 19:28076353-28076375 GAGGGACCTATTTGGGTGATGGG + Intergenic
1165472914 19:36013873-36013895 GAGGCTCAGATTGGGGTCACAGG - Intronic
1165621049 19:37248063-37248085 GAGGCAGAGATTGCGGTGAGCGG + Exonic
1165853763 19:38868015-38868037 GAGGCGAAGATTGCGGTGAGCGG - Intronic
1166115606 19:40652128-40652150 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
1166143444 19:40818550-40818572 GGGGTACAGATTGGAGGGATGGG + Intronic
1166184109 19:41128228-41128250 GGGGCACAGATTGGAGGGATGGG - Exonic
1166401039 19:42480131-42480153 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1166684566 19:44788548-44788570 GAGGCAGAGATTGTAGTGAATGG - Intronic
1167080675 19:47274646-47274668 GAGGCGGTGATTGGGGTGGTGGG + Exonic
1167110847 19:47460126-47460148 GAGGCACTGGTAGGGGTCATGGG - Intronic
1167230720 19:48281422-48281444 GAGGCAGAGACTGGAGTGATGGG - Intronic
1168276485 19:55281443-55281465 GAAGCAGAACTTGGGGTGATGGG - Intergenic
925005450 2:439871-439893 GAGGCACAGAGCTGGGTGCTAGG + Intergenic
925729876 2:6911709-6911731 GAGCCACATATTGAGGTGGTGGG - Intergenic
927554876 2:24024301-24024323 GAGGCACAGTGTGGGCTGCTGGG + Intronic
927828613 2:26328522-26328544 GAGGCGGAGATTGCAGTGATCGG - Intronic
928950541 2:36809486-36809508 GAGGCAGAGGTTGCAGTGATTGG - Intronic
929450536 2:42033975-42033997 GATGCACAGATTGCAGTGAGCGG + Intergenic
929512309 2:42574203-42574225 GAGGCAGAGGTTGTGGTGAGAGG - Intronic
929598600 2:43191248-43191270 GAGGCAGAGCTTGCGGTGAGCGG + Intergenic
930444933 2:51458420-51458442 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
930612385 2:53557547-53557569 GAGGCAGAGATTGGAGTGGTGGG + Intronic
930737679 2:54795821-54795843 GAGGCATAGATTAGGGTATTAGG + Intronic
931188910 2:59980564-59980586 GAGGCAGAGTTTGGAGTGATGGG - Intergenic
931511873 2:63006260-63006282 GTGGCATAGAATGGGATGATGGG - Intronic
931566215 2:63618759-63618781 GAGGCAGAGATTGCGGTGAGCGG - Intronic
931738884 2:65224224-65224246 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
932503463 2:72205538-72205560 GAAGCCCAGACTGAGGTGATAGG + Intronic
932738703 2:74275161-74275183 GTGGCACAGCTGGTGGTGATGGG + Intronic
933044586 2:77519449-77519471 GAGGTCCAGATTGCGGAGATTGG + Exonic
933568135 2:83976306-83976328 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
935729938 2:106056849-106056871 GAGGAACATTTTGGGGTGATGGG + Intergenic
938117387 2:128611343-128611365 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
940569906 2:155417972-155417994 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
940601063 2:155860854-155860876 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
940700520 2:157035924-157035946 GAGGCAGAGATTGGAGTGAGTGG + Intergenic
942251277 2:174049428-174049450 AAGGCACAGATGTGGGTGAACGG - Intergenic
944614738 2:201449373-201449395 GAGCCTCAGATTAGTGTGATAGG + Intronic
944710959 2:202335021-202335043 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
946282386 2:218675593-218675615 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
947708561 2:232295743-232295765 GGGGCAGAGATCGGGGTGACAGG - Intronic
947794262 2:232884259-232884281 GAGGCACAAGTTGGGGGGAAAGG + Intronic
948646188 2:239406611-239406633 GATGCTCAGAGTGGGGTGTTTGG - Intergenic
948880523 2:240855018-240855040 GAGCCACATGTGGGGGTGATTGG + Intergenic
1169847063 20:10005388-10005410 GAGGGACAGGTGGGGGTGAGGGG + Intronic
1170684894 20:18560509-18560531 GAGGCAGAGGATGGGGTGATGGG + Intronic
1170768350 20:19311125-19311147 GAAGCACAGTTTGGGGTCACTGG + Intronic
1171131955 20:22662337-22662359 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1172044200 20:32068225-32068247 GAGGCAGAGGTTGCGGTGAGTGG + Intronic
1172190728 20:33060420-33060442 GGGGCCCAGAATGGGGAGATAGG - Intronic
1172221154 20:33276037-33276059 GAGCCTCAGTTTGGGGTGCTTGG - Intronic
1172962495 20:38808347-38808369 GAGGGAAAGGTTGGGGGGATGGG - Intronic
1173286626 20:41677616-41677638 TAGTCACAGATTTGGGGGATTGG + Intergenic
1173538549 20:43833972-43833994 GAAGAAAAGATTGGGGTGACTGG + Intergenic
1174027751 20:47593002-47593024 GAGGCAGAGATTGTAGTGAGAGG - Intronic
1174198729 20:48791997-48792019 AAGGCACAGATTGGGGTTGGGGG + Intronic
1174673735 20:52333061-52333083 AAGGCAGAGATTGGAGTGAGTGG - Intergenic
1174987330 20:55469922-55469944 GAGGCAGAGATTGCAGTGAGAGG - Intergenic
1175630753 20:60534546-60534568 GAGGCAGAGACTGGGGTGCCGGG + Intergenic
1176133198 20:63505883-63505905 GAGGCAGAGACTGGAGTGAGGGG - Intergenic
1176677658 21:9794688-9794710 GAGGCAGAGGTTGCGGTGAGAGG + Intergenic
1176721101 21:10393545-10393567 GAGTCAGAGATTGAGGTGCTGGG - Intergenic
1176943209 21:14948834-14948856 GAGGCAGACATTGGAGTGATGGG - Intergenic
1177043499 21:16142093-16142115 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1178325488 21:31642085-31642107 TTGGCAGAGATTGGTGTGATGGG + Intergenic
1178357364 21:31920122-31920144 GAGGCAGACATTGGGGTGAGGGG - Intronic
1178691298 21:34752335-34752357 GAGGCAAAGACTGGAGGGATGGG - Intergenic
1179051190 21:37889741-37889763 GTGGCAGAGATTGGAGTGATGGG - Intronic
1179473474 21:41627934-41627956 GAGGCAGAGGTTGTGGTGAGTGG - Intergenic
1179664648 21:42902135-42902157 GAGGCAGAGGTTGCGGTGACTGG + Intronic
1180260100 21:46662637-46662659 GGGGCACAGGCTGGGGTGAGGGG + Intronic
1180302290 22:11046335-11046357 GAGTCAGAGATTGAGGTGCTGGG - Intergenic
1181567108 22:23745698-23745720 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1181598595 22:23935437-23935459 GAGGCAAAGATTGGAGTGATGGG - Intergenic
1181906572 22:26201982-26202004 GAGGCAGAGATTGTAGTGAGCGG - Intronic
1182206894 22:28637077-28637099 GAGGCAGAGCTTGCAGTGATTGG - Intronic
1182412757 22:30201206-30201228 GAGGTAGAGACTGGAGTGATGGG - Intergenic
1182418256 22:30235368-30235390 GGGGCTGAGATTGGAGTGATAGG - Intergenic
1182668246 22:31974301-31974323 GAGGCAGAGGTTGTGGTGAACGG + Intergenic
1182750818 22:32640794-32640816 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1183011738 22:34952336-34952358 AAGGCAGAGATTGGAGTGCTGGG + Intergenic
1183309148 22:37100036-37100058 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1184119725 22:42441925-42441947 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1184369466 22:44073421-44073443 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1184907506 22:47498828-47498850 GGGGCACAGATCGGGGGGTTTGG - Intergenic
1185239628 22:49735600-49735622 GAGGCAGAGACGGGGGAGATGGG + Intergenic
1185291762 22:50030934-50030956 AAGGAACAGGTTGGGGTGCTGGG + Intronic
951887291 3:27536953-27536975 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
952925227 3:38315287-38315309 GAGGCAGAGAAGGGGGTGTTGGG + Intronic
953518646 3:43621515-43621537 GAGGCAGTGAGTGGGGTGGTCGG - Intronic
953960696 3:47263684-47263706 GAGGCCAGGATGGGGGTGATGGG - Intronic
954027523 3:47795036-47795058 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
954143507 3:48622432-48622454 GAGGCAGAGCTTGCGGTGAGCGG - Intergenic
954412317 3:50376192-50376214 GAGGCACAGATTGGGGGCTCAGG + Intronic
954623831 3:52011493-52011515 GAGGCAGAGATTGCAGTGACTGG - Intergenic
956000112 3:64720935-64720957 GAGGCAAAGATTGCAGTGAATGG - Intergenic
956329792 3:68093527-68093549 GCTGCAAAGATTGGGATGATTGG - Intronic
959233433 3:103688851-103688873 GAGGCACAGATTGCAGTGAGTGG - Intergenic
959861760 3:111224383-111224405 GAGGCAGAGATTGCAGTGAACGG - Intronic
959971637 3:112416562-112416584 GAGGCCCAGACTGGTGTGGTGGG - Intergenic
960234219 3:115262895-115262917 CAGGCACAGATTCTGGTAATTGG - Intergenic
960265976 3:115621576-115621598 GAGGCAGAGAATGTGGGGATTGG - Intergenic
960741665 3:120840931-120840953 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
960945373 3:122962779-122962801 GAACCACAGACTGGGGTGATGGG + Intronic
961111459 3:124287389-124287411 GAGGCTGAGATTTGGGTGACAGG - Intronic
962068854 3:132012237-132012259 GAGGCAGAGATTGCAGTGAGCGG - Intronic
962095158 3:132285440-132285462 TAGGCACAGGATGGGGGGATGGG + Intergenic
965861273 3:173153923-173153945 GAGGCAGAGACTGGAGTAATTGG + Intergenic
966441287 3:179947775-179947797 GAGGCAGAGCTTGCGGTGAGTGG - Intronic
967865461 3:194186564-194186586 GAGGCACACACTGGGGCAATGGG - Intergenic
967933136 3:194705235-194705257 AAGGCACAGAGAGGGGGGATTGG + Intergenic
968270420 3:197399213-197399235 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
968652497 4:1765836-1765858 CAGGCACAGAGTGGGGAGAAGGG + Intergenic
969440971 4:7216621-7216643 AAGGCAGAGATTGGAGGGATGGG - Intronic
969956105 4:10892384-10892406 GAAGCAGAGGTTGGAGTGATGGG + Intergenic
971193061 4:24445993-24446015 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
971261713 4:25063251-25063273 GAGGCAGAGATTGGAGTAATGGG + Intergenic
971285528 4:25285612-25285634 GAGGCAGAGATTGCAGTGAGGGG - Intergenic
973185331 4:47320838-47320860 GAGGCGGAGATTGCGGTGAGCGG - Intronic
973603327 4:52562815-52562837 AAGGCAGAGATAGGGCTGATGGG - Intergenic
976334668 4:83871578-83871600 GTGTCACAGAGTGGGGTAATAGG - Intergenic
976471585 4:85435140-85435162 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
976749778 4:88442566-88442588 GAGGGAGAGATTGGGGGAATGGG + Exonic
976787363 4:88837063-88837085 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
977571512 4:98634006-98634028 GAGGCAGAGGTTGCGGTGAGTGG + Intronic
977804276 4:101278336-101278358 GAGGCAAAATTTGGGGTAATGGG - Intronic
978172871 4:105694993-105695015 GAGGCAGAGATTGCAGTGAGCGG - Intronic
978189464 4:105895591-105895613 GAGGAACAGGTTGGGGTGGTGGG - Exonic
978707167 4:111727683-111727705 GAGGCGGAGATTGCGGTGAGCGG - Intergenic
979443375 4:120779830-120779852 GAGGCACAGGTTGTGGAGAGCGG + Intronic
981336568 4:143574853-143574875 AAGGCAGAGATTGGAGTAATAGG - Intergenic
981831097 4:149003069-149003091 GAGGAACAGATTGCAGTGATTGG + Intergenic
983486169 4:168333090-168333112 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
983817811 4:172154301-172154323 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
984086577 4:175320228-175320250 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
984346240 4:178531152-178531174 GAGGCAGAGGTTGTGGTGAGTGG + Intergenic
984667176 4:182441566-182441588 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
984993960 4:185409850-185409872 GAGGCAGAGATCGGAATGATGGG + Intronic
985040640 4:185888373-185888395 GAGGCAGAGACTTGAGTGATGGG + Intronic
985471987 5:52413-52435 GAGGCACAGGTTGCAGTGAGTGG + Intergenic
985545582 5:507603-507625 GGGGCAGGGATTGGGGTGTTGGG - Intronic
985569771 5:638627-638649 GAGGCAGAGATGGGGGAGGTGGG + Intronic
985963256 5:3319826-3319848 GAGGCACAGGCTGGGGTGGAAGG + Intergenic
986066971 5:4244051-4244073 GAGGCAAAGGTTGGGCTAATTGG + Intergenic
986732916 5:10648686-10648708 GAGGCAGAGGTTGCGGTGAACGG + Intronic
987302805 5:16611517-16611539 TAGGCACAGAATGGAGTGAAAGG - Intronic
987342404 5:16950481-16950503 GAGGCAGAGGTTGGAGTGAGCGG + Intergenic
987802419 5:22716064-22716086 GAGGCAGAGATTGCAGTGAGCGG + Intronic
988115726 5:26887817-26887839 GAGACAGAGATTGGAGTAATTGG + Intronic
988449931 5:31331465-31331487 CAGGCACAGATCAAGGTGATAGG + Intergenic
988724491 5:33912569-33912591 GAGACAGAAATTGGAGTGATGGG + Intergenic
991054217 5:62305116-62305138 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
992903464 5:81321874-81321896 GAGGCAAAGGTTGCGGTGAGTGG + Intergenic
993895661 5:93530500-93530522 GAGGCAAAGACTAGGCTGATGGG - Intergenic
995068855 5:107894408-107894430 GAGGCAAAGATGGGGGACATTGG + Intronic
995254595 5:110032080-110032102 GATGCAGAGATTGGAGTAATTGG - Intergenic
995261943 5:110114316-110114338 GAGGCAGAGAAGGAGGTGATGGG - Intergenic
997003378 5:129788592-129788614 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
997919509 5:137965096-137965118 GAGGAGCAGATTGCGGTGAGTGG + Intronic
998400093 5:141844219-141844241 GAGGCAGAGGTTGGGGTGGTAGG - Intergenic
998481956 5:142470143-142470165 GAGGCACAGATTTGGGTCTGGGG + Intergenic
999740599 5:154547450-154547472 TAGACACAGAGTGGGGTGACAGG + Intergenic
1001293803 5:170485009-170485031 GAGGCAGAGATTGCAGTGAGTGG - Intronic
1001614384 5:173031013-173031035 GAGGCAGAGATTGCGGTGAGCGG - Intronic
1002255141 5:177953046-177953068 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1002514397 5:179746273-179746295 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1003626974 6:7750020-7750042 GAGGCACAGATTCTGGCAATGGG + Intronic
1003677868 6:8223368-8223390 AAGGTAGAGATTGGGGTGATGGG + Intergenic
1003702822 6:8489156-8489178 GAGGCGGAGATTGCAGTGATTGG + Intergenic
1004015190 6:11725827-11725849 GAGGCAGAGCTTGCAGTGATTGG + Intronic
1004041007 6:11975478-11975500 GAGGCAGAGGTTGCGGTGAACGG + Intergenic
1004085979 6:12449680-12449702 GAGGCAGAGACTGGAGTGATGGG + Intergenic
1004288279 6:14343097-14343119 GAGACACACATCGGGGTAATGGG + Intergenic
1005832127 6:29679811-29679833 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1006585865 6:35111507-35111529 GAGGCAAAGATTGGCATAATGGG + Intergenic
1006904296 6:37522702-37522724 GATGCAGAGCTTGGCGTGATTGG + Intergenic
1007604182 6:43104881-43104903 GAGGCGGAGATTGGAGTGAGCGG - Intronic
1008494491 6:52118821-52118843 GAAGTTCAGATTGGGGAGATGGG - Intergenic
1008594863 6:53031902-53031924 GAGGCAGAGGTTGGGGTGAGCGG - Intronic
1009041438 6:58183864-58183886 GAAGCACATACTGGAGTGATGGG - Intergenic
1009349785 6:62660276-62660298 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1009734629 6:67661211-67661233 GAGGCACAGAATGGGGGGATTGG + Intergenic
1011257861 6:85442248-85442270 GAGGCAGAGATTGCAGTGAGTGG + Intergenic
1011822484 6:91270495-91270517 GATGCAGACATTGGGGTGAAGGG + Intergenic
1012971980 6:105741064-105741086 GAGACACTGATTAGGGTGTTTGG - Intergenic
1013266146 6:108501062-108501084 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1013371976 6:109478628-109478650 GAGGCGGAGGTTGTGGTGATCGG + Intronic
1013509474 6:110831366-110831388 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1013628388 6:111960034-111960056 AAGGCAGATACTGGGGTGATGGG + Intergenic
1013992843 6:116274490-116274512 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1015352768 6:132242209-132242231 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1015793295 6:136985896-136985918 GAGGCAGAGCTTGTGGTGAGTGG - Intergenic
1016105139 6:140152881-140152903 GAGGCAGAGGTTGTGGTGAGTGG + Intergenic
1017095867 6:150805004-150805026 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
1017725868 6:157275402-157275424 GAGGCAGAGACTGGAGTGACGGG - Intergenic
1018768409 6:166952094-166952116 AAGGCAGAGATTGGGGTGATGGG + Intronic
1018991160 6:168675399-168675421 GATGCACAGATTGGTGTCCTTGG - Intergenic
1019310627 7:358994-359016 CAGGCACAGCTTGGGGTGCGTGG - Intergenic
1019736747 7:2653790-2653812 GAGGCAGAGATTGCGGTGAGCGG + Intronic
1019742049 7:2679907-2679929 GAGGCCCAGCTGGGGGTGAAGGG + Intronic
1020325040 7:6967855-6967877 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1020886246 7:13822347-13822369 AAGACAGAGATTGGGGTGACAGG - Intergenic
1021491947 7:21228466-21228488 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1021934563 7:25616945-25616967 GAAGCACAGAGCTGGGTGATGGG - Intergenic
1022021409 7:26402609-26402631 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1023272321 7:38477519-38477541 AAGGCACAGATTGTGCTAATGGG + Intronic
1024785352 7:52901169-52901191 GAGGAACAGAATGGAGGGATCGG + Intergenic
1025069955 7:55889170-55889192 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1025151178 7:56551895-56551917 GAGGCAGAAATTGCGGTGAGCGG + Intergenic
1026068574 7:67097467-67097489 GAGGCACAGATTGCAGTGAGAGG - Intronic
1026708338 7:72714844-72714866 GAGGCACAGATTGCAGTGAGAGG + Intronic
1026742141 7:72985485-72985507 GAGGCAGAGGTTGCGGTGACTGG - Intergenic
1026801986 7:73405908-73405930 GAGGCAGAGGTTGCGGTGACTGG - Intergenic
1027101594 7:75379593-75379615 GAGGCAGAGGTTGCGGTGACTGG + Intergenic
1030755467 7:113282797-113282819 GGGGCATAGAGTGGGGTGAGAGG - Intergenic
1031289983 7:119922082-119922104 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
1031573488 7:123387292-123387314 GAGGCAGAGATTGGAGTGATGGG + Intergenic
1032065103 7:128762735-128762757 GAGGCAGAGATTGTAGTGAGTGG - Intronic
1032220147 7:129988376-129988398 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1032687590 7:134251307-134251329 AAGACTCAGATTGGGGTGATGGG + Intronic
1032689466 7:134268798-134268820 GAGGCAGAGCTTGCAGTGATTGG - Intergenic
1033128079 7:138722255-138722277 GAGGCACAGCTTGTAGTGAGCGG + Intronic
1033179879 7:139166026-139166048 GAGGCAGAGGTTGCGGTGAGCGG - Intronic
1033202971 7:139390329-139390351 GAGGCAGAGGTTGTGGTGAGTGG - Intronic
1033288890 7:140064475-140064497 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1035004948 7:155649863-155649885 GAGGCTAAGGTTGGGGTTATAGG - Intronic
1035119313 7:156551759-156551781 GAGGCAGAGATTGTAGTGAGTGG + Intergenic
1035551512 8:531120-531142 GTGGCACAGCTTGGCATGATTGG - Intronic
1035735981 8:1887929-1887951 GAGACAGTGATTGGGGTGAGGGG + Intronic
1035736071 8:1888445-1888467 GAGGCACTGAGTGGGGTGAGGGG + Intronic
1035736155 8:1888942-1888964 GAGACACTGAGTGGGGTGAGGGG + Intronic
1035736176 8:1889060-1889082 GAGACAGTGATTGGGGTGAGGGG + Intronic
1035736229 8:1889351-1889373 GAGACACTGAGTGGGGTGAGGGG + Intronic
1035736238 8:1889409-1889431 GAGACACTGAGTGGGGTGAGGGG + Intronic
1035736245 8:1889440-1889462 GAGACACTGAGTGGGGTGAGGGG + Intronic
1035736252 8:1889471-1889493 GAGACACTGAGTGGGGTGAGGGG + Intronic
1035736259 8:1889502-1889524 GAGACACTGAGTGGGGTGAGGGG + Intronic
1035736270 8:1889563-1889585 GAGACACTGAGTGGGGTGAGGGG + Intronic
1036648667 8:10627973-10627995 GAGGCACAGCTTGGGGAGGCAGG + Intronic
1037480890 8:19304083-19304105 GAGAGAGAGAGTGGGGTGATGGG + Intergenic
1037597148 8:20363750-20363772 GAGGCAGAGACTGGAGTGATGGG + Intergenic
1037610275 8:20470149-20470171 AAGACAGAGATTGGAGTGATGGG - Intergenic
1038037529 8:23699168-23699190 CAGGCAGAGAGTGGGGAGATGGG + Intergenic
1038524725 8:28263127-28263149 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1038810445 8:30836282-30836304 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1040797913 8:51306863-51306885 GAGGCAAAGGTTGCGGTGAGCGG + Intergenic
1040809318 8:51433136-51433158 GAGGCAGAGATTGCGGTGAGCGG + Intronic
1041038988 8:53826879-53826901 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1041079939 8:54206643-54206665 GAGGCTCAGACTGGGGTGGTAGG + Intergenic
1041752295 8:61273764-61273786 GAGTCAAAGAAAGGGGTGATGGG - Intronic
1041891846 8:62877967-62877989 GAGGCAGAGGTTGTGGTGAGTGG + Intronic
1042252112 8:66766920-66766942 GAGGCAGAGATTGCGGTGGGCGG - Intronic
1043113528 8:76218663-76218685 GAGGCCGAGCTTGGGGTGAGCGG - Intergenic
1044212154 8:89562492-89562514 GAGGGATAAATTGGGGTAATGGG - Intergenic
1045000033 8:97870445-97870467 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1046351877 8:113025710-113025732 CAGGCACACATGGGTGTGATAGG + Intronic
1046870327 8:119198281-119198303 AAGGCACAGATTTTGGTGATGGG + Intronic
1047047731 8:121073634-121073656 GAGACACAGATTAGAGTGATGGG + Intergenic
1047351739 8:124080677-124080699 GACCCACAGCTTGGGGAGATGGG + Intronic
1048176460 8:132156926-132156948 GAGGCAGAGATTGGAGGAATGGG + Intronic
1048579884 8:135722216-135722238 GAGGCAGAGACTGGAGTGAGGGG - Intergenic
1049102644 8:140590414-140590436 GAGGCACAGATGGGGGTCCCAGG + Intronic
1049102662 8:140590481-140590503 GAGGCACAGATGGGGGTCCCAGG + Intronic
1049122953 8:140756250-140756272 GAGGCAGAGGTTGCAGTGATTGG + Intronic
1049873062 8:144996276-144996298 TAGCCACAGGTTGGGGTGAGGGG - Intergenic
1049952103 9:655298-655320 GAGGCAGAGGTTGCGGTGAGTGG + Intronic
1050120420 9:2301899-2301921 GAAGCAGAGATTGGAGTGAGAGG - Intergenic
1050466555 9:5931279-5931301 GAGGCACAGGATGGGGAGACTGG + Intronic
1051706031 9:19880750-19880772 GAGGAAGAGATTGGGGGGATTGG + Intergenic
1051972125 9:22901659-22901681 GAAGCAGAGATTGAAGTGATTGG + Intergenic
1052989736 9:34512215-34512237 GAGGGTCACACTGGGGTGATTGG + Intronic
1053205088 9:36179431-36179453 GAGGCCCGGTGTGGGGTGATTGG - Intergenic
1053243631 9:36516919-36516941 GAGGCAGAGGTTGCGGTGAGCGG - Intergenic
1053540804 9:38971450-38971472 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1053564823 9:39238017-39238039 GAGGCAGAGATTGCAGTGAGCGG - Intronic
1053805220 9:41794501-41794523 GAGGCAGAGGTTGCGGTGAGTGG + Intergenic
1054132328 9:61381008-61381030 GAGGCAGAGATTGCAGTGAGCGG + Intergenic
1054140040 9:61520860-61520882 GAGGCAGAGGTTGTGGTGAGTGG - Intergenic
1054625335 9:67392456-67392478 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
1055406158 9:75975639-75975661 TAGGCACAGATTTGTGGGATTGG + Intronic
1055516192 9:77036062-77036084 GAGGCAGAGGTTGCGGTGAGCGG + Intergenic
1056328680 9:85503739-85503761 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1056407361 9:86287466-86287488 AAGGCACAGATGGGGGTGGGGGG - Intergenic
1056537386 9:87541476-87541498 GAGGCAAAGATTGCGGTGAGTGG + Intronic
1057157531 9:92856790-92856812 GAGGCAGAGCTTGCGGTGAGTGG - Intronic
1057333202 9:94135519-94135541 GAGGCAGAGATTGGAATGATGGG - Intergenic
1058038216 9:100276378-100276400 GAGAGACAGACTGTGGTGATGGG - Intronic
1058437375 9:104975604-104975626 GAGGCAGAGGTTGCAGTGATCGG - Intergenic
1058566194 9:106287769-106287791 GAGACAGAGATGGGGGTGCTGGG - Intergenic
1058931112 9:109720057-109720079 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1059108511 9:111532458-111532480 TAGGCAGAGTTTGGAGTGATAGG + Intronic
1059203221 9:112438165-112438187 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1059474832 9:114537680-114537702 GAGGCAGAGATTGGAGTAACGGG + Intergenic
1059907290 9:119002276-119002298 GAGGCAGAGATTGTAGTGAGCGG - Intergenic
1060403995 9:123364053-123364075 GAGGTACAGATTGGGGGGCTGGG + Intronic
1060815672 9:126633892-126633914 GAGGCACAGAAAGGGGTAGTCGG + Intronic
1060999886 9:127897141-127897163 GAGGAAGAGATTGGGGTGTGCGG - Intronic
1061053026 9:128207149-128207171 GAGGAGCAGACTGGGGGGATGGG + Intronic
1061426872 9:130505021-130505043 GAGGCAGAGGTTGGGGTGAGCGG - Intergenic
1061648341 9:132025249-132025271 GAGGCAGAGATTGCGGTGAGAGG - Intronic
1185511144 X:666040-666062 GAGGTAGAGACTGGAGTGATGGG + Intergenic
1185523955 X:762304-762326 GAGGCAGAGACTGGAGTGATGGG - Intergenic
1185536912 X:869648-869670 GAGGCAGAGACTGGAGTGATGGG - Intergenic
1185539866 X:894524-894546 GAGGCAGAGATTGAGGTGTTGGG + Intergenic
1185561190 X:1061704-1061726 GAGGCAGAGACTGGAGTGATGGG - Intergenic
1185568456 X:1114608-1114630 GAGGCAGAGACTGGAGTGATGGG + Intergenic
1185579810 X:1203279-1203301 GAGGCAGAGACTGGAGTGATGGG + Intronic
1185630589 X:1513819-1513841 GAGGCAGAGACTGGAGTGATGGG - Intronic
1185653583 X:1666806-1666828 GAGGCAGAAACTGGAGTGATGGG - Intergenic
1185659491 X:1715448-1715470 GAGGCAGAGATTGCAGTGAGTGG + Intergenic
1185764904 X:2717275-2717297 GAGGCAGAGGTTGTGGTGAACGG + Intronic
1186814708 X:13225087-13225109 GAGGTAGAGACTGGAGTGATAGG - Intergenic
1186946955 X:14579398-14579420 GAGGCGCAGGTTGCGGTGAGTGG - Intronic
1187426491 X:19181958-19181980 GAGGCAGAGATTGCAGTGAGCGG - Intergenic
1188210216 X:27415048-27415070 GAGGCAGAGGTTGAGGTGAGCGG - Intergenic
1189459750 X:41230128-41230150 GAGGCACAGATTGCAGTGAGCGG + Intronic
1189908672 X:45787596-45787618 GGTGCACAGATTGGCGTGTTTGG - Intergenic
1190145632 X:47889452-47889474 AAGGCACAGGCTGGGGAGATGGG + Intronic
1190876013 X:54460668-54460690 GAGGCAGAGATTGCAGTGAGCGG + Intronic
1191206105 X:57835422-57835444 CAGGGACAGTTTGGGGTTATTGG - Intergenic
1191881002 X:65843679-65843701 GAGACAGAGATTGTGGTGCTTGG - Intergenic
1192099166 X:68245872-68245894 GAGGCAGAGGTTGTGGTGAGCGG - Intronic
1192170827 X:68853421-68853443 AAGGCAGAGATTGGAGTGAGAGG - Intergenic
1192300212 X:69893163-69893185 AAGGCAGAGGTTGGAGTGATGGG - Intronic
1192456375 X:71279544-71279566 GAGGCAGAGACTGGAGTGAAAGG + Intergenic
1192592607 X:72373199-72373221 GAGGGACAGATTTGGCTCATGGG - Intronic
1195773976 X:108382875-108382897 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1196437261 X:115686042-115686064 GAGGCAGAGGTTGCGGTGAGTGG - Intergenic
1197359293 X:125478958-125478980 GTGGCACAATTTGGGATGATAGG - Intergenic
1197966261 X:132065501-132065523 GGGACACAGATTTGGGTCATTGG - Intergenic
1198176747 X:134163975-134163997 GAGACAGAGACTGGAGTGATGGG + Intergenic
1198201971 X:134430801-134430823 GAGGCAGAGGTTGTGGTGAGCGG - Intergenic
1198417272 X:136433510-136433532 GCAGGACAGATTTGGGTGATGGG - Intergenic
1198685506 X:139224376-139224398 GAGGCTCAGTTTGGGGTGTGAGG - Intergenic
1199259775 X:145758922-145758944 TAGGCACAAACTGGGGCGATAGG + Intergenic
1199808011 X:151320817-151320839 GAGGCAGAGGTTGGGGTGGGCGG - Intergenic
1199835639 X:151587393-151587415 CAGGCACAGTTTAGGGTGCTAGG + Intronic
1200085150 X:153600446-153600468 GAGGCACAGATTGGAGTGATGGG - Intergenic
1200136465 X:153877389-153877411 GAGGCAGAGGTTGCGGTGAGCGG + Intronic
1201018505 Y:9627614-9627636 GAGGCACAGTTTGAGGCGAGTGG - Intergenic
1201609375 Y:15823676-15823698 CAGGCACAGAATGGGGAGGTGGG + Intergenic