ID: 1113302944

View in Genome Browser
Species Human (GRCh38)
Location 13:109042727-109042749
Sequence TGTTAAATAATATTACCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113302944 Original CRISPR TGTTAAATAATATTACCTAA GGG (reversed) Intronic
903413231 1:23164071-23164093 TTTTAATTATTATTTCCTAATGG + Intronic
904202250 1:28828152-28828174 TCTTAAATAATAAAACTTAAAGG + Intronic
905180827 1:36165421-36165443 TTTTAAATAAAATTAAATAAAGG - Intronic
905515341 1:38558390-38558412 TGGTAAATAACATTACCTGAAGG + Intergenic
906221313 1:44081985-44082007 TGTTAAATAATTTTTCTTAATGG + Intergenic
908845850 1:68323472-68323494 TGTTAAACAATGTTAACTAGAGG + Intergenic
909897755 1:81094282-81094304 TGTTAACTAATTTTAACAAAAGG - Intergenic
910198019 1:84665964-84665986 AGTTAAATACTATTACACAAAGG + Intronic
910340937 1:86186346-86186368 TTTTAAAAAATATTTCATAATGG + Intergenic
910611302 1:89145263-89145285 TTTTAAATAATTTCACATAAAGG + Intronic
911205156 1:95085230-95085252 TGTGAAATAATATTTTTTAAAGG + Intergenic
911748943 1:101473245-101473267 TGGTAAATAATACTACCTTCTGG - Intergenic
913413653 1:118580625-118580647 TTTTAAATATTATTTCCTACAGG - Intergenic
916427191 1:164691937-164691959 TGTTATATAAAATTACCTTTAGG + Intronic
918656633 1:187034878-187034900 TAATAAATAATAATAGCTAAGGG + Intergenic
918903886 1:190465006-190465028 AGTTAAATGCTAATACCTAATGG + Intronic
921951537 1:220935201-220935223 GGTAAAATAATAGTACCTGATGG - Intergenic
922083475 1:222322320-222322342 TTTTAAAAAACATTACATAATGG - Intergenic
923000863 1:230005330-230005352 TGTTTAATAGGATTACCTACAGG - Intergenic
923419880 1:233802283-233802305 TATTATAAAATATTTCCTAAGGG + Intergenic
1064630332 10:17304828-17304850 TGATAAATAATATCACAGAATGG - Intergenic
1065215250 10:23441518-23441540 TTTTAAAGAAAATTACTTAATGG + Exonic
1065647379 10:27849761-27849783 TGTGAAAAAATAGTTCCTAATGG + Intronic
1065797995 10:29324520-29324542 CGTCAAATAGTATTACCTCATGG + Intergenic
1069131141 10:64704551-64704573 TATTAAATATTCTTACCTAATGG - Intergenic
1069273857 10:66565483-66565505 TCTTAATTAATATTCCATAAAGG + Intronic
1069309266 10:67013020-67013042 GCTTAAAGAATATTACCTAGTGG - Intronic
1073497282 10:103904553-103904575 TTTTAATTTATATTACTTAATGG + Intronic
1073717602 10:106125494-106125516 TATTGAATAATATTTACTAAGGG - Intergenic
1073806053 10:107099410-107099432 AGTTAAACAAGATTCCCTAAAGG + Intronic
1074904670 10:117851231-117851253 TTTTAAAAAATACTACATAAAGG - Intergenic
1075477372 10:122747785-122747807 TGTTAAACAATACATCCTAAGGG + Intergenic
1077961678 11:7082317-7082339 TGTAAAACAATATTACATTATGG + Intergenic
1078982346 11:16550759-16550781 AGTAAAATAATATTATTTAAAGG + Intronic
1079568960 11:21918961-21918983 TGTAAAATATTCTTACCAAATGG + Intergenic
1079662879 11:23063599-23063621 ATTTAAATAATGTTACATAAGGG + Intergenic
1080693642 11:34581772-34581794 TGTTCAATAATATGACCACATGG + Intergenic
1081002232 11:37689228-37689250 TATTATATAATATTAGGTAATGG + Intergenic
1081697856 11:45129184-45129206 TGTTAAAAGATGTTAGCTAAGGG - Intronic
1083523345 11:63337189-63337211 TGGTTATTAATATTACCTACAGG + Intronic
1083542354 11:63521268-63521290 TTTTAAATCATTTTACCTACAGG - Intergenic
1086019694 11:82211994-82212016 TGTTCAGTAATATTTCCGAAGGG - Intergenic
1086326086 11:85701309-85701331 TGTTATATAAAATTACCTTCAGG - Intronic
1088060461 11:105643416-105643438 GGTTAAATAATTGTACCTAGAGG - Intronic
1088161278 11:106874227-106874249 TGTTAGATAACCTTACTTAAGGG + Intronic
1088498406 11:110456387-110456409 TGTGAAATAATATAACGTGAGGG + Intronic
1089043458 11:115476910-115476932 TAATAAATAAAATTACCAAAGGG - Intronic
1090169953 11:124592520-124592542 TTATAAATAATACTACCTGAAGG + Intergenic
1090463881 11:126915801-126915823 TGTGAAATGCTCTTACCTAAAGG - Intronic
1093016653 12:14162049-14162071 TGTTACATAACAATACCTATCGG + Intergenic
1093158078 12:15712572-15712594 TCTTAAATACCATGACCTAAAGG + Intronic
1093436864 12:19145522-19145544 AGTTAAAGAATAGTACCTACAGG - Intronic
1095496943 12:42795091-42795113 GGATAAATAATATTGGCTAAAGG + Intergenic
1095558354 12:43535648-43535670 CCTTAAATAATATGATCTAATGG - Intronic
1095864955 12:46961654-46961676 TTTTAAAGAGAATTACCTAATGG - Intergenic
1095933817 12:47655447-47655469 TATTAAATAAAATTACCAAGAGG + Intergenic
1097777426 12:63665004-63665026 TGTAAAATAATATTTCCTTCTGG - Intronic
1097921883 12:65084535-65084557 AGTTAAATAATAATACATAGTGG - Intronic
1098280677 12:68859901-68859923 CGTCAAATCATATTACCTTAAGG + Intronic
1099213946 12:79831117-79831139 TATTAAAGAGTATTACATAAAGG - Intronic
1099340857 12:81432011-81432033 GGTTTAGTAATATTACCAAAGGG - Intronic
1099367052 12:81780077-81780099 TGTTAAATGTTATTTACTAATGG + Intergenic
1099569281 12:84295146-84295168 TGTTAGATCATATTATCTAGAGG - Intergenic
1099716766 12:86304833-86304855 AGTCAAATGATATTACCAAATGG + Intronic
1099926894 12:89029614-89029636 TCTTAAATACTGATACCTAATGG + Intergenic
1101842100 12:108335072-108335094 TGTTAACTAAGATTGACTAATGG + Intronic
1104249163 12:127074222-127074244 TGTTGAATGCTATTTCCTAATGG - Intergenic
1105205412 13:18219160-18219182 TGTTAGATAATATTTCCTTGGGG + Intergenic
1107882113 13:44841885-44841907 TTTTAAATATTAGTACCTGAAGG + Intergenic
1108279448 13:48846809-48846831 CCTTAAATAATATCACATAAGGG + Intergenic
1108879190 13:55088057-55088079 TGTAAAATCATAGTACTTAACGG - Intergenic
1109417767 13:62065896-62065918 TGTTAATTATTTTTAACTAAAGG - Intergenic
1109440752 13:62369412-62369434 TGTTTAATAATTTTACTTATTGG - Intergenic
1109654842 13:65376273-65376295 TGTTAAATATTATTACCTTTTGG - Intergenic
1109849398 13:68040537-68040559 TTTTTCATAATATTGCCTAAGGG + Intergenic
1110198915 13:72825243-72825265 TGTTAGATAATATTATATTAGGG + Intronic
1110478956 13:75951259-75951281 AATTAAATAATATGACCTTAAGG - Intergenic
1110490865 13:76104931-76104953 TGAAAAATAAAATTACATAAAGG - Intergenic
1113302944 13:109042727-109042749 TGTTAAATAATATTACCTAAGGG - Intronic
1113384441 13:109835439-109835461 TGTTAATTAATTTTACAGAAAGG - Intergenic
1116146701 14:41082175-41082197 TATCAAAGAAAATTACCTAAAGG + Intergenic
1116378916 14:44240176-44240198 AGTTAAATAAAAATAACTAAAGG + Intergenic
1118085896 14:62416835-62416857 TGTTTGATTATATTACCTATTGG - Intergenic
1118632692 14:67720750-67720772 TGTTAAATATTATAATCCAAAGG - Intronic
1119819996 14:77607133-77607155 TTTTAAAGAATATCACCTAAAGG + Intronic
1120085993 14:80273996-80274018 TGTTATGTAGCATTACCTAAGGG - Intronic
1120669329 14:87346197-87346219 TGTTAAATAATATTACAATCAGG - Intergenic
1121205388 14:92160911-92160933 TGTTAAATAATGTTAAATAATGG + Intronic
1122056448 14:99101451-99101473 TTTTAAATAAGATTTGCTAAAGG + Intergenic
1124877602 15:33609948-33609970 TTTTAAATAATTTTACCTATAGG + Intronic
1125181458 15:36884589-36884611 AGTTAAATCATATTGCTTAAAGG - Intergenic
1125468812 15:39982229-39982251 TTTTAAATTGTTTTACCTAAAGG + Intronic
1125852476 15:42917907-42917929 TGTAAAAGAATATTTCCTATAGG + Intronic
1126324905 15:47465888-47465910 TCTGCAATAATATTACCTATTGG + Intronic
1126973844 15:54151304-54151326 TCTTAAATACTATTAAATAATGG - Intronic
1127504820 15:59588215-59588237 TTTTAAATAATTTTTCTTAATGG - Intergenic
1127885256 15:63193500-63193522 TGTTAATTATGATTACATAAGGG - Intronic
1128101833 15:65007759-65007781 TTTTAAAAAATATAACCAAAGGG - Intronic
1131109114 15:89753522-89753544 TGTTAAAGAATATTAGAAAAGGG + Intergenic
1131681015 15:94723511-94723533 TGTTAGATAATATTTCCCAGAGG + Intergenic
1131721869 15:95178223-95178245 TGTAAACTAATATTACCAATGGG - Intergenic
1132129295 15:99260718-99260740 TGTTAAAATATAGTTCCTAAAGG + Intronic
1133507346 16:6425119-6425141 TGAAAAATAATATTACTAAAAGG - Intronic
1137340443 16:47597364-47597386 TGTGAAATATTCTTCCCTAATGG - Intronic
1137660921 16:50205459-50205481 TGTTAACAGATATTACCTTAGGG - Intronic
1140152619 16:72386069-72386091 TGTTACATAAAATTACCTTCAGG - Intergenic
1140644105 16:77011157-77011179 TATTAAATTATATTTCCTATAGG - Intergenic
1141044131 16:80700712-80700734 TGTTAAATTACCTTCCCTAAAGG - Intronic
1141321585 16:83015254-83015276 TATTAAATAATATGAGTTAAAGG + Intronic
1141385434 16:83618768-83618790 TGTTAATAAATAATACATAAAGG + Intronic
1142822677 17:2484135-2484157 TGATAAAGAGTATTATCTAAGGG + Intronic
1145227841 17:21145353-21145375 TTTTAAATTATAGTACTTAATGG + Intronic
1146418902 17:32664089-32664111 TGTTAAAAAATAGAGCCTAAGGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149725549 17:58890235-58890257 TGTTAAATAATCTTAACTCTTGG - Intronic
1150027693 17:61694725-61694747 TGTGAAATAATATTTCATTATGG + Intronic
1152848945 17:82620130-82620152 TTCTAAAAAATACTACCTAAAGG + Intronic
1153398701 18:4656491-4656513 TATTATATAAAATTACCTACTGG + Intergenic
1156182675 18:34624029-34624051 TTTTAATTAAAATTACCCAAAGG + Intronic
1156215136 18:34990297-34990319 TGTTAAATACTAATACCTCTGGG + Intronic
1156326960 18:36083205-36083227 TGTCAAAAAATACTAGCTAACGG + Intergenic
1156642091 18:39114464-39114486 TATTAAACAATTTTTCCTAAGGG - Intergenic
1156676851 18:39537507-39537529 TTTTATATGATATTACTTAATGG - Intergenic
1156996452 18:43474252-43474274 TGATAAATATTATTTTCTAATGG - Intergenic
1157943268 18:51952479-51952501 TTTTAAATAATATAACATATGGG + Intergenic
1158123883 18:54081314-54081336 TGTTAAATGGTATTAGCTTAAGG - Intergenic
1158170444 18:54593216-54593238 TTTTTAATAATAATTCCTAATGG + Intronic
1158739855 18:60128060-60128082 TATTCAATAATATTAAGTAATGG + Intergenic
1158785006 18:60700775-60700797 TGTTAAATTATGTTATCTATGGG + Intergenic
1159358515 18:67369113-67369135 TGTAGAAAAATATTACCTTATGG + Intergenic
1159389904 18:67777513-67777535 TGTTAAAGAATATTTTATAAAGG + Intergenic
1159396366 18:67863224-67863246 TTTAAAATAATATTAGCTACAGG - Intergenic
1159397319 18:67877644-67877666 TTATAAATAGTATTACTTAAAGG - Intergenic
1159464054 18:68757361-68757383 TTTGAAATAATATTACCAAAAGG - Intronic
1159783762 18:72690481-72690503 TGTTAAATAATATTTTATTAAGG - Intergenic
1159787557 18:72732261-72732283 TGGGAAATTATATTACCTGAGGG + Intergenic
1160331572 18:77997320-77997342 TGTTGTATAATATTTCCTAAGGG - Intergenic
1163963013 19:20715160-20715182 TTTTAAATAAAATGAACTAATGG - Intronic
1164214957 19:23136256-23136278 TGTAAAGTAAGATTACCAAAGGG - Intronic
1164439959 19:28268867-28268889 TGTTGTATAATATTACTTGAAGG - Intergenic
1167653386 19:50746470-50746492 TTTTAAATCATAGTACCTCACGG - Intergenic
925045268 2:768425-768447 TTTTAAAAAATAGTACCTCAGGG + Intergenic
925649181 2:6070918-6070940 TATTAAAAATTATTTCCTAATGG - Intergenic
925834098 2:7926633-7926655 TTTTAAATAATAATAAATAAAGG + Intergenic
926654255 2:15383102-15383124 TATTAAATAATATTACTTCCAGG + Intronic
928512871 2:32017738-32017760 TGTTTAATTAAATTACGTAATGG - Intronic
929525338 2:42696410-42696432 TTTTGAATAATATTACCTCTGGG + Intronic
929719954 2:44357771-44357793 TGCAAAATAAAATAACCTAAAGG + Intronic
929848316 2:45555958-45555980 TATTAATTAATATTACCTTAAGG + Intronic
930518680 2:52436498-52436520 TATGATATAATATTACATAAGGG - Intergenic
931059056 2:58505711-58505733 TTTCAAATAATAGTACCTAATGG - Intergenic
934585954 2:95495533-95495555 GGTCAAATAAGATTACCTCAAGG + Intergenic
934593509 2:95581231-95581253 GGTCAAATAAGATTACCTCAAGG - Intergenic
935895074 2:107727389-107727411 AGTTTAAAAATAGTACCTAATGG - Intergenic
937172049 2:119883226-119883248 TATTATATAATATTACCTTCAGG + Intronic
938971946 2:136440613-136440635 AAGTAAATAATATTAGCTAATGG - Intergenic
939200243 2:139024681-139024703 TGGTATATTCTATTACCTAAAGG - Intergenic
939434535 2:142156939-142156961 TGTTAAATAATTTTACCTTTTGG + Intergenic
939445472 2:142304287-142304309 TCTTAGATATTATTCCCTAATGG + Intergenic
939656075 2:144826965-144826987 TTTTAAAAAATATTACATTAGGG + Intergenic
941463386 2:165796446-165796468 TGTTTTATAAAATTACCTTAAGG - Intergenic
941837535 2:170041788-170041810 TGATAAATCCTTTTACCTAAGGG + Intronic
943060277 2:183036488-183036510 TTTTAAATAGTATTACTTAGAGG - Intronic
943883332 2:193177414-193177436 TGTTTAATAATATTATTGAAGGG + Intergenic
943910286 2:193556616-193556638 GGTTAAATAATATTATTTTAAGG + Intergenic
944496470 2:200312055-200312077 TGTTCAATAATGGAACCTAAAGG + Intronic
945115276 2:206402217-206402239 TGATCAATAATGTTACCTGATGG + Intergenic
945364478 2:208934656-208934678 TGTTAAATAATAGGACTTACAGG + Intergenic
945512074 2:210714895-210714917 TCTTATATAATATTACATACTGG + Intergenic
945700635 2:213165714-213165736 TGCTAAATAAGTTAACCTAAAGG - Intergenic
946259708 2:218477069-218477091 TGTTAAGTAATTTTCCGTAATGG - Intronic
947178257 2:227389164-227389186 TTTTAAATAAAATTATTTAAAGG - Intergenic
948318633 2:237051138-237051160 TATTAAATAATATTACAGAATGG - Intergenic
1169705430 20:8498396-8498418 GGTTAAATAAAATAACATAAAGG - Intronic
1173090491 20:39966196-39966218 TGGTCAATAAGATTAACTAAGGG - Intergenic
1173209264 20:41019387-41019409 TTTTAGAAAATATTACCTACAGG - Intergenic
1174668085 20:52279176-52279198 ATTCAAATAATATTTCCTAAAGG - Intergenic
1177045045 21:16158836-16158858 TTTAGAATAATATTACCTTATGG - Intergenic
1177588119 21:23125654-23125676 TGTTAAGTACTCTTACCAAAGGG - Intergenic
1178921442 21:36741462-36741484 TGTTAAATAAGAGTTCTTAATGG + Intronic
1179101393 21:38358096-38358118 TGTTAAAAAATATGAACCAATGG + Intergenic
1180760563 22:18199558-18199580 TGTTAGATAATATTTCCTTGGGG - Intergenic
1180770877 22:18383855-18383877 TGTTAGATAATATTTCCTTGGGG - Intergenic
1180775106 22:18425138-18425160 TGTTAGATAATATTTCCTTGGGG + Intergenic
1180808180 22:18736193-18736215 TGTTAGATAATATTTCCTTGGGG + Intergenic
1180828818 22:18886814-18886836 TGTTAGATAATATTTCCTTGGGG - Intergenic
1181071103 22:20341158-20341180 TGTTAGATAATATTTCCTTGGGG + Intergenic
1181194175 22:21170107-21170129 TGTTAGATAATATTTCCTTGGGG + Intergenic
1181215266 22:21322671-21322693 TGTTAGATAATATTTCCTTGGGG - Intergenic
1182188242 22:28430495-28430517 AGGTAACTAATATTACCCAAAGG + Intronic
1185144419 22:49123209-49123231 TATTAAATAATATTCACCAAAGG + Intergenic
1203232711 22_KI270731v1_random:125027-125049 TGTTAGATAATATTTCCTTGGGG - Intergenic
1203278909 22_KI270734v1_random:112802-112824 TGTTAGATAATATTTCCTTGGGG - Intergenic
949121573 3:391067-391089 TGTTAAATGAAATTCACTAAAGG - Exonic
949313974 3:2731093-2731115 TATTAAATAATATTTTCTAATGG + Intronic
949552832 3:5125455-5125477 TGTTAAATATAATAATCTAATGG - Intronic
950986057 3:17367974-17367996 TATAAAATAATATATCCTAAAGG - Intronic
951791676 3:26492453-26492475 AGTTAAATGATAAAACCTAATGG - Intergenic
955998450 3:64702629-64702651 TGTTTTATAACATTACATAAAGG - Intergenic
956812982 3:72882373-72882395 TGTTAACTCATATAATCTAAGGG - Intergenic
957504240 3:81099170-81099192 AGTTAAATAATTTTACACAATGG + Intergenic
957637379 3:82804247-82804269 TGCTAAATCATGTTTCCTAAAGG - Intergenic
957720366 3:83987930-83987952 TATTAAATATTATTTCCTCAGGG + Intergenic
957866223 3:86027341-86027363 TTATAAATAACATTACATAATGG - Intronic
957967113 3:87336507-87336529 TGTGAGTTAATATTACCAAAAGG - Intergenic
958685848 3:97392726-97392748 TTTTAACTAATATTACGGAAAGG - Intronic
959954686 3:112222271-112222293 TGTTAAATTATCTTTCCCAATGG + Intronic
960232779 3:115247830-115247852 TGGTAAATAATATTGCCTTAAGG - Intergenic
961610952 3:128138146-128138168 TGTTGAATAATAGTAGCAAAGGG - Intronic
962505442 3:136042041-136042063 TGTTAAATAATAATAACAATAGG - Intronic
963590986 3:147259077-147259099 TGTTAAATAACATTAACTTTTGG - Intergenic
963660054 3:148114061-148114083 TCTTCTATAATATAACCTAAGGG + Intergenic
964127279 3:153248452-153248474 TATTAAATAATATTATAAAATGG + Intergenic
964555133 3:157928931-157928953 TGTCTAATAATATGACATAATGG - Intergenic
970775200 4:19666416-19666438 TGTTAAATAATATTACAGGCAGG - Intergenic
971449849 4:26789610-26789632 TGTAAATTAATATAACCTCATGG + Intergenic
971536757 4:27761976-27761998 TGTTAAATACTATTAGCAAAGGG + Intergenic
971783259 4:31066764-31066786 TATTAAATATTATTTCATAAAGG + Intronic
971904233 4:32705267-32705289 TGTCCAATAATATTTCCTACTGG + Intergenic
971955971 4:33418976-33418998 GGTAAGAGAATATTACCTAATGG - Intergenic
971992544 4:33918276-33918298 TGTGAAAAAATATTACACAAGGG + Intergenic
974262943 4:59548016-59548038 TTTTAAATAATATTACCTGAAGG - Intergenic
974491946 4:62575615-62575637 TGTTAAATATTATTATATTATGG + Intergenic
977674904 4:99736250-99736272 TTTTAAATAATATTTCCAATAGG + Intergenic
977755115 4:100660737-100660759 TTTTATATTATATTACCAAATGG + Intronic
978020018 4:103797110-103797132 TGGTAAATAATTTTAACAAAAGG - Intergenic
978365005 4:107972055-107972077 TGTTAAATAATTTTCCCTGGGGG + Intergenic
978482653 4:109211854-109211876 TGTGAAATAATATTACACATTGG - Intronic
978509669 4:109502675-109502697 TGTTAAATTAAAATACCTAATGG + Intronic
978630521 4:110738724-110738746 TGTTAATTAATATTGACCAACGG - Intergenic
978679901 4:111367671-111367693 TGTTAAATATTTTTGCCTAGAGG + Intergenic
979539226 4:121861386-121861408 TGGAAAATAAAATTAACTAAAGG - Intronic
979581275 4:122364433-122364455 TGTAAAAAAAAATTACATAAAGG + Intergenic
979663546 4:123285777-123285799 TGTTGAACAAATTTACCTAAAGG + Intronic
980291798 4:130854272-130854294 TGTTGAATAGTATTGCCTCAAGG + Intergenic
981515847 4:145608816-145608838 TGTTAAATAATTTTTAATAATGG - Intergenic
982468842 4:155761875-155761897 TCTTAAATAAAATTGCCTCAAGG + Intronic
982522498 4:156436492-156436514 TTTTAAACATTTTTACCTAAAGG - Intergenic
983350247 4:166577702-166577724 TGTAAACTCATATTACCCAATGG - Intergenic
983439298 4:167761124-167761146 TGTTATATAACATTACCACAAGG - Intergenic
983518788 4:168685208-168685230 TTTTAAATGCTATTACCAAATGG - Intronic
983592710 4:169432548-169432570 TTTTAAATAATAATACATGAAGG - Intronic
984400162 4:179253597-179253619 TATAAAATAATATTATCTATAGG + Intergenic
986090797 5:4502678-4502700 TGTTAAATAATTTTTCACAAGGG - Intergenic
986574189 5:9195869-9195891 TGATTAATAATAGTAACTAATGG + Intronic
986926016 5:12753004-12753026 TGGTATATAAAAGTACCTAAAGG + Intergenic
988094229 5:26582401-26582423 TATAAAATATTATTACCTTAAGG - Intergenic
989332880 5:40280689-40280711 TGATACAGAATATTATCTAAAGG - Intergenic
989532897 5:42528153-42528175 TCTTAAATAATAAGACTTAAAGG - Intronic
989738150 5:44733244-44733266 TTTTAAAGAACATTATCTAAAGG + Intergenic
990558855 5:56963890-56963912 TCTTACATCTTATTACCTAAGGG - Intronic
990772550 5:59265448-59265470 TGTTAAAAAAGACTACCTTATGG + Intronic
990860865 5:60325377-60325399 GGTAAAATAATATGATCTAATGG + Intronic
991212960 5:64128665-64128687 TGTAAAATAATATAACCAATTGG - Intergenic
991214375 5:64145367-64145389 TGTTAAATAATTTTCCATATAGG - Intergenic
991217202 5:64169234-64169256 TGTTAAATAATATTTACAACAGG - Intronic
992071075 5:73150047-73150069 TATTAAATAATATTATAGAATGG + Intergenic
992145562 5:73843708-73843730 ATTTAAATAATATAACATAATGG - Intronic
992547984 5:77833971-77833993 TGTTATATAATATAAGCCAAAGG - Intronic
993506854 5:88719565-88719587 TGTAAAATAATACTCCCTCAGGG + Exonic
995695108 5:114870095-114870117 TGTTTAATAATATTCTCTGATGG - Intergenic
995816488 5:116174948-116174970 TTTTAAATAATTGTACCTTATGG + Intronic
995982773 5:118125900-118125922 TGTTAAACTATTTTACTTAAAGG + Intergenic
996170591 5:120285536-120285558 TGTCAAATAATATAACATACTGG + Intergenic
996470660 5:123856352-123856374 TGTTATCTAGTATTACTTAAAGG - Intergenic
997164573 5:131646053-131646075 TCTTAAATATTTTTACATAAAGG + Intronic
997855804 5:137371524-137371546 TGGTAAATCCTGTTACCTAAAGG - Intronic
998563922 5:143199127-143199149 TGTTAAATTATATTAGATGAGGG + Intronic
998594398 5:143513710-143513732 TTTTAAATTATATGAGCTAACGG - Intergenic
998853467 5:146372759-146372781 GCTTAAATGATATTACCCAAGGG - Intergenic
1000952760 5:167504354-167504376 TATTATATAATATTACTTGAGGG + Intronic
1004052181 6:12095748-12095770 TGTTAAATAACTTAACCCAAGGG + Intronic
1004632008 6:17430835-17430857 TGTTAAAAAATAACCCCTAATGG - Intronic
1004639577 6:17502175-17502197 TGTCAATTAAAATTACATAAGGG - Intronic
1005306619 6:24520317-24520339 TGTTTAAAAAAATTACCAAATGG - Intronic
1007872392 6:45055172-45055194 TGCTAAAATATATTATCTAAAGG + Intronic
1007936854 6:45740202-45740224 TGTTAAATCATATAATCTCAGGG - Intergenic
1008434252 6:51456603-51456625 TGTTAAATCATAATACCAATGGG + Intergenic
1009698208 6:67137974-67137996 TATTTAAAAATATAACCTAATGG + Intergenic
1011243860 6:85301063-85301085 TTTTAAATAATTTTATATAAAGG - Intergenic
1011525753 6:88262981-88263003 TATTAAATAATGTTAAATAATGG - Intergenic
1011896594 6:92235247-92235269 TGCTAAATAATATTGCCTTGGGG - Intergenic
1012047032 6:94289565-94289587 TATGGAATAATTTTACCTAAAGG + Intergenic
1012138253 6:95586114-95586136 TCTTAAATAAAATTTCCTAAAGG + Intronic
1012657993 6:101849876-101849898 ATTTAGAAAATATTACCTAATGG - Intronic
1013253855 6:108363020-108363042 TATTAATTAACACTACCTAAAGG - Intronic
1014921482 6:127218925-127218947 TATGAAATAGTATTACCTCAAGG + Intergenic
1015016335 6:128418150-128418172 TGTTAAAAATTAACACCTAATGG - Intronic
1015048398 6:128808192-128808214 TGTTACATAAAATTATCTATTGG + Intergenic
1015642326 6:135348817-135348839 GGTTAAATAGTAATAGCTAATGG + Intronic
1017250118 6:152271336-152271358 TTTTATATACTATTACCTACAGG - Intronic
1019980357 7:4617093-4617115 TGTTCAATATCATTACCTACTGG + Intergenic
1020683850 7:11269570-11269592 TTTTAAAAAACATTACCTTACGG + Intergenic
1020908848 7:14102678-14102700 TGTTATATAAAATTACCTTCAGG - Intergenic
1020981936 7:15080320-15080342 TGCTAAATTATATTACATTAAGG - Intergenic
1021329713 7:19320911-19320933 TATTGAATAAAATTACCTACAGG + Intergenic
1022783525 7:33611746-33611768 TATTATATAATATTATATAAAGG - Intergenic
1023026164 7:36052015-36052037 TCTTAAATAATACTACTTGAAGG - Intergenic
1023569551 7:41557815-41557837 TGTTCAATAATATATCCTAGTGG + Intergenic
1024828530 7:53420918-53420940 TGAAAAATAATATTCCCTGAGGG + Intergenic
1025194890 7:56925091-56925113 TGTAAAATATTATTAGCAAAGGG - Intergenic
1025677062 7:63651852-63651874 TGTAAAATATTATTAGCAAAGGG + Intergenic
1027400578 7:77801653-77801675 TGTTATATAAAATTACCTTTGGG + Intronic
1028235204 7:88353015-88353037 TTTTAAATAATACTATCTAATGG + Intergenic
1028318206 7:89430726-89430748 TGTTAAAGCATATTCCCTAAAGG + Intergenic
1028373764 7:90122903-90122925 TGTAAAATAATATTTCCTTCTGG + Intergenic
1029787986 7:102812188-102812210 TGTTACATAATATCAAATAATGG + Intergenic
1030145287 7:106347142-106347164 TTTTAGATAATATTACAAAATGG + Intergenic
1030585159 7:111409518-111409540 AGTAAAATTAAATTACCTAAAGG + Intronic
1030657290 7:112182350-112182372 TTTTAAAAAATATTACATCATGG - Intronic
1030842810 7:114377058-114377080 TATTTAATAATATTACCAATAGG - Intronic
1031308136 7:120159924-120159946 TATAGAATAATCTTACCTAATGG - Intergenic
1031551795 7:123123448-123123470 TATTCTATAATATTACCCAAAGG - Intronic
1032355717 7:131208598-131208620 TGAAAAATAATAATAACTAAAGG + Intronic
1032391921 7:131560820-131560842 TATTGAATAATAATACATAAAGG - Intergenic
1032807220 7:135367965-135367987 TGTTAAAAAATTTTACTTTATGG + Intronic
1033916476 7:146332729-146332751 TGTTAAATAATATTTACTGTTGG - Intronic
1033936398 7:146591136-146591158 TGTTACATAAAATTACCTTCAGG + Intronic
1035463199 7:159058981-159059003 TGTTAAACACTATTACCTACAGG + Intronic
1035848713 8:2892639-2892661 TTTTAAATCATATTACGTAGAGG - Intergenic
1036060682 8:5316243-5316265 TGTAAAATAATCTGACCTAATGG - Intergenic
1037218082 8:16482696-16482718 TGTGAAATAATATTAGTGAATGG - Intronic
1039104731 8:33978050-33978072 TGATACATTAGATTACCTAAGGG - Intergenic
1039524410 8:38201077-38201099 TAATAAATACTTTTACCTAAGGG - Intronic
1040406009 8:47102911-47102933 TATTATATAATATTGCCTGAAGG + Intergenic
1040845141 8:51829951-51829973 TGGTAAAGAATTTTACCTCATGG + Intronic
1041085710 8:54254581-54254603 TGTTAAATTATTTTACAAAATGG - Intergenic
1041893001 8:62892256-62892278 TATGAAATAATATTGTCTAAAGG - Intronic
1042410154 8:68456543-68456565 TCTAAATTAATATTACATAAGGG - Intronic
1042646311 8:70990567-70990589 TGCTATTTAATATTTCCTAAAGG + Intergenic
1042794964 8:72651943-72651965 TGGTAAATGATACTACCTAGTGG + Intronic
1042966690 8:74361207-74361229 TTTTAAAAAATATTAACTATAGG - Intronic
1043147984 8:76680424-76680446 TATTCAAGAATATTACATAAAGG + Intergenic
1043234607 8:77847190-77847212 TGTTACATTATATTAAATAATGG + Intergenic
1043799115 8:84584707-84584729 TATAAAATAATATTAGTTAATGG - Intronic
1044475718 8:92623619-92623641 TATTTAATAAGATTATCTAAAGG + Intergenic
1044889376 8:96816645-96816667 TGTTAAATAATAAGACTTGAAGG + Intronic
1045731755 8:105249927-105249949 TGTTATATATTATGACCTAGTGG - Intronic
1046085060 8:109422941-109422963 TTTTAATTGATATTTCCTAATGG + Intronic
1046257011 8:111713334-111713356 ACTTAAGTAATATTTCCTAAGGG + Intergenic
1047108516 8:121762018-121762040 TAATAAATGAGATTACCTAAAGG + Intergenic
1047359842 8:124159307-124159329 GGAAAAATTATATTACCTAATGG + Intergenic
1048032260 8:130643776-130643798 TGTTAAATAATAAGATCCAATGG + Intergenic
1048700192 8:137079608-137079630 TGTTAGATAATTTTACCCAATGG - Intergenic
1049941738 9:552421-552443 TGTTAAACAATATTTGATAATGG + Intronic
1050865707 9:10495799-10495821 TGTAAAAAATTATTACTTAATGG + Intronic
1051001081 9:12282687-12282709 TGTTAAATTAAGTTACATAATGG + Intergenic
1051959404 9:22739729-22739751 TGTAAAATAATAATATATAAGGG + Intergenic
1052140226 9:24972896-24972918 TATTAAATAATGTTACGAAATGG + Intergenic
1053386493 9:37694913-37694935 TGTCAAATAATATTCCATTATGG + Intronic
1055024398 9:71703873-71703895 TATTAAATAATTCTGCCTAAGGG - Intronic
1055246712 9:74254531-74254553 TCTTAATTAATATTAGATAAAGG + Intergenic
1055564091 9:77550416-77550438 TGGTACATATTATTAGCTAAAGG + Intronic
1056923338 9:90811334-90811356 TTTTAAAAGATATTACCAAACGG - Intronic
1057776466 9:98014422-98014444 TGTTAAATCATATTTCATACAGG - Intronic
1058413491 9:104761358-104761380 TATTAAATAACAATATCTAATGG - Intergenic
1058978608 9:110148325-110148347 TGTCAAATATTATTGCTTAAAGG - Intronic
1059873966 9:118612127-118612149 TATTAAATAATCTTATCCAAGGG + Intergenic
1060011759 9:120049851-120049873 TGTTAGATATTATAACCGAATGG - Intergenic
1185471732 X:387658-387680 AGTTAAATAACTTTACCCAATGG + Intergenic
1186444724 X:9617498-9617520 TGTTAATTAATATAACCAAATGG + Intronic
1187484518 X:19689698-19689720 TGTTAAATATTAGTACTTGAAGG + Intronic
1187717397 X:22116560-22116582 TGATACATAATAATACCAAATGG + Intronic
1187796985 X:23014646-23014668 TGTTAAATGATGGTAACTAAAGG + Intergenic
1189016270 X:37286275-37286297 TATTATATAATATTATATAATGG - Intergenic
1189721120 X:43919657-43919679 TGTTAAAAAATATTACTTTGGGG - Intergenic
1189883973 X:45521067-45521089 TATTAAATTATATTTCTTAAGGG - Intergenic
1190140532 X:47839508-47839530 TGTTATATAAAATTACCTTCAGG + Intronic
1190894408 X:54602608-54602630 TTTTATGTAATATAACCTAATGG - Intergenic
1192816244 X:74595696-74595718 TGTTAAATAATATTTCATAAGGG + Intronic
1193288987 X:79749759-79749781 TGTTAAATGCTCTTGCCTAATGG + Intergenic
1193374089 X:80737362-80737384 TGTTATACTATATTACTTAAGGG + Intronic
1193411574 X:81169522-81169544 TGTTAAATAATTTGTCCTTAGGG + Intronic
1193835626 X:86340002-86340024 TTTTAAAAAATATTTCATAAAGG - Intronic
1193848308 X:86502634-86502656 TATTAAATAACATTCCCTGAAGG - Intronic
1194573033 X:95575787-95575809 TGTAAAATGATTTTTCCTAAAGG + Intergenic
1195114944 X:101687916-101687938 TCTTAATTTATATTACCCAAAGG + Intergenic
1196146428 X:112322699-112322721 TGTCAAAGAATATATCCTAAGGG - Intergenic
1196569042 X:117244250-117244272 GGTTAAAAAATATTACCTGTTGG - Intergenic
1198198347 X:134387993-134388015 TTTTAAAAAATAGTAACTAAAGG + Intronic
1200563568 Y:4736249-4736271 TGTCAAATAGTAATTCCTAATGG - Intergenic
1201270455 Y:12248994-12249016 TGTGATATAATATTTCATAAGGG - Intergenic
1201680406 Y:16639072-16639094 TGTGATATAATATTTCATAAGGG + Intergenic