ID: 1113303218

View in Genome Browser
Species Human (GRCh38)
Location 13:109045766-109045788
Sequence AGGGCTGTGCAGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113303218 Original CRISPR AGGGCTGTGCAGACTGTGGA AGG (reversed) Intronic
900131751 1:1090196-1090218 AGGGCTGTGGAGCTTGGGGAAGG - Intronic
902220317 1:14960482-14960504 TGAGCTCTGCAGACTGTGGGTGG + Intronic
902686489 1:18080812-18080834 AGGGCTGTGGTGATTGGGGATGG + Intergenic
903338756 1:22641701-22641723 AGGGCTGAGCTGACTCTGGAAGG - Intergenic
904060472 1:27706065-27706087 AGGTCTGAGCAGGTTGTGGAAGG - Intergenic
904120261 1:28193629-28193651 AGGGCTGCTCAGATTCTGGAAGG - Intronic
905038131 1:34930242-34930264 TCGGCTGTGCGGACTGTGGGTGG - Intergenic
905217953 1:36423255-36423277 AGGGCTGGGCAGACTGTGAGTGG + Intronic
905456056 1:38088667-38088689 AGGGCTGGGGAGAGTGTGGAAGG - Intergenic
905828483 1:41045598-41045620 AGTGCTGTGCTGTCTGTTGATGG - Intronic
906203386 1:43974283-43974305 AGGGCAGTGCAGCCAGAGGAGGG + Intergenic
906513737 1:46425908-46425930 AGAGCTGTGCAGACTATGCAGGG + Intergenic
906557497 1:46725120-46725142 AGGGCTCTTCTGACTGAGGAGGG + Intergenic
909598587 1:77435944-77435966 AGGTCTGTGCAGATCGTGAAAGG - Intronic
909767677 1:79377709-79377731 AGGACTGGGCAGACTGTGCATGG - Intergenic
911213716 1:95168999-95169021 AGAGCTGTGCAGTCTGGGGTGGG + Intronic
911842222 1:102697629-102697651 AGGTCTCAGCAAACTGTGGAAGG + Intergenic
913217652 1:116633936-116633958 AGGGCTGTTCATGCTATGGAAGG + Intronic
915082467 1:153361386-153361408 AGGGCTGTGTAGACAGTGATGGG - Intergenic
915384514 1:155477885-155477907 AGGGCAGTACAGACTTTGGCAGG - Exonic
916462578 1:165042124-165042146 AGGGCTGAACAGTCTCTGGAAGG - Intergenic
916657067 1:166885694-166885716 AGGACAGTGCAGCCTGTAGAGGG - Intergenic
917037957 1:170769850-170769872 AGGACTGTGTAGACTATGGGTGG - Intergenic
917155935 1:171999032-171999054 TGGGCTGAGCAGCCAGTGGAGGG + Intronic
918525155 1:185456753-185456775 AGGGCAGGGCAGATTGTGGAGGG - Intergenic
919437742 1:197583964-197583986 AGGGCTGTTCAGGCTGATGAGGG - Intronic
923249543 1:232167252-232167274 TGGGCTTTGCTGACTCTGGAGGG - Intergenic
924671883 1:246136597-246136619 TGGGCTCTGCAGACTGGGCAGGG + Intronic
1062895507 10:1100328-1100350 GAGGCAGTGCAGCCTGTGGACGG + Intronic
1062967243 10:1617116-1617138 AGGGCAGTGCAGAGTGTGTCTGG - Intronic
1062967310 10:1617576-1617598 AGGGCAGTGCAGAGTGTGTCTGG - Intronic
1065130347 10:22613630-22613652 AGGGGACTGCAGAATGTGGATGG + Intronic
1065813515 10:29463948-29463970 AGGGCTGTGCTAAGAGTGGAAGG + Intronic
1065958134 10:30711030-30711052 AGGGCTGTGCTAAGAGTGGAAGG - Intergenic
1066250897 10:33631812-33631834 AGGGCACTGCAGTCTGGGGAAGG + Intergenic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1068950560 10:62772707-62772729 AGAGCAGTGCAGGCTTTGGATGG + Intergenic
1069716437 10:70524070-70524092 AGGGCTGGGGGGAGTGTGGATGG + Intronic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1069749868 10:70738380-70738402 AGGTCTGTGCATGCAGTGGAAGG - Intronic
1069778970 10:70943067-70943089 AGGGCTCTGCAGTTTGTGGAAGG + Intergenic
1070282757 10:75061890-75061912 AGGGCTGTGAGGCCTGTGCAAGG + Intergenic
1072019758 10:91386793-91386815 AGAGCTGTGCAGACAACGGATGG - Intergenic
1072534806 10:96353931-96353953 AGGTCTGGGCAGACAGTGGTGGG + Intronic
1073096690 10:100984297-100984319 GGGTCTGTGGAGACTGAGGAGGG - Exonic
1073132969 10:101202369-101202391 AGGGCTGTGCTGAATGTGTGAGG - Intergenic
1074432668 10:113407076-113407098 AGACCTGTGCAGTCTGTGGGTGG + Intergenic
1075708258 10:124515928-124515950 AGAGCTGTGGAGATCGTGGAGGG - Intronic
1076210790 10:128643082-128643104 AGGGCCGTGCTGGCTCTGGAGGG - Intergenic
1076706479 10:132304813-132304835 AGGCCCTTGCAGGCTGTGGACGG - Intronic
1077044423 11:538074-538096 AGGGCCGTGAAGTGTGTGGATGG + Intronic
1077096405 11:800934-800956 AGGGCTGTACAGACTGGGGGAGG + Intronic
1077143555 11:1035241-1035263 TGGGCAGTGCAGAGGGTGGAGGG - Intronic
1077273018 11:1690621-1690643 AGGGCTGTGCGGAGTGTGACAGG + Intergenic
1077273021 11:1690641-1690663 AGGGCTGTGCGGAGTGTGACAGG + Intergenic
1077418969 11:2440612-2440634 ATGGGGGTGCAGATTGTGGAGGG - Intergenic
1077704949 11:4475806-4475828 AGGGCTGTGCTGAGAGTAGATGG + Intergenic
1078107056 11:8365177-8365199 AGGGCAGTGAGGCCTGTGGAGGG - Intergenic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1078714683 11:13828568-13828590 GGGGCTTTGCTGACTCTGGAGGG + Intergenic
1080749042 11:35135897-35135919 AGTGCTTTGCAAACTGTAGAAGG - Intergenic
1081571462 11:44294012-44294034 AGAGCTCTGTAGACGGTGGAGGG - Intronic
1081629996 11:44682563-44682585 AGGGATGTGCAGAGTGAGGGAGG - Intergenic
1081870615 11:46381222-46381244 AGGGCTGAGCCGGCCGTGGAGGG + Intronic
1082096855 11:48137975-48137997 AAGGCTTTGCAGACAGTGGTGGG + Intronic
1085010722 11:73140494-73140516 AGAGGTGAGCAGAGTGTGGATGG + Intronic
1085273743 11:75285270-75285292 AGCACTCTGCAGATTGTGGAAGG + Intronic
1085345228 11:75764248-75764270 AGGGCTGTGGAGGCGATGGATGG + Intronic
1087662963 11:101009189-101009211 GGGGCTATGCAGACTCTTGAAGG - Intergenic
1089376939 11:118000996-118001018 AGGGCTGAGATGACTCTGGATGG - Exonic
1089646855 11:119886269-119886291 AGGGCTGGGGAGCCTGGGGAGGG - Intergenic
1089688151 11:120169845-120169867 AGGATCGTGCAGCCTGTGGAAGG + Exonic
1090391785 11:126393563-126393585 AGGGCTGAGATGCCTGTGGAGGG - Intronic
1090845644 11:130527839-130527861 AGGCGTGTGCAGTCTGTGGAAGG - Intergenic
1090868893 11:130725690-130725712 AGGGCCTTGCAGGTTGTGGAAGG + Intergenic
1090967875 11:131614313-131614335 AGGGCCGTGCAGAGTTCGGAAGG + Intronic
1091237681 11:134032915-134032937 AGGGGTGTGCACGCTGTGGGAGG + Intergenic
1091584390 12:1807763-1807785 AGAGCTGTCCAGAGTGAGGAAGG + Intronic
1092228940 12:6766436-6766458 AGGGCGGTGCAGGCGGTGGCCGG - Exonic
1092283759 12:7116711-7116733 AGGGCTGTGAGCACTGAGGATGG + Intergenic
1094554945 12:31489789-31489811 AGTGCTGGGAAGACGGTGGAAGG + Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096466560 12:51849928-51849950 AGGGCTGTGCTGATGATGGAGGG + Intergenic
1096912883 12:55001681-55001703 ATGGCTGTGCCTACTCTGGAAGG - Intergenic
1097237678 12:57550840-57550862 GGGTCTCTGCAGAGTGTGGATGG + Intronic
1101830751 12:108254416-108254438 AGGCCTGTCCAGAGGGTGGAGGG + Intergenic
1101953436 12:109193912-109193934 AGGGCTGTGCATTCTGCAGAGGG + Intronic
1102497458 12:113329536-113329558 AGGGCTGTGCAGCTCGGGGAGGG - Intronic
1103446078 12:120996195-120996217 AGGGCTGTGGAGGCAGGGGAGGG + Intronic
1103468670 12:121162594-121162616 AGGGCTGTGCTGAGAGGGGAAGG - Intronic
1103531955 12:121608620-121608642 AGGGCTGTACACAGTGTGGCAGG + Intergenic
1103603287 12:122067957-122067979 AAGGCTGTACAAACTGTTGAGGG + Intergenic
1104146111 12:126035336-126035358 AGGCCTGTGCTCACTGTGGGTGG - Intergenic
1104262071 12:127193771-127193793 AGTGCTTTGCAGACTCTGAAGGG + Intergenic
1104339292 12:127932311-127932333 GGGGGAGTGCAGACTGTGGGTGG + Intergenic
1104416940 12:128603317-128603339 AGGGGTGTGCATACTGGGGTGGG + Intronic
1104921996 12:132295353-132295375 AAGTCTGTGCAGACTGTTGTGGG + Intronic
1104942727 12:132402473-132402495 AGGGCTCTGCCAACTGTGGGAGG + Intergenic
1104947795 12:132424604-132424626 GGGGCTGTGAAGACAGTGGCGGG + Intergenic
1105241433 13:18612169-18612191 AGAGCTGTGCAGGCTGTAGGAGG + Intergenic
1105242377 13:18619944-18619966 AGAGCTGTGCTGCCTGGGGAAGG + Intergenic
1105251067 13:18698518-18698540 AGGGCTGGGCAGGCTGGGTATGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107249493 13:38341345-38341367 AGGGCAGGGCAGACTGTTCAGGG + Intergenic
1108263207 13:48678809-48678831 AGAACTGACCAGACTGTGGATGG - Intronic
1110553230 13:76830078-76830100 AGAGCTTTCCAGGCTGTGGAGGG - Intergenic
1110820379 13:79908564-79908586 AGCGCTGCGCAGACTGGGTAGGG + Intergenic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1113549045 13:111177484-111177506 AGGTCTGTGCTCACTGAGGAGGG + Intronic
1113559791 13:111269585-111269607 AGGGCTGCCCAGAGAGTGGAGGG + Intronic
1113573955 13:111381760-111381782 AGGGCTGTGGTGACTGGGGGTGG + Intergenic
1113574016 13:111381980-111382002 AGGGCTGTGGTGACTGGGGGTGG + Intergenic
1113707570 13:112444442-112444464 TGGGCAGAGCAGACTGTGAAAGG + Intergenic
1113858042 13:113460194-113460216 AGGGCGGAGCTGTCTGTGGAAGG - Intronic
1115770055 14:36658523-36658545 AGGTCAGTGATGACTGTGGATGG - Intronic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1119186975 14:72650114-72650136 AGGGCAGTGTGGAGTGTGGATGG - Intronic
1119196658 14:72722325-72722347 GGGGCTGTGCAGCCTGTGCAGGG - Intronic
1119556381 14:75556434-75556456 AGGGCTGAGCAGAATGAGCAAGG - Intergenic
1119620906 14:76131277-76131299 TGGGGAATGCAGACTGTGGAAGG + Intergenic
1120436690 14:84491675-84491697 AGGGCAGAGCAGTGTGTGGAGGG - Intergenic
1121864159 14:97346854-97346876 AGGGCTGTGCTCCCTCTGGAGGG - Intergenic
1122180866 14:99953613-99953635 AGGGCTGTTGAGAGTGTTGAAGG - Intergenic
1122198878 14:100109826-100109848 CGAGGTGTGCATACTGTGGAAGG + Intronic
1122253031 14:100453685-100453707 GGGACTGGGCAGGCTGTGGAGGG + Intronic
1122687626 14:103517589-103517611 AAGGCTGTCTAGACTGTGGTTGG + Intergenic
1122795040 14:104201771-104201793 GAGGCGGTGGAGACTGTGGATGG + Intergenic
1122824600 14:104363464-104363486 AGAGCTGTGCCTAGTGTGGAGGG - Intergenic
1123488923 15:20764648-20764670 AGGGCTGTGCTGCCTGGGGAAGG - Intergenic
1123489926 15:20772981-20773003 AGAGCTGTGCAGGCTGTAGGAGG - Intergenic
1123545422 15:21333735-21333757 AGGGCTGTGCTGCCTGGGGAAGG - Intergenic
1123546425 15:21342068-21342090 AGAGCTGTGCAGGCTGTAGGAGG - Intergenic
1124639860 15:31391065-31391087 AGGGCTGTGGGGACTATGGCGGG + Intronic
1125891611 15:43270836-43270858 AGGGCTGTGCCCACAGGGGAGGG + Intergenic
1126534799 15:49749713-49749735 AGGGCTCTGGATACTGTGAAAGG + Intergenic
1126675281 15:51155452-51155474 AAGGGTGTGCGGACTGGGGAAGG + Intergenic
1127363866 15:58268919-58268941 AGGGCTCTGCATACTTTGGTGGG - Intronic
1127599203 15:60518451-60518473 CGGGCTTTGCAGACACTGGAGGG + Intronic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1128506065 15:68273721-68273743 AGGGCTGTCCAGACTATGTGTGG + Intergenic
1128518524 15:68359973-68359995 AGTGCTGAGCAGACAGAGGAAGG + Intronic
1128943176 15:71805066-71805088 AGGGCTGGGAAAACTGTGCAGGG + Intronic
1129523135 15:76198295-76198317 TGTGCTGTGCAGTCCGTGGAGGG - Intronic
1130253546 15:82315566-82315588 AGGGCTGTACAGAGTGAGGCAGG + Intergenic
1131024037 15:89124661-89124683 AGAGTTGTGCAGACTGGGCATGG + Intronic
1131489510 15:92850331-92850353 ATGCCTGTGCAGGCTGTGGAAGG - Intergenic
1131981785 15:98001386-98001408 TGTGCTGTGCATACTGTGGGTGG + Intergenic
1202953767 15_KI270727v1_random:61006-61028 AGGGCTGTGCTGCCTGGGGAAGG - Intergenic
1202954752 15_KI270727v1_random:69283-69305 AGAGCTGTGCAGGCTGTAGGAGG - Intergenic
1132580583 16:682979-683001 GGGGCCGTGCAGACGGTGGCAGG + Exonic
1133742039 16:8659004-8659026 TGGGCTGTGGACACTGGGGAAGG - Intergenic
1137709679 16:50557820-50557842 AGGGCTGTGGAGGTTGGGGAGGG + Intronic
1137710447 16:50563282-50563304 AGGACTGTGCCCACTGAGGATGG - Intronic
1137710459 16:50563342-50563364 AGGGCTGTGCCCATTGAGGATGG - Intronic
1137710469 16:50563402-50563424 AGGGCTGTGCCCACTGAGGATGG - Intronic
1137710482 16:50563462-50563484 AGGGCTGCGCCCACTGAGGATGG - Intronic
1137710494 16:50563522-50563544 AGGGCTGTGCCCATTGAGGATGG - Intronic
1137710507 16:50563582-50563604 AGGGCTGTGCCCACTGAGGATGG - Intronic
1137710529 16:50563701-50563723 AGGGCTGTGCCCACTGAGGATGG - Intronic
1137710540 16:50563761-50563783 AGGGCTGTGCCCACTGAGGATGG - Intronic
1137710551 16:50563821-50563843 AGGGCTGTGCCCACTGAGGATGG - Intronic
1137710562 16:50563881-50563903 AGGGCTGTGCCCACTGAGGATGG - Intronic
1137710573 16:50563941-50563963 AGGGCTGTGCCCACTGAGGATGG - Intronic
1138336781 16:56259655-56259677 AGGGCTGAGCAGACAGTGCTGGG + Intronic
1138459285 16:57138491-57138513 AGGGCTGTGCAGTCAGTGATCGG - Intronic
1140892725 16:79298792-79298814 AGGGCCTTGCAGGCTTTGGAGGG + Intergenic
1141324004 16:83038507-83038529 AGGGCTCTCCTGTCTGTGGAAGG + Intronic
1141763433 16:86043840-86043862 AGGGCTGTGAAGATGGGGGAAGG + Intergenic
1142968386 17:3595088-3595110 AGGGCTGTCCGCACTGTGAACGG - Intronic
1143852590 17:9823861-9823883 GGTGCTGTGCAGAATGGGGAGGG + Intronic
1146811868 17:35910286-35910308 AGGGCTCTGAAGACTGAGCAGGG + Intergenic
1147595268 17:41712627-41712649 AGGGCTGGGAAGAGTGTGAAGGG - Intronic
1147844791 17:43397457-43397479 AGGGCTGCCCAGACTGTAGCAGG + Intergenic
1149806239 17:59620197-59620219 AGGGCTGTGGAGAAGGTGGTAGG + Intronic
1150759255 17:67945512-67945534 AAGGCTGAGCAGTCTGTGGCTGG - Exonic
1151046760 17:70929655-70929677 AGCTCTGGGCAGACTGTGGAAGG + Intergenic
1151549736 17:74815226-74815248 AGCGCTTGGCAGAGTGTGGAGGG + Intronic
1152068617 17:78124543-78124565 AGGCCTGTGCAGACGGGGGCAGG + Exonic
1152525695 17:80887211-80887233 GGGGCTGTGCTGACTCTGGGGGG + Intronic
1152655101 17:81515610-81515632 GGGGCAGTGCAGGCCGTGGAGGG - Intronic
1153232627 18:2954457-2954479 AGGCCTGAGCACACTGTGTAAGG + Intronic
1153262256 18:3236000-3236022 ATGGCTGAGCAGACTGGGGAGGG + Intergenic
1154305718 18:13229292-13229314 AAGGCTGTGCAACCTGGGGAAGG + Intronic
1154446572 18:14439934-14439956 AGAGCTGTGCTGCCTGGGGAAGG - Intergenic
1154447526 18:14447737-14447759 AGAGCTGTGCAGGCTGTAGGAGG - Intergenic
1155709092 18:28853524-28853546 AGGGCCTTGGAGAGTGTGGAGGG + Intergenic
1157606376 18:48928560-48928582 AAGCCTGGGCAGACAGTGGACGG - Intronic
1157662727 18:49460207-49460229 GGGGCTGTGCTGACAGCGGACGG - Intronic
1157792004 18:50541192-50541214 GGGGCTGTGCTGGCTGTGGAAGG - Intergenic
1159174431 18:64814868-64814890 AGGGAAGTGCAGACTGAAGATGG - Intergenic
1159818746 18:73112649-73112671 AGGGCTGGGAAGAGTGTGGGTGG + Intergenic
1160313682 18:77821016-77821038 CGGGCTGTGCAGAGTGTGGGGGG + Intergenic
1160486805 18:79300486-79300508 AGGGAGGTGCAGGCTGTTGAGGG + Intronic
1161074500 19:2278803-2278825 CGGGCTGTGCAGATCGCGGAGGG + Exonic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1163028533 19:14528634-14528656 AGGGCGGAGCAAAGTGTGGAGGG + Intronic
1164109729 19:22144783-22144805 AGGGGAATGCAGACTGTCGATGG - Intergenic
1164183149 19:22837409-22837431 AGGTCTGTGCTGACTCTGGGTGG + Intergenic
1164241093 19:23389806-23389828 AGGTCTGTGCTGACTCTGGGTGG - Intronic
1164621748 19:29700108-29700130 AGGGGTGGGCAGGCTGTGGGAGG + Intronic
1165105017 19:33464143-33464165 TGGGCTGTGCAGGGTGTGGTAGG - Intronic
1165423188 19:35732379-35732401 AGGGCTGTGACGACTGAGGTAGG - Exonic
1165774932 19:38398945-38398967 AGAGCTGGGCAGAGTGGGGAGGG - Intergenic
1165796878 19:38524831-38524853 GGGGTTGTGCATGCTGTGGAGGG + Intronic
1167363478 19:49042652-49042674 AGGGCTGTGTGGACTGGTGATGG + Intergenic
1167761878 19:51454839-51454861 AGGGCCCTGCAGACAGTGGGAGG - Intronic
1168267880 19:55232118-55232140 TTGGCTGTGCAGCCCGTGGAGGG - Exonic
1168415204 19:56163343-56163365 AGGACTGCGCAGTCTGAGGAAGG - Intergenic
1168415206 19:56163363-56163385 AGGACTGTGCACTCTGAGGAAGG - Intergenic
1168467076 19:56611556-56611578 ATCTCTGTGCAGAGTGTGGAAGG + Intronic
925023252 2:588145-588167 AGGGCTGTGCTGCCTGGGGCAGG + Intergenic
925177461 2:1795458-1795480 GGGGCTGAGCAGGCTGGGGAGGG + Intronic
925378385 2:3405352-3405374 TGGGCTGTGCGGACTGTGTAAGG - Intronic
925436415 2:3842136-3842158 AGTGCTGTCCGGAATGTGGAGGG + Intronic
925788089 2:7452627-7452649 TGGGCGGTGCTGACGGTGGAGGG - Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
927640439 2:24842204-24842226 ATGGCAGAGCAGGCTGTGGAGGG - Intronic
928138889 2:28710321-28710343 AGGTCTGAGAAGACTGAGGAGGG + Intergenic
928704071 2:33928630-33928652 AGGGCTTGGCAAACTGTGAAAGG - Intergenic
929798797 2:45082256-45082278 AGAACTGTGCAGAGTGTGGAAGG + Intergenic
931343548 2:61425831-61425853 TGAGCTGTGCAGCCTGTCGAGGG - Intronic
931370882 2:61661428-61661450 AGGTCTTTGCACACTTTGGATGG + Intergenic
932089029 2:68788446-68788468 AGGGATGATCAGACTGGGGAAGG + Intronic
935179317 2:100675900-100675922 AGGGCTCTGCTCACTCTGGAGGG + Intergenic
937320278 2:120956763-120956785 AGGGCCGTGCAGCCTGTAGCAGG + Intronic
937452147 2:122010585-122010607 AGGGCTGTGCTCACTGTGGCAGG - Intergenic
937984963 2:127634302-127634324 GGGGCTGGGCAGACGGTGGGCGG + Intronic
938088220 2:128415770-128415792 AGGGCAGGGAAGTCTGTGGAGGG - Intergenic
939375170 2:141355980-141356002 CAGGCTGTGTAGACTGAGGAAGG - Intronic
939711972 2:145533111-145533133 AGGGCTGTGTAGGCTGCGTATGG + Intergenic
940328512 2:152450967-152450989 AGAGCTGTGCCAACTGAGGATGG - Intronic
942481577 2:176393787-176393809 AGGTCTGAGCAGGCTCTGGAGGG - Intergenic
943782775 2:191843483-191843505 AGACCTGTGGAGAATGTGGAGGG - Intronic
944187781 2:196968504-196968526 AGGGCAGTCCAGACTGTTCAAGG - Intronic
944439440 2:199727354-199727376 AGAGCTGTGCAGACTCTTGGTGG - Intergenic
944883695 2:204041516-204041538 GGGGCTCTGGAGATTGTGGATGG + Intergenic
946355788 2:219183518-219183540 AGTGCAGTGCAGGGTGTGGAAGG - Exonic
946697262 2:222372262-222372284 AGAGCTGTGCAGCCTGGGGTTGG - Intergenic
947295832 2:228628940-228628962 AGGGCTGTGCTCCCTCTGGATGG - Intergenic
948240583 2:236429730-236429752 TGGGCTGTGCTCACTGTGGCAGG + Intronic
948711319 2:239827420-239827442 AAGGCCGTGCAGCCTGTGGCAGG - Intergenic
948740139 2:240041112-240041134 AGGGAGGTCCTGACTGTGGATGG + Intergenic
1168982643 20:2021116-2021138 AGGACTTTGGAGGCTGTGGAAGG - Intergenic
1172033417 20:31996486-31996508 AGGGCTGTGGAGACAGGGCAGGG - Exonic
1172095090 20:32456621-32456643 AGGGCTGTGCAGGGCATGGAGGG + Intronic
1172519084 20:35555848-35555870 AGGAGTTTGCAGGCTGTGGAAGG + Intronic
1172589040 20:36104869-36104891 TGGGCTGTGCGCACTCTGGATGG + Intronic
1172669189 20:36622701-36622723 CTGGCTGTGAAGACTGAGGAAGG - Intronic
1173187065 20:40848444-40848466 AGGGCTGAGCTGGCTGTGGCGGG - Intergenic
1174062974 20:47845551-47845573 AGGGCTGTGTTGACTGCAGAAGG + Intergenic
1174072749 20:47910127-47910149 AGGGCTGTGTTGACTGCAGAAGG - Intergenic
1174151321 20:48488548-48488570 AGGGCTGTGTTGACTGCAGAAGG + Intergenic
1176029226 20:63003283-63003305 AGAGATGTGCAGGCTGTGGGAGG - Intergenic
1176146089 20:63566170-63566192 AGGGCTGAGCAGGCTCTGGCAGG + Exonic
1176370307 21:6058384-6058406 GAGGCTGCGCAGACTGTTGAAGG - Intergenic
1176448674 21:6842929-6842951 AGAGCTGTGCAGGCTGTAGGAGG + Intergenic
1176826844 21:13707952-13707974 AGAGCTGTGCAGGCTGTAGGAGG + Intergenic
1179252754 21:39686779-39686801 AGGCCCGTTCTGACTGTGGATGG + Intergenic
1179595951 21:42443431-42443453 GGGGCTGTTCATACTGAGGATGG - Intronic
1179753212 21:43480157-43480179 GAGGCTGCGCAGACTGTTGAAGG + Intergenic
1179901195 21:44395690-44395712 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901207 21:44395729-44395751 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901220 21:44395768-44395790 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901232 21:44395807-44395829 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901245 21:44395846-44395868 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901257 21:44395885-44395907 AGGGGTGTGGAGACTGTGGAGGG + Intronic
1179901263 21:44395904-44395926 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901268 21:44395923-44395945 AGGGGTGTGGAAGCTGTGGAGGG + Intronic
1179901281 21:44395962-44395984 AGGGCTGTGGAGGATGTGGAGGG + Intronic
1179901293 21:44396001-44396023 AGGGATGTGGAGGCTCTGGAGGG + Intronic
1179901302 21:44396030-44396052 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179901314 21:44396069-44396091 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901326 21:44396108-44396130 AGGGGTGTGGAGACTGTGGAGGG + Intronic
1179901332 21:44396127-44396149 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901338 21:44396146-44396168 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901344 21:44396165-44396187 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901350 21:44396184-44396206 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901356 21:44396203-44396225 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901386 21:44396292-44396314 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1179901392 21:44396311-44396333 AGGGGTGTGGAGGATGTGGAGGG + Intronic
1179901430 21:44396430-44396452 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901444 21:44396469-44396491 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1179901453 21:44396507-44396529 AAGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901459 21:44396526-44396548 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901464 21:44396545-44396567 AGGGGTGTGGAGGCTGTGAAGGG + Intronic
1179901470 21:44396564-44396586 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901481 21:44396603-44396625 AGGGTTGTGGAGGCTGTGGAGGG + Intronic
1179901498 21:44396652-44396674 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901515 21:44396701-44396723 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901539 21:44396770-44396792 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901556 21:44396819-44396841 AGGGGTGTGGAGGCTGTGGAGGG + Intronic
1179901599 21:44396938-44396960 AGGGCTGTGGAGGCTGTGGAGGG + Intronic
1180011362 21:45053674-45053696 TGGCCAGGGCAGACTGTGGAAGG - Intergenic
1180105882 21:45617764-45617786 ATGGCATTGCAGGCTGTGGAAGG - Intergenic
1180765789 22:18345280-18345302 GGGGCTGTGCAGAGTGGGCAGGG - Intergenic
1180780521 22:18517098-18517120 GGGGCTGTGCAGAGTGGGCAGGG + Intronic
1180813240 22:18774419-18774441 GGGGCTGTGCAGAGTGGGCAGGG + Intergenic
1180818964 22:18812007-18812029 AGGGCTGTTCATGCTATGGAAGG + Intergenic
1181184540 22:21093527-21093549 AGGGCTGTGCAGGATGTGCCTGG + Intergenic
1181199416 22:21208735-21208757 GGGGCTGTGCAGAGTGGGCAGGG + Intronic
1181205188 22:21246455-21246477 AGGGCTGTTCATGCTATGGAAGG + Intergenic
1181629804 22:24144725-24144747 AGGCCTGTTCAGACTGTTGGTGG + Intronic
1182294064 22:29302863-29302885 AGGACTGTGCAGTCTGTGACAGG + Intergenic
1183377884 22:37475676-37475698 AGGGGAGTGCAGGCTGGGGAGGG - Intronic
1183377891 22:37475695-37475717 AGGGGAGTGCAGGCTGGGGAGGG - Intronic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184667587 22:45996930-45996952 AGGGGTGTGCAGGCGATGGAGGG + Intergenic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1185088672 22:48754107-48754129 TGGCCAGTTCAGACTGTGGATGG + Intronic
1203221737 22_KI270731v1_random:48960-48982 AGGGCTGTTCATGCTATGGAAGG - Intergenic
1203227411 22_KI270731v1_random:86171-86193 GGGGCTGTGCAGAGTGGGCAGGG - Intergenic
1203263342 22_KI270734v1_random:101-123 GGGGCTGTGCAGAGTGGGCAGGG + Intergenic
1203269089 22_KI270734v1_random:37860-37882 AGGGCTGTTCATGCTATGGAAGG + Intergenic
950477748 3:13224465-13224487 GGCGCTGGGCAGACTGTTGAGGG + Intergenic
951089885 3:18560193-18560215 AATTCTGTTCAGACTGTGGAAGG + Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
952918046 3:38264405-38264427 AAGGCAGGGCAGACAGTGGAGGG - Intergenic
953568090 3:44050422-44050444 AGCGTTGTGCAGACAGTGAAGGG - Intergenic
953734414 3:45479447-45479469 AGGTCTGAGAAGTCTGTGGAAGG + Intronic
953882811 3:46700429-46700451 AGGCCTGCGCAGGCTGGGGATGG - Intergenic
954205625 3:49056989-49057011 GTGGCTGTGCAGGCTGTGGCAGG - Exonic
954463717 3:50642286-50642308 ATGGCTGTGCAGAAACTGGATGG - Exonic
954681093 3:52346351-52346373 AGGGCTCATCTGACTGTGGAGGG - Intronic
955071879 3:55578406-55578428 AAGGAGGTGCAGACTGTGGTAGG - Intronic
955190832 3:56759989-56760011 AGGTCTGTCCAGACTATGGGAGG - Intronic
955397222 3:58566070-58566092 AGGGCAGGGCAGACTGCAGATGG - Exonic
955433796 3:58877933-58877955 AGTGCTGTGGGGACTGGGGAGGG + Intronic
956501601 3:69892722-69892744 AGGGGTCTGCAGACTCTGAAAGG - Intronic
957909007 3:86597500-86597522 AGGCCAGAGCAGACTGTGGAAGG + Intergenic
958816413 3:98921183-98921205 AGGGCTGTGCAGTCTGGACAAGG - Intergenic
960807349 3:121597032-121597054 AGGTGTGTGCAGGCAGTGGAAGG - Intronic
961493887 3:127276536-127276558 AGGGGAGTGCAGGCTGAGGATGG - Intergenic
962203764 3:133418786-133418808 AGTTCAGTGAAGACTGTGGATGG - Intronic
962990495 3:140573200-140573222 AGGGCCTGGCAGAGTGTGGAGGG + Exonic
966071690 3:175885857-175885879 AGGGCTGTGCAGACTCAAGGCGG - Intergenic
967069397 3:185949615-185949637 AGGGTTGGGCTGACTGGGGATGG - Intergenic
967852708 3:194094077-194094099 AGGGATGAGCTGACTGTGGGAGG - Intergenic
968243610 3:197117661-197117683 GGGGCTGGGAAGACAGTGGAAGG + Intronic
969230701 4:5828261-5828283 AGGGCTTTGCAAACTGTAGAGGG - Intronic
969306333 4:6328126-6328148 GGGGCTGTCCACCCTGTGGATGG - Intronic
970164940 4:13226568-13226590 AGAGCTGTGCAGATTGCTGAAGG + Intergenic
971504574 4:27352240-27352262 AGGGATTTGTAGACTGTGGGAGG - Intergenic
972076529 4:35096397-35096419 AGGGCTTCTCAGACTGTAGAAGG + Intergenic
972444999 4:39135515-39135537 AGCACTGTGCAGACTGGCGAAGG + Intergenic
972792547 4:42387021-42387043 AGGTCTGTGTGGATTGTGGAGGG + Intergenic
974671040 4:65030508-65030530 AGAGTTGTGCAGATTGTGGCAGG + Intergenic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
977506617 4:97911200-97911222 AGAGCTGTGCAGACTGTCAGCGG + Intronic
981739509 4:147987440-147987462 AGGGCACTACAGACTGAGGAGGG - Intronic
982549786 4:156783411-156783433 GGGGGTGTGCAGACTCTGGTGGG + Intronic
985489492 5:171151-171173 AGGGCCGGGCAGGCTGTGGGGGG - Intronic
985506003 5:280637-280659 AGGGCACTGTAGGCTGTGGATGG + Intronic
985506021 5:280713-280735 AGGGCACTGTAGGCTGTGGATGG + Intronic
985836884 5:2278100-2278122 AGGTCTGTGGAGAGTATGGATGG + Intergenic
986449314 5:7850296-7850318 GGGGCTGGACAGCCTGTGGAGGG - Intronic
989125427 5:38048128-38048150 AGGCCTATGCATACTATGGAGGG - Intergenic
989266714 5:39483241-39483263 AAGTCTGTGCAGACTGTAGCTGG + Intergenic
989467321 5:41772273-41772295 AGAGCTTTGCAGACAGTGGGAGG - Intronic
990561045 5:56983109-56983131 AGGGCTTTTCAGAATGGGGATGG - Intergenic
990763102 5:59152312-59152334 AGAGATGTTCAGACAGTGGAAGG + Intronic
991022116 5:61990277-61990299 AGGACTGTGGAGGCTGTGGAAGG - Intergenic
992075290 5:73187224-73187246 AGGGCTGTGAAGACAGTGCTGGG - Intergenic
992576275 5:78116959-78116981 TGGGCTGTGCAGACTGTTGTAGG - Intronic
995840501 5:116439189-116439211 AGGGCTCTGCAGACGCAGGAAGG + Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
997379158 5:133423024-133423046 AGTGCTGTGCAGGCTCTGAACGG + Intronic
997427838 5:133816399-133816421 AGGACTGTGCAAACTTTGGAAGG - Intergenic
1003371954 6:5537279-5537301 ATGTCTGTGCTGTCTGTGGAAGG - Intronic
1006313946 6:33279448-33279470 AGGAGGGTGCAGCCTGTGGAAGG + Intronic
1006920856 6:37626194-37626216 TGGCCTGTGCAGCCTGAGGAGGG - Intergenic
1006935207 6:37712444-37712466 AGGGCTGTGATGAGGGTGGAGGG - Intergenic
1011266216 6:85522191-85522213 ATGGCTCTGCAGAATGGGGAAGG - Intronic
1011322882 6:86116372-86116394 TGAGCTGTGCAGTCTGTGGTTGG + Intergenic
1011377681 6:86707082-86707104 AGAGCTGTGCAGACTCTTGGTGG - Intergenic
1011577677 6:88822034-88822056 AGTGCTGTGCAGTCAGGGGAAGG + Intronic
1012165730 6:95948871-95948893 TTGACTGTGAAGACTGTGGAGGG + Intergenic
1012652756 6:101777381-101777403 AGGCTTGTGCTGACTGTGCAAGG + Intronic
1013165568 6:107588320-107588342 GTAACTGTGCAGACTGTGGAGGG - Intronic
1015096042 6:129416564-129416586 GGGGCTGTGCAGTCTGTGTAGGG - Intronic
1015465688 6:133545998-133546020 GGGACTTTGGAGACTGTGGAGGG + Intergenic
1015750889 6:136557790-136557812 GATGCTGTGCACACTGTGGAAGG - Exonic
1016986593 6:149900178-149900200 AGGGCGGTGAAAGCTGTGGATGG - Intergenic
1017228897 6:152051330-152051352 AGTGCTGGGCAGCCTGGGGATGG - Intronic
1017674057 6:156795694-156795716 AGGCCTGGGCAGCCTGGGGAGGG - Intronic
1018106437 6:160491870-160491892 TTGGCAGTGCAGACTGTAGATGG + Intergenic
1018689397 6:166332779-166332801 AGTGCTGTGCTTACTGTGGCGGG - Intronic
1018747717 6:166775269-166775291 AGGGCTGTGCATAGTGCGAAGGG - Intronic
1018824291 6:167397666-167397688 AGGGCTGTGCAGCTTGGGGGTGG + Intergenic
1019322554 7:422261-422283 AGGACCCTGCAGCCTGTGGAGGG - Intergenic
1019323295 7:425223-425245 AGGGCTGGGCACACAGTGAAAGG - Intergenic
1019362728 7:613859-613881 AGGTCTCTGCAGGCTGGGGAGGG - Intronic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1021090496 7:16477406-16477428 AGGACTGTGCAGACTGGGTGTGG + Intronic
1023018202 7:35986459-35986481 GGGTCTGTGCAGTCTGAGGAAGG + Intergenic
1024051538 7:45626884-45626906 AGGGCTGGGCAGTGTGTGGGTGG + Intronic
1024517367 7:50270307-50270329 TGGGCTATGGAGACTGTGGTGGG + Intergenic
1025231427 7:57205361-57205383 AGGGCTGTGTTGACTGCAGAAGG - Intergenic
1025865763 7:65379235-65379257 GGGTCCGTGCAGACTCTGGATGG + Intronic
1027479117 7:78672386-78672408 ATGGCTCTGCAGACTGTATAGGG - Intronic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1029606156 7:101600703-101600725 GGTGCTGTGTAGACTGTTGAGGG + Intergenic
1029725944 7:102404542-102404564 TGGTCTGGGCAGACTGTGGGAGG - Intronic
1030642070 7:112017617-112017639 AGGGCTGTGAACAGTATGGATGG - Intronic
1031657781 7:124379798-124379820 ATGGCTGTGCTGCCTGTGGCTGG - Intergenic
1032076330 7:128837861-128837883 TGTGCTGTGCAGTCTGGGGAAGG + Intronic
1033238178 7:139655058-139655080 AGGGCTGCTCTGACTGTGGGGGG + Intronic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1034331564 7:150287580-150287602 GGCGCTGAGCACACTGTGGAAGG + Intronic
1034958821 7:155351674-155351696 GGGGCTGTGCAGACCCAGGAGGG - Intergenic
1035024284 7:155815971-155815993 GGTGCTGTGCAGAGTGTGGCTGG - Intergenic
1035090992 7:156310162-156310184 GGGGCTGAGCAGAGTGTGGGGGG - Intergenic
1035251106 7:157597758-157597780 TGGGCTGTGCAGACTGAGTGGGG + Intronic
1035353179 7:158260965-158260987 AGGGCTGAGCTGACCCTGGAGGG - Intronic
1035956354 8:4084613-4084635 AGGGCTTGGCAAACTCTGGAAGG - Intronic
1037783672 8:21889063-21889085 AGGGCTTTGCTATCTGTGGAGGG - Intergenic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1039189793 8:34960359-34960381 ATGGCTATACAGACTGTGCAAGG + Intergenic
1039568266 8:38566111-38566133 AGGGCTCTGGCGACTGTGGAAGG + Intergenic
1039966520 8:42288063-42288085 AAGGCTCTGTAGACTCTGGATGG + Intronic
1040526151 8:48226829-48226851 AGAGGAGTGCAGACTGAGGATGG - Intergenic
1042469269 8:69164636-69164658 AGGGCCTTTCAGAGTGTGGAGGG - Intergenic
1043461534 8:80465230-80465252 AGGGATGTGGAGAAAGTGGAAGG + Intergenic
1043925337 8:86030504-86030526 AGGGCTGGGCAGAGTGGGGGTGG + Intronic
1044694168 8:94906196-94906218 AGGGCAGGGCAGACTGTGGAGGG - Intronic
1045030235 8:98128050-98128072 AATGCTGTGCTGAGTGTGGATGG - Intronic
1045970997 8:108080186-108080208 AGGGCTGGCCAGACAGTGTAGGG - Intronic
1047770101 8:128024107-128024129 TGGGCTCTGCAGACGGTGGTGGG - Intergenic
1048340892 8:133537657-133537679 AGGGATGTGCAAGCTGTAGAGGG - Intronic
1048384357 8:133897823-133897845 GGGGCAGAGAAGACTGTGGAGGG - Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1049580713 8:143409271-143409293 AGAGCTGTCCAGGCTGGGGAGGG + Intergenic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1053716134 9:40890982-40891004 AGGGCTTTGCAGCCTATGGTAGG + Intergenic
1054076384 9:60539295-60539317 AGGGCTTTGCAGCCTATGGTAGG - Intergenic
1055006479 9:71513041-71513063 TGGGCTGTGCACACCATGGATGG + Intergenic
1055010923 9:71564201-71564223 TGGGCTTTCCAGAGTGTGGAGGG - Intergenic
1055592176 9:77828486-77828508 TGTGCTGTGAAGACTGTGAATGG - Intronic
1057142514 9:92735880-92735902 AGGGCAGTGCAGGCTCTGGGTGG + Intronic
1057693877 9:97310163-97310185 AGCTCTGTGCAGAATGTGGGGGG + Intronic
1057937371 9:99252270-99252292 GGGGCTTTGCAAACTGTGGATGG - Intergenic
1060073376 9:120570182-120570204 TGGGCAGGGCAGACTGTGAAGGG + Intronic
1060884532 9:127141064-127141086 AGGGCTGTCCAGGGAGTGGAGGG + Intronic
1061377859 9:130236712-130236734 GGGAATGTGCAGACTGGGGAGGG - Exonic
1061772346 9:132935666-132935688 AGGACTGTGGGGACTGTGGCAGG - Intronic
1062145801 9:134989030-134989052 AGGGGTGTCCAGACTGTGTGAGG + Intergenic
1203520515 Un_GL000213v1:41588-41610 AGAGCTGTGCAGGCTGTAGGAGG - Intergenic
1187171781 X:16859273-16859295 AAGGGTGTTCATACTGTGGAGGG - Intronic
1187704240 X:21993687-21993709 AGCTCTGTACAGGCTGTGGAGGG - Intronic
1188118612 X:26277423-26277445 AGGGCTGTGCAGCCTGGCAATGG + Intergenic
1189752679 X:44238515-44238537 AGGGCTCTACAGACTGTTTAAGG - Intronic
1190731694 X:53230845-53230867 TGCACTGTCCAGACTGTGGAGGG - Intergenic
1192175662 X:68883539-68883561 AGGGCTCTGCAGTCTGTTTAGGG - Intergenic
1194239092 X:91422144-91422166 AGGGCTGTGCAGGGTGGGGCAGG + Intergenic
1195013097 X:100752432-100752454 AGTGCTGAGCAGAGTGAGGAAGG + Intergenic
1195812619 X:108851268-108851290 AGAGCTGTGCAGATTGTCAATGG + Intergenic
1195821828 X:108954005-108954027 GGGGGTGTGCAGAATGTGTATGG + Intergenic
1196224207 X:113146492-113146514 AGAGCTAGGCAGACTATGGAAGG - Intergenic
1197040198 X:121928017-121928039 GGGGCTTTTCAGAGTGTGGAGGG + Intergenic
1198515331 X:137400982-137401004 TGGGCTGTGCAGCCTGAGGTTGG + Intergenic
1199133164 X:144219054-144219076 CAAGCTGTGCAGACTGTGGTTGG + Intergenic
1200732055 Y:6753045-6753067 AGAGCTGTGCAGACTCATGAGGG - Intergenic