ID: 1113305188

View in Genome Browser
Species Human (GRCh38)
Location 13:109069855-109069877
Sequence AACACTTATCTCAATAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113305188 Original CRISPR AACACTTATCTCAATAGATG TGG Intronic
902881156 1:19372630-19372652 ATCACTTAGGTCAAAAGATGAGG + Intronic
904649809 1:31996544-31996566 AACACTTATTTAAATGCATGAGG - Intergenic
907001163 1:50859026-50859048 CACAATCATCTCAATAGATGCGG + Intronic
907282505 1:53360346-53360368 AACACTTATCAGCAAAGATGTGG + Intergenic
907995863 1:59631750-59631772 AACACTTCTCTTCAGAGATGGGG - Intronic
908182658 1:61621714-61621736 AAGATTCATCTCAAAAGATGGGG + Intergenic
908373231 1:63504750-63504772 CATGATTATCTCAATAGATGTGG - Intronic
908557857 1:65275499-65275521 AAGACTTTTCTCAATTGATTTGG + Intronic
909081916 1:71122756-71122778 CAGGATTATCTCAATAGATGCGG + Intergenic
911088627 1:94000508-94000530 ACCACTTATCTCAACAGATCCGG - Intronic
911551649 1:99289697-99289719 CATGATTATCTCAATAGATGCGG + Intronic
912676275 1:111684063-111684085 CAAGATTATCTCAATAGATGTGG + Intronic
913362795 1:118001061-118001083 CATGATTATCTCAATAGATGCGG - Intronic
916453514 1:164945684-164945706 CATAATCATCTCAATAGATGAGG - Intergenic
916600213 1:166285951-166285973 AACACTTACCTCACAAGATTTGG + Intergenic
916880512 1:169015733-169015755 AACAGTTATCTTAAGAGCTGAGG - Intergenic
917400809 1:174647446-174647468 CATGATTATCTCAATAGATGCGG - Intronic
918061697 1:181067043-181067065 AACATTTATGTCAAGACATGAGG - Intergenic
918785563 1:188758261-188758283 AACAATTATAACAATATATGTGG - Intergenic
919962653 1:202487185-202487207 AGCAATCATCTCAATATATGGGG + Intronic
920623690 1:207575078-207575100 ATCATTTATCTCAATACATTTGG + Intronic
921440352 1:215178597-215178619 TACTATCATCTCAATAGATGTGG - Intronic
923453093 1:234138241-234138263 AATACTTATCTCAGAAGTTGTGG + Intronic
1062917999 10:1256596-1256618 ACCACATATATCAAAAGATGGGG + Intronic
1066039493 10:31532670-31532692 AACAATCATCTCAATAGGTGTGG + Intergenic
1068450296 10:57177968-57177990 CATAATTATCTCAAAAGATGTGG + Intergenic
1069182281 10:65376441-65376463 AACACTTTTCTGTGTAGATGAGG - Intergenic
1071063104 10:81597457-81597479 CATGATTATCTCAATAGATGCGG + Intergenic
1073488163 10:103834934-103834956 CACACTTATCTTAATAGTTCTGG + Intronic
1075217481 10:120549751-120549773 TATAATCATCTCAATAGATGTGG + Intronic
1075729167 10:124626073-124626095 CACACGCATCTCAACAGATGTGG - Intronic
1075990871 10:126837526-126837548 AGCACTTATCTCAAAGGAAGAGG - Intergenic
1077714003 11:4563229-4563251 GATGATTATCTCAATAGATGTGG + Intergenic
1077953769 11:6991082-6991104 AACACTTTTCTCACATGATGAGG - Intergenic
1078030170 11:7742092-7742114 AGGAATCATCTCAATAGATGCGG + Intergenic
1078488352 11:11745234-11745256 AACATTTATTTCAAGAGTTGGGG + Intergenic
1079700296 11:23537770-23537792 TATAATCATCTCAATAGATGTGG - Intergenic
1080118295 11:28645172-28645194 CATGATTATCTCAATAGATGCGG + Intergenic
1080118861 11:28651661-28651683 TACAATTATTTCCATAGATGTGG - Intergenic
1080164537 11:29221186-29221208 CATGATTATCTCAATAGATGTGG - Intergenic
1080435615 11:32239426-32239448 AATACATATATGAATAGATGTGG + Intergenic
1081187129 11:40057686-40057708 AACACTTATGTCAGTAGACTTGG + Intergenic
1081221175 11:40464231-40464253 TACAATCATTTCAATAGATGAGG + Intronic
1087574536 11:99973911-99973933 AACACTCATTTGAATATATGAGG - Intronic
1088181177 11:107113845-107113867 AACACTTCTCACAAAAAATGAGG - Intergenic
1088545213 11:110952187-110952209 ATGACATATCTCAATAGATGTGG - Intergenic
1089316555 11:117595108-117595130 GACACTTCTCTGAAGAGATGAGG + Intronic
1090321556 11:125848786-125848808 CATTATTATCTCAATAGATGCGG + Intergenic
1090559992 11:127921524-127921546 AACAATTAAGTAAATAGATGTGG + Intergenic
1090895762 11:130973320-130973342 CATGATTATCTCAATAGATGCGG - Intergenic
1093188926 12:16052726-16052748 CATGATTATCTCAATAGATGCGG + Intergenic
1093823911 12:23658294-23658316 AACACTTTTCTCATGAGAAGTGG + Intronic
1095306054 12:40640286-40640308 CATGATTATCTCAATAGATGCGG - Intergenic
1096535798 12:52273512-52273534 GAAACTTATTTCAGTAGATGTGG + Intronic
1097456048 12:59799821-59799843 CACTATTATCTCAATAGATGTGG + Intergenic
1097470479 12:59984781-59984803 CATGATTATCTCAATAGATGCGG + Intergenic
1098145498 12:67493562-67493584 CATAATTATCTCAATAGATACGG + Intergenic
1098716922 12:73840590-73840612 AACACCTGTCTCAGTACATGTGG - Intergenic
1099697060 12:86036536-86036558 CAAGATTATCTCAATAGATGAGG - Intronic
1099732409 12:86522341-86522363 CATGATTATCTCAATAGATGTGG - Intronic
1099899285 12:88687679-88687701 ACCATTTATCTCAATAAATTGGG - Intergenic
1100029354 12:90167048-90167070 AACACTTACTTCAATAGAACTGG - Intergenic
1101538319 12:105641166-105641188 AACACTGATCACATTAGATGAGG + Intergenic
1101622406 12:106401714-106401736 CATGATTATCTCAATAGATGCGG + Intronic
1101766757 12:107707947-107707969 AACAGCTTTCTCAAAAGATGTGG + Intronic
1105211050 13:18257272-18257294 AACACGAATCCCAATAGATGTGG + Intergenic
1105936062 13:25100514-25100536 AACACTTCTCAGAATAGCTGAGG + Intergenic
1107218627 13:37952814-37952836 CACGATTATCTCAATAAATGCGG - Intergenic
1108562659 13:51661510-51661532 GATACTTATATCAAGAGATGAGG - Intronic
1109001985 13:56816687-56816709 TATAATCATCTCAATAGATGCGG + Intergenic
1109117283 13:58404676-58404698 TATAATTATTTCAATAGATGTGG - Intergenic
1109161755 13:58984074-58984096 CATGATTATCTCAATAGATGCGG - Intergenic
1109540992 13:63778667-63778689 CATGATTATCTCAATAGATGCGG - Intergenic
1109714206 13:66200013-66200035 AACACTTATTTTAATAGATGAGG + Intergenic
1111186946 13:84750295-84750317 AACAATTTTCTCAATATATTTGG + Intergenic
1112345464 13:98585534-98585556 ACCACTGATCTAAATAGATGAGG - Intergenic
1112437246 13:99399323-99399345 AAGGATTATCTGAATAGATGGGG - Intergenic
1113305188 13:109069855-109069877 AACACTTATCTCAATAGATGTGG + Intronic
1114432553 14:22674286-22674308 CATGATTATCTCAATAGATGCGG - Intergenic
1114860180 14:26507961-26507983 AAGAGTTATATCAATAGAAGAGG + Intronic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1116324903 14:43520203-43520225 AAAAATTATATCAATAGATCGGG - Intergenic
1116776009 14:49181573-49181595 CAAGATTATCTCAATAGATGCGG + Intergenic
1117751876 14:58931896-58931918 CACAGTCATCTCAATTGATGTGG - Intergenic
1118052410 14:62043736-62043758 TATAATCATCTCAATAGATGTGG - Intronic
1118165932 14:63336297-63336319 CATGATTATCTCAATAGATGCGG + Intergenic
1120652143 14:87147589-87147611 AGCACTTGTTTCAATAGTTGAGG + Intergenic
1121157326 14:91698632-91698654 TATAATGATCTCAATAGATGTGG - Intronic
1123958863 15:25372593-25372615 AACACTTATCTCAAAAAGTTGGG - Intronic
1124580417 15:30949122-30949144 CACGATTATCTCATTAGATGCGG + Intronic
1125784017 15:42299302-42299324 CATGATTATCTCAATAGATGCGG - Intronic
1127611127 15:60638555-60638577 AAAACTCATCTCATTAGAAGAGG + Intronic
1129638211 15:77345277-77345299 ACAATCTATCTCAATAGATGCGG - Intronic
1130763467 15:86845593-86845615 AATACATTTCTCAATATATGGGG - Intronic
1133098269 16:3462690-3462712 AACGCTTTTCTTAATAGAAGAGG - Intronic
1134088358 16:11373938-11373960 AACACTTCTCTTACCAGATGAGG - Intronic
1134475697 16:14571625-14571647 GACACTTCTCTGACTAGATGTGG - Intronic
1135516763 16:23142273-23142295 AACACGTATATCAACACATGTGG - Intronic
1136860268 16:33696419-33696441 AACACTTTTCTAAAAATATGAGG + Intergenic
1137948496 16:52758785-52758807 AACACTTATCACAATAGGGATGG + Intergenic
1138325074 16:56158402-56158424 CATGATTATCTCAATAGATGCGG + Intergenic
1139775402 16:69313831-69313853 AACACGTATGGCAAAAGATGAGG - Intronic
1140595288 16:76401781-76401803 CATGATTATCTCAATAGATGTGG - Intronic
1203121775 16_KI270728v1_random:1544587-1544609 AACACTTTTCTAAAAATATGAGG + Intergenic
1146683257 17:34823737-34823759 AACATTTATCTGCATAGAGGAGG + Intergenic
1146884301 17:36460843-36460865 AACATTTTTCTTAAGAGATGGGG + Intergenic
1149027381 17:52043794-52043816 TATGATTATCTCAATAGATGGGG - Intronic
1153420183 18:4896471-4896493 CATGATTATCTCAATAGATGCGG + Intergenic
1153593854 18:6703693-6703715 CATAATTATCTCAATAGATGTGG + Intergenic
1154979780 18:21493391-21493413 AGCACTTAACACAAAAGATGGGG - Intronic
1155476534 18:26240824-26240846 CATGATTATCTCAATAGATGTGG - Intronic
1156761747 18:40600325-40600347 CATAATCATCTCAATAGATGTGG + Intergenic
1159304226 18:66618347-66618369 CACGATTATCTCAATAGATGTGG + Intergenic
1161662114 19:5553256-5553278 AAAACTTATCTCAACATATAAGG + Intergenic
1162791613 19:13065938-13065960 AACACCTTTCTCATTATATGAGG + Intronic
1166263552 19:41660998-41661020 CATGATTATCTCAATAGATGCGG + Intronic
925968548 2:9089656-9089678 CACAGTTTTCTCAATAAATGTGG - Intergenic
926549351 2:14282564-14282586 AACAGTTATCTCAACATCTGGGG + Intergenic
927221570 2:20715282-20715304 CATGATTATCTCAATAGATGCGG + Intronic
930546295 2:52771572-52771594 CATAATTATCTCAATAGAAGAGG + Intergenic
931498634 2:62839243-62839265 CATGATTATCTCAATAGATGCGG + Intronic
932541244 2:72655217-72655239 ATTACTTACTTCAATAGATGGGG + Intronic
933016899 2:77139376-77139398 CATGATTATCTCAATAGATGCGG + Intronic
933088595 2:78089433-78089455 AATACTAATGTCAATAGATATGG + Intergenic
934458639 2:94197533-94197555 AACACTTTTCTAAAAATATGAGG + Intergenic
937740225 2:125343390-125343412 TATGTTTATCTCAATAGATGTGG + Intergenic
938746625 2:134284688-134284710 AACAGTTATCTCAATTTAAGAGG + Intronic
939125154 2:138169040-138169062 CATGATTATCTCAATAGATGTGG + Intergenic
939215464 2:139232220-139232242 TACATTTATCTGTATAGATGTGG + Intergenic
940395427 2:153184707-153184729 CATGATTATCTCAATAGATGCGG - Intergenic
941563534 2:167079098-167079120 TACGTTTATCTCAATAGATGTGG - Intronic
941726751 2:168869108-168869130 CATAATTATCTCAATAGATGCGG + Intronic
941797653 2:169618092-169618114 CACAATTATCTCAATAGATGTGG - Intronic
942122909 2:172796126-172796148 AACACCTAGCCCTATAGATGAGG + Intronic
942628703 2:177932565-177932587 AAAGATCATCTCAATAGATGAGG + Intronic
944102291 2:196040475-196040497 TACAATCATCTTAATAGATGTGG + Intronic
944879543 2:203998153-203998175 AACTCTGATATCAGTAGATGTGG + Intergenic
945350267 2:208769357-208769379 AACATTTTTCTTAATAGATAGGG + Intronic
948429442 2:237909772-237909794 AACAACTTTCTCCATAGATGTGG - Intronic
1169945111 20:10979681-10979703 ACCACTCATCTAAATATATGTGG - Intergenic
1173389244 20:42617178-42617200 CATGATTATCTCAATAGATGCGG - Intronic
1173733327 20:45343223-45343245 AACACATATGTCAACAGTTGGGG - Intronic
1173971566 20:47156715-47156737 AACACTTAGCACAAGAGATGTGG + Intronic
1174952986 20:55063755-55063777 CAGGATTATCTCAATAGATGTGG - Intergenic
1174981006 20:55394797-55394819 AATACTTATCACATTACATGAGG - Intergenic
1176675946 21:9777349-9777371 AACACATAATTGAATAGATGTGG + Intergenic
1176924263 21:14727848-14727870 AACATTTATCTCATTATATCTGG + Intergenic
1177596341 21:23248111-23248133 AACACTAATGTTAATAGCTGTGG + Intergenic
1178574912 21:33778015-33778037 CATACTTATCTCAATAGATGCGG - Intronic
1179472886 21:41623229-41623251 AACACTTCCCTCACTAGAGGTGG + Intergenic
1180765197 22:18342164-18342186 AACACGAATCCCAATAGATGTGG - Intergenic
1180813833 22:18777520-18777542 AACACGAATCCCAATAGATGTGG + Intergenic
1181200018 22:21211855-21211877 AACACGAATCCCAATAGATGTGG + Intronic
1181357567 22:22308900-22308922 AACACTTTTCTAAAAATATGAGG - Intergenic
1181701717 22:24625104-24625126 AACACGAATCCCAATAGATGTGG - Intronic
1181794731 22:25298051-25298073 TACGATCATCTCAATAGATGTGG + Intergenic
1203226818 22_KI270731v1_random:83069-83091 AACACGAATCCCAATAGATGTGG - Intergenic
1203263932 22_KI270734v1_random:3207-3229 AACACGAATCCCAATAGATGTGG + Intergenic
949223177 3:1660364-1660386 CATGATTATCTCAATAGATGCGG + Intergenic
953395237 3:42563975-42563997 AAACGTTTTCTCAATAGATGTGG - Intronic
953507792 3:43503414-43503436 AACATTCATCCCAATAGATGAGG + Intronic
953525461 3:43686588-43686610 AACTCTCATCTTTATAGATGAGG + Intronic
953673282 3:44980436-44980458 AAATGTTATCTCTATAGATGAGG + Intronic
954497141 3:50975380-50975402 CATGATTATCTCAATAGATGCGG - Intronic
954509546 3:51110588-51110610 CATGATTATCTCAATAGATGCGG + Intronic
955269301 3:57480821-57480843 TATGATTATCTCAATAGATGCGG + Intronic
956985015 3:74688687-74688709 CATAATTATCTCAATAGATGTGG + Intergenic
957265554 3:77960032-77960054 TATAATTTTCTCAATAGATGTGG - Intergenic
957846971 3:85750221-85750243 AAAACACATCTCAAAAGATGTGG - Intronic
958460179 3:94384508-94384530 CATGATTATCTCAATAGATGTGG + Intergenic
958599072 3:96269999-96270021 AATACTTATTTCAATATATGTGG - Intergenic
959290357 3:104466077-104466099 CATGATTATCTCAATAGATGTGG - Intergenic
960642867 3:119845063-119845085 CATGATTATCTCAATAGATGTGG + Intronic
961044125 3:123697119-123697141 GAGTCTTTTCTCAATAGATGTGG - Intronic
961199384 3:125032343-125032365 AACAGTTATCTCAAGGGATTTGG - Intronic
963029958 3:140960239-140960261 AACACTTATCTCAAAATATCAGG - Intronic
963255768 3:143143084-143143106 AACAATTATCTCAATACAAGAGG + Intergenic
963979610 3:151522592-151522614 CACAATTATCTCAATAGACATGG + Intergenic
969953052 4:10859115-10859137 AAAAATTATCTCACTGGATGAGG - Intergenic
970412444 4:15822094-15822116 CATGATTATCTCAATAGATGCGG + Intronic
970728358 4:19073726-19073748 AATACATATATCAATATATGAGG + Intergenic
971781915 4:31046705-31046727 AATATTTAACTCAATAGATTCGG - Intronic
971801069 4:31291684-31291706 TATGATTATCTCAATAGATGTGG - Intergenic
971915911 4:32869576-32869598 AACAATTACCTCAATAGGTATGG - Intergenic
972198945 4:36689453-36689475 TATAATAATCTCAATAGATGTGG - Intergenic
973535937 4:51881993-51882015 AACACTTTTCTTAAGAGATGGGG - Intronic
973935836 4:55845633-55845655 CATGATTATCTCAATAGATGCGG + Intergenic
975275946 4:72501852-72501874 TACGATCATCTCAATAGATGTGG - Intronic
975424603 4:74211423-74211445 CATGATTATCTCAATAGATGCGG - Intronic
976899406 4:90155119-90155141 CATGATTATCTCAATAGATGCGG - Intronic
976905510 4:90231373-90231395 CATGATTATCTCAATAGATGCGG + Intronic
977050026 4:92118200-92118222 CATAATTATCTCAAGAGATGTGG - Intergenic
977179962 4:93861548-93861570 TATACTTATCTCAATAGACTTGG + Intergenic
978418751 4:108506982-108507004 CATGATTATCTCAATAGATGCGG + Intergenic
978702886 4:111670777-111670799 TAGACTTTTCTTAATAGATGAGG - Intergenic
979052217 4:115949782-115949804 TATGATTATCTCAATAGATGTGG - Intergenic
980162608 4:129183838-129183860 CATGATTATCTCAATAGATGCGG - Intergenic
980375133 4:131936394-131936416 AACAGTTATCCCACTTGATGGGG - Intergenic
980531274 4:134059024-134059046 AACAAATATCTCAAGAGAAGGGG + Intergenic
981907532 4:149939065-149939087 CACAATCATCTCAATAGATGTGG + Intergenic
981987847 4:150879269-150879291 TACATTTATCCCAATAGATGTGG + Intronic
982393973 4:154895877-154895899 CATGATTATCTCAATAGATGCGG + Intergenic
983313694 4:166098649-166098671 AATATTTATCTCACTTGATGGGG - Intronic
983533696 4:168835200-168835222 AGCACTTATTTCAAGAGATCCGG + Intronic
983838890 4:172429956-172429978 AACAGTTTTCTCAATAAGTGAGG + Intronic
984178858 4:176455479-176455501 TATGATTATCTCAATAGATGTGG + Intergenic
984268614 4:177524046-177524068 AATGATTATCTCAATAGATGCGG + Intergenic
984997705 4:185451719-185451741 AACTCTTATCTCAAAAGAATTGG - Intronic
987454238 5:18123254-18123276 CATGATTATCTCAATAGATGCGG + Intergenic
988495162 5:31738810-31738832 ACCACTTTTCTAAAGAGATGGGG - Intronic
988745734 5:34135158-34135180 CACGATTATCTCAACAGATGCGG - Intergenic
989687259 5:44104842-44104864 CATGATTATCTCAATAGATGCGG - Intergenic
990766070 5:59184117-59184139 GACAATTATCCCAGTAGATGAGG + Intronic
991071569 5:62488517-62488539 AACAGTTACCTCATTAGAAGTGG + Intronic
991267233 5:64735526-64735548 AACATTTAACTTAAGAGATGCGG + Intronic
991416843 5:66401758-66401780 CACGATTATCTCAATAGATGCGG - Intergenic
991742403 5:69694990-69695012 CAAGATTATCTCAATAGATGCGG - Intergenic
991755291 5:69860218-69860240 CAAGATTATCTCAATAGATGCGG + Intergenic
991793977 5:70274730-70274752 CAAGATTATCTCAATAGATGCGG - Intergenic
991821793 5:70570293-70570315 CAAGATTATCTCAATAGATGCGG - Intergenic
991834618 5:70735366-70735388 CAAGATTATCTCAATAGATGCGG + Intergenic
991886354 5:71274262-71274284 CAAGATTATCTCAATAGATGCGG - Intergenic
991969478 5:72124869-72124891 AACACTGCTCTACATAGATGTGG + Intronic
992666624 5:79015891-79015913 AATGATTATCTCAGTAGATGTGG + Intronic
993064326 5:83079251-83079273 AACACATATGCCAATAAATGAGG + Intronic
994717829 5:103345232-103345254 AACCCTAATCTCAATATATTAGG + Intergenic
996953857 5:129160237-129160259 CACAATCATCTCAATAGATGTGG - Intergenic
998294002 5:140947922-140947944 AACACTTTTCTCATAAGATCAGG - Intronic
998683112 5:144492951-144492973 CACAATCATCCCAATAGATGCGG + Intergenic
999810616 5:155123829-155123851 CATGATTATCTCAATAGATGCGG + Intergenic
1001357123 5:171038722-171038744 ACAAATCATCTCAATAGATGTGG - Intronic
1003276429 6:4657720-4657742 AACACTTAGCTCAATAATTTTGG - Intergenic
1003664350 6:8096137-8096159 AAAAGTTATATTAATAGATGTGG - Intronic
1003834943 6:10060808-10060830 AGCACTCATCTTAAGAGATGAGG + Intronic
1005120665 6:22386219-22386241 CACGATTGTCTCAATAGATGCGG - Intergenic
1005543893 6:26843393-26843415 CACGATTATCTCAATAGATGCGG - Intergenic
1008094525 6:47325834-47325856 AACACTCTTTTCAATAAATGGGG + Intergenic
1009053818 6:58311994-58312016 CATGATTATCTCAATAGATGCGG - Intergenic
1009893198 6:69714156-69714178 ATCACTTATTTCAATATATTTGG + Intronic
1009900554 6:69803433-69803455 AACACTTTTCTTAATAGTTTTGG - Intergenic
1010476586 6:76295779-76295801 TAGGATTATCTCAATAGATGCGG - Intergenic
1011801468 6:91020764-91020786 AAGCCTTCTCTCAATAGAGGTGG + Intergenic
1012000130 6:93644500-93644522 AACACTTAGTGCAATAGGTGTGG - Intergenic
1012158364 6:95849709-95849731 ATCAGTTATCTCAGTAGTTGAGG - Intergenic
1012343147 6:98153708-98153730 AAAGATTATCTCAATAGATGCGG - Intergenic
1012775893 6:103493407-103493429 CATGATTATCTCAATAGATGCGG - Intergenic
1013383449 6:109600317-109600339 CATGATTATCTCAATAGATGCGG - Intronic
1013505214 6:110793365-110793387 ATCACTTATCTAAAAAGATAAGG + Intronic
1014353234 6:120370465-120370487 CAAATTTATCTCGATAGATGAGG + Intergenic
1014589579 6:123247004-123247026 CATGATTATCTCAATAGATGCGG + Intronic
1014973369 6:127847035-127847057 CATAATTGTCTCAATAGATGCGG + Intronic
1015349946 6:132206318-132206340 AAAGATCATCTCAATAGATGTGG - Intergenic
1015658077 6:135542236-135542258 CATGATTATCTCAATAGATGTGG + Intergenic
1015782845 6:136888261-136888283 AACAACTATCTTAAAAGATGAGG - Intronic
1017836153 6:158180113-158180135 CACGATTATCTCAAAAGATGCGG - Intronic
1018103935 6:160465531-160465553 AACACTTCTCACACCAGATGTGG - Intergenic
1018130984 6:160732412-160732434 AACACTTCTCACACCAGATGTGG + Intronic
1018486883 6:164249640-164249662 AGCACTTTTCTCAATATTTGAGG + Intergenic
1020406045 7:7835046-7835068 ATCACTTCTCTCAATAGATGGGG + Intronic
1020969475 7:14917097-14917119 AATACTTATGTCAAAATATGTGG + Intronic
1021351467 7:19599034-19599056 TATAATTATCTCAACAGATGTGG - Intergenic
1022876805 7:34541955-34541977 CATGATTATCTCAATAGATGTGG - Intergenic
1024086762 7:45899349-45899371 AACACTTAACTCATTGTATGAGG + Intergenic
1024416718 7:49116208-49116230 CATGATTATCTCAATAGATGAGG - Intergenic
1026187798 7:68096084-68096106 CACACTTATCTCTATAGAACAGG + Intergenic
1026514470 7:71056534-71056556 AACTCTCAGCTCAATAAATGGGG - Intergenic
1027447547 7:78291834-78291856 TACGATTATCTCAATAGATGCGG + Intronic
1027994205 7:85403664-85403686 CACAATTAGCTCAATAGATAAGG + Intergenic
1028816171 7:95147735-95147757 CATGATTATCTCAATAGATGTGG - Intronic
1029010829 7:97260300-97260322 CACGATTATCTCAATAGATGTGG - Intergenic
1032866620 7:135931854-135931876 AACAGTTATATATATAGATGGGG + Intronic
1033490805 7:141841665-141841687 AACAGTTATCTTGATAGTTGGGG + Intergenic
1033887883 7:145970453-145970475 CATGATTATCTCAATAGATGAGG + Intergenic
1035215892 7:157366437-157366459 AACCCTTAATTCAATAGATAAGG - Intronic
1036704498 8:11036639-11036661 AACACTGCTCTCAAGAGTTGGGG + Intronic
1037476514 8:19263083-19263105 AACATTTATGTCAAAATATGTGG - Intergenic
1039205058 8:35143223-35143245 AACACTTAAATCAGTAGATGTGG + Intergenic
1041900275 8:62974900-62974922 CATGATTATCTCAATAGATGCGG - Intronic
1042232886 8:66576979-66577001 CATGATTATCTCAATAGATGCGG + Intronic
1042731103 8:71935927-71935949 CACGATTATCTCAATAGATACGG + Intronic
1043343952 8:79277130-79277152 TATAATTATCTCAATAGATATGG + Intergenic
1043764887 8:84118782-84118804 AACACTAATCTTATTAGATCAGG - Intergenic
1043777922 8:84293789-84293811 AACACTTATCCTAAAAGGTGAGG - Intronic
1044470286 8:92559069-92559091 CATGATTATCTCAATAGATGCGG - Intergenic
1046496113 8:115015730-115015752 CATGATTATCTCAATAGATGCGG - Intergenic
1050440854 9:5662070-5662092 CATGATTATCTCAATAGATGCGG - Intronic
1051759603 9:20447349-20447371 AACACATCTCAAAATAGATGGGG + Intronic
1052267144 9:26588137-26588159 CATGATTATCTCAATAGATGCGG + Intergenic
1052410940 9:28120283-28120305 AACGCCTGTCACAATAGATGGGG + Intronic
1055537575 9:77265035-77265057 CACGATTACCTCAATAGATGCGG - Intronic
1055866453 9:80819747-80819769 TATGATTATCTCAATAGATGCGG + Intergenic
1059748924 9:117229649-117229671 AACATTTATTTCAGTAGCTGTGG - Intronic
1062519818 9:136952971-136952993 ATCACTTAGCTCAAAAGTTGCGG - Exonic
1190585591 X:51937055-51937077 TATGATTATCTCAATAGATGTGG + Intergenic
1190601999 X:52102603-52102625 AACACTATGCTGAATAGATGTGG + Intergenic
1190799672 X:53775855-53775877 AACACTATTCTTAAAAGATGTGG - Intergenic
1190939655 X:55028119-55028141 AACACATATCTCCAGATATGAGG - Intronic
1191664305 X:63682735-63682757 CACGGTTATTTCAATAGATGTGG + Intronic
1191854926 X:65616946-65616968 CATGATTATCTCAATAGATGCGG - Intronic
1193156472 X:78179632-78179654 CATGATTATCTCAATAGATGCGG + Intergenic
1193160898 X:78228217-78228239 CATGATTATCTCAATAGATGCGG - Intergenic
1193270320 X:79521473-79521495 CACAATCATCTCAATAAATGTGG + Intergenic
1193294203 X:79815229-79815251 CATTCTTATCTCAGTAGATGTGG - Intergenic
1193997817 X:88388352-88388374 AATAATTATCTCAATAGATGTGG + Intergenic
1194248389 X:91542533-91542555 CAATATTATCTCAATAGATGTGG + Intergenic
1194312465 X:92329187-92329209 TATAAGTATCTCAATAGATGCGG + Intronic
1194599491 X:95902882-95902904 AACACTGATCTCAACATTTGTGG + Intergenic
1195212718 X:102665902-102665924 CACGATTATCTCAATAGATGCGG - Intergenic
1196362785 X:114885423-114885445 AACACATTTCTCAGAAGATGTGG + Intronic
1197155007 X:123260840-123260862 AAGACTCATCACAATAGATTAGG - Intronic
1197183864 X:123564511-123564533 CATGATTATCTCAATAGATGTGG + Intergenic
1197571089 X:128151533-128151555 CATGATTATCTCAATAGATGCGG + Intergenic
1198164987 X:134046406-134046428 CATGATTATCTCAATAGATGTGG - Intergenic
1198687433 X:139241932-139241954 CATGATTATCTCAATAGATGCGG + Intergenic
1198930428 X:141852681-141852703 AACAATCATCTTAATAGACGTGG - Intronic
1199011693 X:142766076-142766098 TATGATTATCTCAATAGATGCGG - Intergenic
1199276212 X:145945431-145945453 TATAATCATCTCAATAGATGAGG - Intergenic
1200567401 Y:4784053-4784075 CAATATTATCTCAATAGATGTGG + Intergenic
1202297785 Y:23378131-23378153 AGCAATCATCTCAATATATGGGG + Intergenic
1202573024 Y:26292466-26292488 AGCAATCATCTCAATATATGGGG - Intergenic