ID: 1113307045

View in Genome Browser
Species Human (GRCh38)
Location 13:109090197-109090219
Sequence GTCTGCACATGGCTCTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113307045_1113307049 6 Left 1113307045 13:109090197-109090219 CCTTAGCAGAGCCATGTGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1113307049 13:109090226-109090248 GAGAACTGAGAAGCCTCATACGG 0: 1
1: 0
2: 2
3: 9
4: 169
1113307045_1113307050 7 Left 1113307045 13:109090197-109090219 CCTTAGCAGAGCCATGTGCAGAC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1113307050 13:109090227-109090249 AGAACTGAGAAGCCTCATACGGG 0: 1
1: 0
2: 3
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113307045 Original CRISPR GTCTGCACATGGCTCTGCTA AGG (reversed) Intronic