ID: 1113307486

View in Genome Browser
Species Human (GRCh38)
Location 13:109094090-109094112
Sequence CTCTGGGGGAACTGTAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113307486_1113307492 6 Left 1113307486 13:109094090-109094112 CCGGGACTACAGTTCCCCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1113307492 13:109094119-109094141 CAGCTTCCTCCCTCATTGTCAGG 0: 1
1: 1
2: 1
3: 26
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113307486 Original CRISPR CTCTGGGGGAACTGTAGTCC CGG (reversed) Intronic
901752397 1:11418711-11418733 CTCTGGGGGAGCAGGAGCCCTGG - Intergenic
903973489 1:27134276-27134298 CTGTGAGGAAACTGTAGCCCAGG - Intronic
905491201 1:38345251-38345273 CTCTGGGGAGACTGTTCTCCAGG - Intergenic
905866943 1:41381831-41381853 CACTCGGGGAGCTGTCGTCCGGG - Exonic
905882534 1:41474136-41474158 CTCAGGGGGACCTGCAGGCCAGG + Intergenic
908108044 1:60865939-60865961 CTCTGAGTGAATTCTAGTCCTGG + Intronic
908108914 1:60875186-60875208 CTCTGGGGGAAGCAGAGTCCTGG - Intronic
912761299 1:112369907-112369929 CTCAGGGAGAGCAGTAGTCCAGG - Intergenic
919313780 1:195946510-195946532 ATCTGGGGAAACAGCAGTCCAGG + Intergenic
923040681 1:230317971-230317993 CTCTGTGTGAACTGTGTTCCGGG - Intergenic
1063347231 10:5323384-5323406 CTCAGAGGGAACTGGAATCCCGG - Intergenic
1065425516 10:25598895-25598917 CTCTGGGAGAACTGGAGTCTTGG - Exonic
1067044802 10:42979388-42979410 CTCTGGGGCAAGTGGAGTCCTGG + Intergenic
1067761427 10:49050490-49050512 CTCAGTGGGAACTGTATTCTTGG - Intronic
1070829563 10:79410120-79410142 ATCTGGGGGAAGGGTATTCCTGG - Intronic
1074869667 10:117566849-117566871 CTCTGAGGGCACTGAGGTCCTGG + Intergenic
1075302284 10:121335621-121335643 ATCTGGGGGAAGCGTGGTCCAGG - Intergenic
1075632977 10:124012246-124012268 CTCTGGGGCAAATGCAGACCTGG - Intronic
1076113947 10:127882349-127882371 CTCTGGTCCACCTGTAGTCCTGG + Intronic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1077315441 11:1917549-1917571 CTCCTGGGGGACTGTAGACCTGG - Intergenic
1077486987 11:2843508-2843530 CTCCTGGGGAACTGCAGCCCAGG + Intronic
1078662452 11:13298318-13298340 CTCTGGGGGAAGAATGGTCCAGG - Intronic
1078969785 11:16394860-16394882 CTTTGGGGAATCTGTATTCCTGG - Intronic
1080873637 11:36258287-36258309 ATCTGGGGGAAGTGTATTCTAGG + Intergenic
1082874347 11:57972753-57972775 CTCTGGGGGAATCCCAGTCCTGG - Intergenic
1084415601 11:69031128-69031150 CTCTGGGGGAAAGGTGGGCCAGG + Intergenic
1085076844 11:73598632-73598654 CTCCCTGGGAACTGTAGTACCGG - Intergenic
1088619276 11:111665144-111665166 CTATGGGGCAAGTGTAGACCAGG + Intronic
1088763809 11:112957682-112957704 CCCTGGGGGAACAGTATTCATGG - Intergenic
1090977427 11:131689521-131689543 CTGTGGGGAAACTGAATTCCAGG - Intronic
1092239835 12:6829689-6829711 CTCTAGGGGATCTGCAGTTCGGG + Intronic
1092525568 12:9307539-9307561 CTCTGGGAGAAGTGTGATCCTGG - Intergenic
1092709903 12:11324964-11324986 CACTGGGGAAGCTGCAGTCCTGG + Intergenic
1093323403 12:17742066-17742088 CTCTGTGGGAACTGTGGGCAAGG + Intergenic
1094146055 12:27229536-27229558 CTCTGGGAGAAATGTATTCCAGG - Intergenic
1097036832 12:56129633-56129655 CTCTAGGGGACCTGTAGCCTAGG + Intronic
1097966826 12:65590419-65590441 CTCTGGGGGGACTGTGGTTGTGG - Intergenic
1102694496 12:114787578-114787600 CTCTGGCGGAACAGTATTCCGGG + Intergenic
1102883275 12:116502567-116502589 CTCGTGGGGAACTGAAGTGCTGG + Intergenic
1103145280 12:118590107-118590129 GTCTGGAGGAACTGTGTTCCAGG + Intergenic
1109197397 13:59393212-59393234 CTCAGGGGGATCTGAAGTCCAGG + Intergenic
1113307486 13:109094090-109094112 CTCTGGGGGAACTGTAGTCCCGG - Intronic
1118225428 14:63894598-63894620 CTCTGGGAGAACAGCAGTCCAGG - Intronic
1119038361 14:71249699-71249721 CATTGGGTGAACTGTAGGCCGGG + Intergenic
1121709715 14:96028588-96028610 CTCCTGTGGAACTGTGGTCCAGG + Intergenic
1121724793 14:96139397-96139419 CTCTGGGGAAAAAGAAGTCCTGG + Intergenic
1122218882 14:100222690-100222712 CTCTCTGGGAACTGGGGTCCTGG - Intergenic
1123091171 14:105742996-105743018 CTCTGGGGGCACAGCAGCCCTGG - Intergenic
1125533985 15:40432478-40432500 CTCTGGGGGGACTACAGTCTGGG - Intronic
1127456927 15:59163833-59163855 CTCTGTGGACACTGTAGGCCAGG + Intronic
1128110274 15:65071761-65071783 TTGGGAGGGAACTGTAGTCCCGG + Intronic
1129322499 15:74782696-74782718 CTCTTGGGGCACTGCGGTCCGGG - Exonic
1132544650 16:527699-527721 CCCTGTGGGAGCCGTAGTCCGGG + Intronic
1133236733 16:4390878-4390900 TTCTGGGGCAGCTGTGGTCCTGG - Intronic
1133771612 16:8869758-8869780 CTCCGGGGGCCCTGTTGTCCCGG - Intergenic
1135507924 16:23055167-23055189 ATCTGGGGGAAGAGTATTCCTGG + Intergenic
1135809395 16:25573946-25573968 CCCTGTGGGAACTGCAGCCCTGG - Intergenic
1141884323 16:86881322-86881344 ATGTGGGGGAACTGGAGCCCAGG - Intergenic
1142229680 16:88893968-88893990 CTCTGGGAGGCCTGAAGTCCTGG + Intronic
1144124518 17:12190063-12190085 CCCAGGGGGAACTGTACCCCTGG + Intergenic
1144438535 17:15261792-15261814 CTTTGGGGGAACTGAAGGCTGGG + Intronic
1144622110 17:16824289-16824311 CTCTGGGGAAATTGTAGGACTGG - Intergenic
1144884314 17:18448424-18448446 CTCTGGGGAAATTGTAGGACTGG + Intergenic
1145147917 17:20495953-20495975 CTCTGGGGAAATTGTAGGACTGG - Intergenic
1147574078 17:41588624-41588646 CTCTGGGGAAATTGTAGGGCTGG - Intergenic
1148334835 17:46834278-46834300 CTCAGGGGGAAGTGGTGTCCTGG + Intronic
1149577238 17:57722975-57722997 CCCTGGGTGAATTGTATTCCAGG + Intergenic
1150419586 17:65020327-65020349 CTCTGGGGGAAATGGAGACCTGG - Intronic
1152608405 17:81304184-81304206 CTGTGGGGCAACTGTCGTCGAGG - Intergenic
1153435897 18:5067493-5067515 CCCTCGGGGACCTGTGGTCCAGG + Intergenic
1155336991 18:24774831-24774853 CTATAGGTGAACTGTAGTTCAGG - Intergenic
1155461687 18:26090761-26090783 CTCTGGGGGACCCCTAGCCCTGG + Intronic
1157486981 18:48094884-48094906 CTCTGGGGAAACAGCAGTCAAGG + Intronic
1161177837 19:2858221-2858243 CTCTGGAGGAAATGTAGGGCTGG + Exonic
1161473646 19:4473161-4473183 CTCTGGGGGAATGGCGGTCCTGG + Intronic
1164780347 19:30886539-30886561 CACTGGGGCATCTGTATTCCAGG + Intergenic
1164841659 19:31397579-31397601 CTCTGGGGGAACTCCAGGCAGGG + Intergenic
1166341376 19:42139407-42139429 ATCTGGGGAAACTGAGGTCCAGG - Intronic
1166574121 19:43820684-43820706 ACCTGTGGGAATTGTAGTCCCGG + Intronic
1166621478 19:44305095-44305117 CATTCTGGGAACTGTAGTCCAGG - Intergenic
1166792328 19:45405541-45405563 TCCTGTGGGAATTGTAGTCCTGG + Intronic
1168011552 19:53537609-53537631 GTCTCTGGGAAATGTAGTCCGGG - Intronic
1168140251 19:54381138-54381160 CTCTGGGGGAAGAGTGTTCCAGG - Intergenic
1168676249 19:58279709-58279731 CTGTGGGAGAACTGCAGTGCAGG + Exonic
925194042 2:1908816-1908838 CTCTGGGGGCACTTCAGGCCAGG + Intronic
925347143 2:3179173-3179195 CTCTGTGGGCACTGTACTACGGG - Intergenic
926908418 2:17827330-17827352 CTCAAGGAGAGCTGTAGTCCTGG - Intergenic
927435044 2:23059518-23059540 CTGTGGGGCAGCTGAAGTCCTGG + Intergenic
927941632 2:27107048-27107070 CTCTGGAGCAACTCTAATCCAGG + Intronic
937070825 2:119061799-119061821 CGCTGGGGGAACTGAAACCCCGG + Intergenic
938950333 2:136249349-136249371 CTCAGGGAGAAGTGTAGCCCTGG + Intergenic
939173250 2:138720630-138720652 CTTTGAAGGAACTGTAATCCTGG + Intronic
939949055 2:148446467-148446489 CTGTGGAGTAACTGTGGTCCAGG + Intronic
944844465 2:203655051-203655073 GTCTGTGGCAACTGTACTCCAGG + Intergenic
945059913 2:205899881-205899903 CTCTGGGGGAATTATATTCTAGG + Intergenic
948321754 2:237075640-237075662 CTCTGGAGGAACTGGAGTTTGGG - Intergenic
1175218342 20:57403152-57403174 CCCTGGGGGCACAGTTGTCCTGG + Intronic
1175349229 20:58306891-58306913 CTCGCGGAGAACTGAAGTCCTGG + Intergenic
1178836717 21:36104770-36104792 CCCTGGGGGAAATGTAATCAAGG - Intergenic
1180022236 21:45135805-45135827 CTCTGTGGGTCCTGTGGTCCTGG + Intronic
1185367208 22:50442168-50442190 CTGTGGGGGAAGGGTAGTACAGG - Intronic
950855703 3:16102728-16102750 ATCTGGGGGAAGGGTATTCCAGG - Intergenic
950873747 3:16251491-16251513 CTCTGGGGGAGCTAGAGTCATGG - Intergenic
951044035 3:18018612-18018634 CTCTGGTGGAACTGAAGACATGG + Intronic
951728142 3:25782986-25783008 CTGCGGGTGAACTGGAGTCCCGG - Intronic
952882614 3:37994249-37994271 CTCTGGGGGACCTAGGGTCCGGG - Exonic
955639543 3:61067575-61067597 CTCTGGGGGGACTGGAGACTGGG - Intronic
955920017 3:63945853-63945875 GTCTGGGGGAACTGAGTTCCAGG + Intronic
961033044 3:123623163-123623185 CTCAGGGGAAACTGTAGTCTTGG - Intronic
961744749 3:129057370-129057392 CTCTGGGGGAAGGGCACTCCAGG + Intergenic
962090306 3:132237479-132237501 CTCTGTTGGCACTGTAGTCTAGG + Intronic
962285535 3:134082888-134082910 CTTTGTGGGAACTGGAGTCCTGG - Intronic
962285787 3:134084728-134084750 CTGTTTGGGAACTGGAGTCCTGG - Intronic
968626730 4:1629242-1629264 CTCTGTGGGCCCTGGAGTCCTGG - Intronic
969294266 4:6260231-6260253 TCCTGGGGAAAGTGTAGTCCTGG - Intergenic
969598066 4:8159907-8159929 CAGTGGGGGAGCTGAAGTCCTGG + Intergenic
970468280 4:16349627-16349649 CACTGGGGAAAGAGTAGTCCAGG - Intergenic
973000561 4:44943810-44943832 CTCTGGGAGAAAAGTATTCCAGG + Intergenic
973636167 4:52863175-52863197 CTTTGGGAGAACTGTTTTCCAGG + Intronic
978105343 4:104895475-104895497 CTCTGGGGTATATGCAGTCCTGG + Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
980264296 4:130495078-130495100 CTCTTGGGGAAATGTCTTCCAGG - Intergenic
980502044 4:133668701-133668723 CTCTGGGTCATCTGGAGTCCTGG + Intergenic
984413900 4:179432773-179432795 CCCTACGGGAACTGTAGTCTTGG + Intergenic
984806206 4:183754307-183754329 CTCTGTGGAAACGGTAGTCACGG + Intergenic
984970014 4:185179663-185179685 CACTGGGTTGACTGTAGTCCCGG + Intronic
987449582 5:18065089-18065111 ATCTGGGTGAACTGTAGCCAAGG - Intergenic
987710123 5:21494514-21494536 CTCTGGGGGAATTGGATTCAGGG + Intergenic
992583129 5:78202420-78202442 CTCATGGGGAACTGAAGTGCAGG + Intronic
994568491 5:101483513-101483535 CACTGGGGAAACTGAAGTTCTGG - Intergenic
995059270 5:107796086-107796108 ATCTGGGGGAAGAGTAGTCCAGG + Intergenic
995722393 5:115150768-115150790 CACTGGGGAAACTGAAGACCTGG + Intronic
997260608 5:132463140-132463162 CTATGGGGGCTCTGTGGTCCTGG + Exonic
997376038 5:133398283-133398305 CTCAGGGTCAGCTGTAGTCCTGG - Intronic
998547282 5:143040717-143040739 CTCTGGGAGAAGAGCAGTCCAGG + Intronic
1004126727 6:12881494-12881516 GTCTGGGGGAAGAGTATTCCAGG - Intronic
1005547561 6:26885998-26886020 CTCTGGGGGAATTGGATTCAGGG - Intergenic
1007359777 6:41346563-41346585 CTCTGGGAAAACTGTAACCCTGG + Intronic
1007696937 6:43740065-43740087 CTCTGGGGGTGCAGTAGTACAGG - Intergenic
1012629790 6:101450918-101450940 CTCTGAGGAAACTGAAGCCCAGG - Intronic
1013540750 6:111106067-111106089 TTCTGGGTGAACTGAAGTACTGG + Intronic
1016652174 6:146474887-146474909 CTCAGCAGAAACTGTAGTCCAGG - Intergenic
1018972079 6:168536726-168536748 CCCTGGGGGTACTGTGGACCTGG + Intronic
1019629562 7:2041089-2041111 CTCTGGGGGTGCTGTAGCTCAGG - Intronic
1029649685 7:101882813-101882835 CTCTGGGGTCACTGGAGGCCTGG + Intronic
1033445698 7:141420006-141420028 GTCTGGGGGAAGAGTATTCCAGG - Intronic
1035397498 7:158544803-158544825 GTCTGGGGCACCTGTTGTCCTGG + Intronic
1035660392 8:1343458-1343480 CTCTGAGGGAGCTGGAGACCAGG - Intergenic
1042318569 8:67451023-67451045 GTCACGGGAAACTGTAGTCCAGG - Intronic
1042758992 8:72251210-72251232 CTCCTGGACAACTGTAGTCCAGG - Intergenic
1044458619 8:92417993-92418015 CTCTGGGTGAAATGTTGTTCAGG - Intergenic
1047236828 8:123048980-123049002 CTCTGGGGGAAGTGTGTTCCAGG - Intronic
1047271935 8:123368767-123368789 CTCAGGGTTTACTGTAGTCCTGG - Intronic
1047897812 8:129385973-129385995 CTTTGGCGGCACTGTAGACCAGG + Intergenic
1049263628 8:141653283-141653305 CTCTGGGAGAATTGTGGTCTGGG + Intergenic
1051678571 9:19583267-19583289 CTCTGGGGGAAGAATACTCCAGG - Intronic
1059102182 9:111482782-111482804 CTTTGTGGGAAGTGTAGTTCCGG - Intronic
1059412277 9:114139850-114139872 CTCTGGGGCTTCTGTAGACCTGG - Intergenic
1062341082 9:136094346-136094368 CTCTGGGGGAAGTTTGGTCTTGG - Intronic
1062695706 9:137875306-137875328 CTCTGTGGAAACTGCTGTCCGGG + Intergenic
1190214440 X:48470301-48470323 CTGGGCGGGCACTGTAGTCCTGG + Intergenic
1191654919 X:63586052-63586074 CTCAGGGGAAACTGCAGTACGGG + Intergenic
1199022238 X:142895020-142895042 ATCTGGGGGAAATGTATTCCAGG - Intergenic
1199207760 X:145168702-145168724 CTCTGGGAGAAGTGTAGTAAGGG - Intergenic