ID: 1113309397

View in Genome Browser
Species Human (GRCh38)
Location 13:109116282-109116304
Sequence AAGGGCTTTGTAAGGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113309397_1113309404 9 Left 1113309397 13:109116282-109116304 CCCTCATACCTTACAAAGCCCTT 0: 1
1: 0
2: 1
3: 20
4: 166
Right 1113309404 13:109116314-109116336 TCAGCAGTGCAGATTTGCATAGG 0: 1
1: 1
2: 0
3: 13
4: 123
1113309397_1113309405 30 Left 1113309397 13:109116282-109116304 CCCTCATACCTTACAAAGCCCTT 0: 1
1: 0
2: 1
3: 20
4: 166
Right 1113309405 13:109116335-109116357 GGCTACATGAAAAACCCACCAGG 0: 1
1: 0
2: 1
3: 19
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113309397 Original CRISPR AAGGGCTTTGTAAGGTATGA GGG (reversed) Intronic
902710044 1:18232918-18232940 GGGGGCTTTGTTAAGTATGAAGG + Intronic
904488243 1:30841863-30841885 AAGGGCTTTGAAAAGTATGCGGG - Intergenic
908659102 1:66418934-66418956 AAGGGCTTGGAAAGTTAAGATGG + Intergenic
909091362 1:71229850-71229872 AAGGGCTATATAATTTATGAGGG - Intergenic
910400267 1:86831221-86831243 AATGGCTTTTTGAGGAATGAAGG - Intergenic
910884569 1:91951240-91951262 AAGGGGTTTGTATAGCATGAAGG + Intronic
912331374 1:108823128-108823150 AAGGACTTTGAAAGTTATTAAGG - Intronic
912830957 1:112953524-112953546 AAGGGATTTTTAAGGGATAAAGG - Intronic
913935230 1:125034133-125034155 AAGAGCTTTGAGAGCTATGATGG + Intergenic
915966398 1:160312494-160312516 AAGGGTTTTCTAAGGGATGATGG - Intronic
916522509 1:165577560-165577582 AAGGGATTTCTGAGGGATGATGG + Intergenic
917421056 1:174864184-174864206 AAGGGTTTTCTAAGGTTTGAGGG + Intronic
918286203 1:183057326-183057348 AAGGGAGTGGTAAGGAATGAGGG - Intronic
919021268 1:192108804-192108826 AAGGGCTTTGAAAAGCATAAAGG - Intergenic
919026770 1:192181850-192181872 AAGGGCTAGGTAAGGTAGGAAGG - Intronic
919144644 1:193618252-193618274 AGAGGCTGTGAAAGGTATGAAGG - Intergenic
922618712 1:226978024-226978046 AAGGGGTGTGTAAGGTCTGTGGG - Intronic
924002925 1:239573897-239573919 AATAACTTTCTAAGGTATGATGG - Intronic
924402012 1:243693302-243693324 AAGGTATTTCTAAGGTATGTTGG - Intronic
924645781 1:245876246-245876268 AAGGGCCTAGTAAGGTAAGGTGG + Intronic
1063374496 10:5545998-5546020 AAGGGCTTTGCAGGGGAAGAGGG - Intergenic
1064892374 10:20191843-20191865 AGGGGCTTTGTAAGAAAGGACGG + Intronic
1066334703 10:34463412-34463434 AGGGGTTTTGAAAGGAATGAAGG + Intronic
1066444924 10:35473531-35473553 AGGGGCTTTGTGAGGGGTGAGGG + Intronic
1067061106 10:43078306-43078328 AAGCCCTTTGTAAGGAGTGAGGG - Intronic
1070194115 10:74140354-74140376 AAGGGCTTGCAAAGGTATGTAGG - Intronic
1070435742 10:76390855-76390877 AAGATTTTTGGAAGGTATGAAGG + Intronic
1071940962 10:90591401-90591423 AAGGACTTTGTAAAGTAAGTAGG - Intergenic
1072441258 10:95457677-95457699 AAGGGCATTGCCAGGAATGAAGG + Intronic
1075237514 10:120744324-120744346 AAAGGCTCTGTAAACTATGAAGG + Intergenic
1075773755 10:124964788-124964810 AAGGGCTTTGATAGGTCTGAAGG + Intronic
1076322598 10:129594551-129594573 AAGGGCTTTGGATGGAATGAAGG + Intronic
1077351792 11:2096563-2096585 AAGGACTTTGGGAGGTGTGAGGG - Intergenic
1079025597 11:16945508-16945530 TAGTGCTTGGTAAGGGATGATGG + Intronic
1079251935 11:18792934-18792956 AAGGGCTTTGCAGGTCATGAGGG - Intergenic
1079492167 11:21001226-21001248 AAGTGGTTGGAAAGGTATGAGGG + Intronic
1080525163 11:33108964-33108986 AAGGTCATTGTAAGATATTATGG + Intronic
1080928052 11:36778710-36778732 AAGGAGTTTGAAAGGTGTGATGG + Intergenic
1081713017 11:45230022-45230044 AAGGGATTGGTAGGGGATGAAGG - Intronic
1081880503 11:46446480-46446502 AAGGGATTTCTAAGGTTTCAAGG + Intronic
1083410980 11:62492146-62492168 AAGGGCTTTGCAAGGACAGAAGG + Intronic
1085200565 11:74699357-74699379 AAGGGCTGTGGCAGGTCTGAGGG + Intronic
1087940707 11:104093607-104093629 AGGGGGTTTGAAAAGTATGAGGG - Intronic
1088295988 11:108295389-108295411 AAGGTCATAGTAAGTTATGATGG - Intronic
1089526089 11:119097709-119097731 ATGTGCTTTGTAAGTTATAAAGG + Intronic
1089618412 11:119708374-119708396 AAGGGCTTTGTATTAGATGAGGG + Intronic
1092141754 12:6188799-6188821 AAGTGCTTTGTAAACTATAAGGG - Intergenic
1093064536 12:14643020-14643042 AACGGATTTGTAAAGTATAAAGG - Intronic
1094148847 12:27259564-27259586 AAGGTCTTTGTAAACTGTGAGGG + Intronic
1095632988 12:44399828-44399850 AAGTGCTTTGTAAGGGATCTGGG - Intergenic
1096498228 12:52050907-52050929 AAGGGCTTGGGAAGGTGTAAAGG + Intronic
1098354907 12:69603302-69603324 AAGGGCTTTGAAATATATGAAGG - Intergenic
1100787885 12:98097814-98097836 AAGGGGTTTGTAATCTATAATGG - Intergenic
1103014585 12:117484156-117484178 AGGGGCTTTGAAAGGTCTGGGGG + Intronic
1103890913 12:124238525-124238547 AAGGGTTTTGTAGGGAAAGAGGG - Intronic
1106461656 13:29975732-29975754 AAAGGCTGTGTAAGATAAGAAGG - Intergenic
1107712717 13:43166495-43166517 AAGGGCTTTGTAACAGAGGATGG + Intergenic
1113050932 13:106211108-106211130 AAGGGCTTTGAAAAGTTTAATGG + Intergenic
1113309397 13:109116282-109116304 AAGGGCTTTGTAAGGTATGAGGG - Intronic
1113309506 13:109116964-109116986 AAGGGCTTTATAAGTTACAATGG + Intronic
1118810326 14:69268485-69268507 AAGGGCCGTGTGAGGTAGGAGGG + Intronic
1120667572 14:87324858-87324880 AAGGGCTTTCAAAGGTGTTATGG - Intergenic
1120860300 14:89249289-89249311 AAGGGCTTTGGAAAGGAGGATGG - Intronic
1124014871 15:25865667-25865689 GAGGGCTTTGGAAGGGATGAGGG + Intergenic
1125867926 15:43071244-43071266 AAAGTCTTTGTAAGCTATAAGGG - Intronic
1126320331 15:47415541-47415563 AAGGACTTTCTGAGGTGTGAAGG - Intronic
1126383597 15:48072057-48072079 AAGTACTTTGTAAGCTGTGATGG - Intergenic
1126421685 15:48480325-48480347 TAGGACTTGGTAAGGGATGATGG - Intronic
1127951136 15:63807372-63807394 AATGGCTTTGTGAGGTGGGAAGG - Intronic
1133816396 16:9200607-9200629 AAGGGCTCTGTAAGTTAAAAAGG + Intergenic
1133919975 16:10143632-10143654 AGGGGGTTGGTAAGGTATTAGGG + Intronic
1135517059 16:23144976-23144998 AAGGGCTTCGTGAGCTATGCTGG - Intronic
1137816609 16:51404083-51404105 AAGGGCTTTGTAAACCATGAAGG + Intergenic
1142342204 16:89531061-89531083 CAGAGCTTTGCAAGGGATGAAGG - Intronic
1148435108 17:47677913-47677935 AAAGGTTTTGTAAGCTATAAAGG + Intronic
1148999459 17:51742141-51742163 AGGGGCTTGGGAAGCTATGATGG + Intronic
1149783304 17:59415265-59415287 AAGGGCCTTGTAAGGTGTTTAGG + Intergenic
1151020472 17:70610910-70610932 AAGGGATTTGCCAGATATGAAGG + Intergenic
1155391873 18:25347404-25347426 TAGGGCTTTGAAAGGCAGGAGGG + Intronic
1156821311 18:41376308-41376330 AGGAGATTTGTGAGGTATGATGG + Intergenic
1157296243 18:46447356-46447378 AAGGACTCTGAAAGGTCTGAAGG - Intronic
1161720563 19:5900027-5900049 AAGGACTTTGGAAGGGATGGAGG - Intronic
1163058359 19:14739770-14739792 AAGGTCTTTATAAAGTATGAAGG + Intronic
1164015841 19:21255332-21255354 AAAGGCTTTGTGAGGTATATAGG + Intronic
927060867 2:19417938-19417960 AAGTGCTTTGTAAGTTGTAAAGG - Intergenic
927342196 2:21995328-21995350 AATAACTTTGTAAGCTATGAAGG + Intergenic
927468641 2:23355738-23355760 AAGGTCTTTGTAAGTATTGAAGG - Intergenic
929901421 2:46006945-46006967 AAGGTTTTTAGAAGGTATGAAGG + Intronic
930158218 2:48127099-48127121 TAGGGCTATATAAGGTGTGAAGG + Intergenic
930177941 2:48319171-48319193 AAGTGCTTTGAAAGGTGTGTTGG + Intronic
932875940 2:75452090-75452112 AAGTGCTTAGTAAAGAATGAAGG - Intergenic
936315277 2:111419416-111419438 AAGTGCTTTGGAAGGTTTGGAGG - Intergenic
936333371 2:111567502-111567524 ATGGGCATTGTCAGGGATGATGG + Intergenic
937969783 2:127540608-127540630 AAGGGCTTTTTCTGGAATGAAGG + Intronic
940153242 2:150626024-150626046 AAGTGCTTTGTAAGCTAGGAGGG - Intergenic
941039249 2:160601849-160601871 AAGGGCTTTGTAAGCCATTTCGG - Intergenic
942626521 2:177906720-177906742 ACAGACTTTCTAAGGTATGAGGG - Intronic
943539873 2:189199454-189199476 AAGAGCTTTCAAAAGTATGATGG - Intergenic
946604356 2:221386681-221386703 AAGGGCTAGTTAAGGTAGGAAGG - Intergenic
1170812414 20:19684875-19684897 AAGGGATTTGCAAGTTCTGATGG + Intronic
1171036714 20:21718335-21718357 AAGGGCATTTGAAGGTGTGAGGG + Intronic
1171213973 20:23338534-23338556 AAGGGCTTTTCAAGCAATGAGGG + Intergenic
1172533294 20:35649927-35649949 ATTTGCTTTGTATGGTATGAAGG - Exonic
1175652816 20:60742169-60742191 TATGGCTTTATAAGGTATTAAGG - Intergenic
1176667733 21:9703163-9703185 AAGTGCTTGGTAAGGTAAAATGG - Intergenic
1181181178 22:21069661-21069683 AAGGGCTTAGTGAGGTTTGTGGG + Intergenic
950177707 3:10886838-10886860 AAGGGCTTTGTTAGGTCATAGGG - Intronic
955939135 3:64131280-64131302 AAGGGATTTTTGAGGTAGGATGG + Intronic
957349507 3:79004882-79004904 AAGGTCTTTGTAAGGAAATAAGG + Intronic
961052275 3:123756986-123757008 AAGGCCTTTAAAAGGAATGAGGG + Intronic
962476716 3:135761363-135761385 AAGGGCTTTGAACTATATGATGG + Intergenic
964455581 3:156862116-156862138 AAGGGCTTTCAAAGTTATGCTGG - Intronic
964509070 3:157430318-157430340 AAGGGATGTGTAGAGTATGATGG - Intronic
965499779 3:169443583-169443605 AAGGGCTTTTCATGGAATGATGG - Intronic
965746713 3:171934048-171934070 AAGCCCTTTGTAAGCTATTATGG + Intronic
965891622 3:173521012-173521034 AAGGAGTTTGTAAGGCATTATGG + Intronic
969599153 4:8165692-8165714 AAGCACTTTGTAAGTTATGCAGG - Intergenic
970501978 4:16687254-16687276 AAGGGCTTTGGAAGGTAATAAGG + Intronic
971513804 4:27461887-27461909 AAAGGCTGGGAAAGGTATGAGGG - Intergenic
976090709 4:81454459-81454481 AAGGGCTTTTTCTTGTATGAAGG - Intronic
977802298 4:101250017-101250039 AAACGCTGTATAAGGTATGATGG + Intronic
978775924 4:112506822-112506844 ATCTGCTTTGTAAGGTATTATGG + Intergenic
980201774 4:129664916-129664938 AAGGATTCTGTAAGGTCTGAAGG + Intergenic
983674221 4:170273223-170273245 AAGAGCCTTGCAAGGAATGATGG + Intergenic
985407071 4:189648431-189648453 AAGTGCTTGGTAAGGTAAGATGG + Intergenic
991038118 5:62148801-62148823 AAGGGCTTTGAGAGGTATAGAGG - Intergenic
992466008 5:77005518-77005540 AAAGGCTTTGAATGTTATGATGG - Intergenic
994747855 5:103701376-103701398 AGGGGCTTTGTAAGGTAACTAGG + Intergenic
995247232 5:109948128-109948150 ACGGGCTATGAAAGGTAGGAAGG - Intergenic
998673171 5:144376771-144376793 AAGGGCTTTGTCATGTTTTAAGG + Intronic
999182509 5:149680125-149680147 AAGTGCTTTGTAACATATTAAGG + Intergenic
999613226 5:153393876-153393898 AAGGACCCTATAAGGTATGAAGG + Intergenic
1000130555 5:158293511-158293533 AAGGGCTAGATAAGGTAAGATGG + Intergenic
1002335748 5:178477082-178477104 AGGGGCTCTGTAAGCAATGACGG + Intronic
1002444711 5:179282785-179282807 AAGGGCTTGGTCAGGCATGGTGG + Intronic
1003757478 6:9137847-9137869 AAAGGCTTTGCAAGGTGTGAAGG - Intergenic
1004603460 6:17172945-17172967 AAGGGCTCTGCAAGATCTGAGGG + Intergenic
1005636749 6:27760105-27760127 TAGGGCTTTCTAAGGGATGCAGG - Intergenic
1006945300 6:37780446-37780468 AAGGGCTTTGGAAGGCAGGCAGG + Intergenic
1007267156 6:40605283-40605305 AAGGGCTTTATCAGGAAAGAAGG - Intergenic
1007695315 6:43728678-43728700 GAGGACTTTGTAAGCTATAAAGG + Intergenic
1009732419 6:67625999-67626021 AAGGGGTTTGGAAGGTATATTGG - Intergenic
1009785579 6:68333970-68333992 TAGGGCTTTGTCAAGTATGCAGG - Intergenic
1010382419 6:75240276-75240298 AAGGCCTTTGGAATGTTTGAAGG - Intronic
1012701734 6:102466262-102466284 AAGGGCTATGTAAAAGATGATGG - Intergenic
1018531545 6:164769173-164769195 AATGACTTTTTAAGGTGTGATGG + Intergenic
1019622155 7:1997826-1997848 AAGGGCTTTGCATGGCAAGAGGG + Intronic
1022230378 7:28408286-28408308 AAGCGCTTTGTAAGGTGTGAGGG + Intronic
1023023828 7:36033955-36033977 AAGGGCTTTGTAGGCTTTGCTGG + Intergenic
1023605273 7:41925520-41925542 AAAGGCTTGGTAAAGTGTGAGGG - Intergenic
1024537325 7:50448756-50448778 AATGTCTTTGTAAGGCATTATGG - Exonic
1024565710 7:50678418-50678440 AATGGCTCTGGAAAGTATGAAGG - Intronic
1026297894 7:69071429-69071451 GAGTGCTTTGTAAGAAATGAAGG + Intergenic
1027567391 7:79813634-79813656 AAGGGCTTTTTAAACTATAAGGG - Intergenic
1034419755 7:150983463-150983485 AAGGGCTTTCTCAGGTACAAAGG + Intergenic
1038430265 8:27494256-27494278 AAGGGCTTGGAAAGTTAAGATGG + Intronic
1039656212 8:39411128-39411150 AAGGCATTAGTAAGGCATGATGG + Intergenic
1039796224 8:40917866-40917888 AAGGGCTTTGAAAGGCAGGGAGG + Intergenic
1040766887 8:50922170-50922192 AAGGCATTTATAAGGTATGGTGG + Intergenic
1041330345 8:56717323-56717345 AAGCACTTTGTAAACTATGAAGG + Intergenic
1041567096 8:59291046-59291068 AAAGGCTGTGTAAAGTATAAGGG + Intergenic
1042420701 8:68585313-68585335 AAAAGCTTTGAAAGGTAGGAAGG + Intronic
1042501098 8:69510175-69510197 AAAGGCTTCCTAAGGTAGGAAGG - Intronic
1045966202 8:108027858-108027880 AAGGTTTTTGAAAGGTATGAAGG - Intronic
1047213887 8:122861816-122861838 AAGCTCTTTCTAAGCTATGAAGG + Intronic
1050214307 9:3305362-3305384 AAGGGTTTTGCTAGGTATAATGG + Intronic
1053049276 9:34945336-34945358 AAGAGCTTTGGAAGGGGTGAGGG + Intergenic
1055087852 9:72332506-72332528 AATCCCTTTGTAAGGAATGAGGG - Intergenic
1055800033 9:80024795-80024817 AATACCTTTGTAAGGTAAGATGG - Intergenic
1055967452 9:81879541-81879563 AATGGCTTTGTAAACTATGAAGG - Intergenic
1056497616 9:87175463-87175485 AAGGGCTTTGTAAGAAGTGGTGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1058199406 9:102019973-102019995 AAGGGCATACTAAGGAATGATGG + Intergenic
1059906196 9:118989677-118989699 AAGGGCTGGGGAAGGTCTGATGG + Intergenic
1060229730 9:121817904-121817926 AAGTGCTTTGTAAACTGTGAAGG + Intergenic
1060284959 9:122242720-122242742 AAGGTTTTAGTAAGCTATGATGG - Intronic
1203658081 Un_KI270753v1:17536-17558 AAGTGCTTGGTAAGGTAAAATGG + Intergenic
1193393137 X:80953025-80953047 AAGTGCTTAGTAAGTTATGATGG + Intergenic
1194840464 X:98734336-98734358 CAGTGTTTTGTAAGGTATGAAGG + Intergenic
1198133534 X:133724023-133724045 AAGTGCTTTGTAAAGAATAAAGG - Intronic
1199004965 X:142685062-142685084 ATCTGCTTTGAAAGGTATGAGGG - Intergenic
1199603119 X:149554991-149555013 AAGGGCTTGGAAATGTAAGAAGG - Intergenic
1199647269 X:149924484-149924506 AAGGGCTTGGAAATGTAAGAAGG + Intergenic
1199688283 X:150284214-150284236 AAGGGCTTTGGGAGGTATTTAGG - Intergenic
1201284751 Y:12369463-12369485 ACAGGCTGTGTAAGGAATGAAGG - Intergenic
1201455817 Y:14165991-14166013 AAGGGCTTGGAAAGTTAAGATGG - Intergenic
1201755369 Y:17481178-17481200 AAGGGCCTTGAAAGGTATAAAGG - Intergenic
1201846183 Y:18424807-18424829 AAGGGCCTTGAAAGGTATAAAGG + Intergenic