ID: 1113313477

View in Genome Browser
Species Human (GRCh38)
Location 13:109154982-109155004
Sequence ATTCTGTCCCTGCCATAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113313477_1113313483 17 Left 1113313477 13:109154982-109155004 CCCCTTTATGGCAGGGACAGAAT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1113313483 13:109155022-109155044 TTCAGTTAGTTAAATTTAAAAGG 0: 1
1: 0
2: 2
3: 46
4: 497
1113313477_1113313482 -7 Left 1113313477 13:109154982-109155004 CCCCTTTATGGCAGGGACAGAAT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1113313482 13:109154998-109155020 ACAGAATAAATGGGCAAAAAAGG 0: 1
1: 0
2: 3
3: 77
4: 701
1113313477_1113313484 24 Left 1113313477 13:109154982-109155004 CCCCTTTATGGCAGGGACAGAAT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1113313484 13:109155029-109155051 AGTTAAATTTAAAAGGAAATTGG 0: 1
1: 0
2: 7
3: 102
4: 1016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113313477 Original CRISPR ATTCTGTCCCTGCCATAAAG GGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
903002255 1:20274511-20274533 ATTATGCCCCTGCCATGGAGAGG - Intergenic
903002362 1:20275383-20275405 ATTCTCTCCCTCCCCTAAAGAGG + Intergenic
906247757 1:44289163-44289185 ATTATGTCCAGGCCATAAAAAGG + Intronic
907702030 1:56798019-56798041 ATACTGGCCCTGTCTTAAAGGGG - Intronic
909481829 1:76134463-76134485 ATTCTGTCACTGCCATGCTGTGG + Intronic
910571013 1:88702863-88702885 ATTCTGTTCCTTGCTTAAAGAGG + Intronic
911207477 1:95106525-95106547 ATTCTGTCTCTACCAAAAATTGG + Intergenic
911926025 1:103834113-103834135 ACTGTGTCCCTGCCAAGAAGTGG - Intergenic
917525820 1:175787676-175787698 ATTCTGTCCCTGCCATCACCAGG + Intergenic
918017283 1:180648292-180648314 GGTCTGTCTCTGCCATTAAGTGG + Intronic
919087112 1:192933558-192933580 AATCAGTCCCTGCCCTAAAGAGG + Intergenic
919854638 1:201696856-201696878 ATTCTGTCCTTGCAATGCAGCGG - Intronic
921573534 1:216806890-216806912 ATTCTGTCTCTACCATATTGAGG - Intronic
921589296 1:216985072-216985094 AAGCTGCACCTGCCATAAAGGGG - Intronic
1064213215 10:13378198-13378220 ATTCTGTTCCTGTCAGGAAGTGG + Intergenic
1068203510 10:53815575-53815597 ATTCTGTCTTTGCTAAAAAGAGG - Intronic
1068626490 10:59254391-59254413 ATTCTGTATCGGTCATAAAGCGG + Exonic
1069297398 10:66863342-66863364 AGTCTGACCATGCCATATAGCGG - Intronic
1069552227 10:69372494-69372516 CGTCTTTCCCTGCCACAAAGAGG - Intronic
1073475884 10:103753161-103753183 TTTATGTCCTTGCCACAAAGTGG - Intronic
1074848502 10:117420134-117420156 GTTCTGTCCCTGCCATCTGGTGG - Intergenic
1075472207 10:122699572-122699594 AGTCTGTCCATGTCAGAAAGAGG - Intronic
1080918407 11:36683854-36683876 TTTCTGTCCTTGCCATAACATGG - Intergenic
1081330679 11:41796117-41796139 AGTCTCTCCCTGCCATGTAGAGG - Intergenic
1081691654 11:45082423-45082445 CTTCTGTCCCTGCCATGCCGGGG - Intergenic
1081703005 11:45163743-45163765 ATTCTGTCCCTCCCATAAGAAGG + Intronic
1084242647 11:67833089-67833111 CTTCTGTCCTTGCAATAAGGCGG - Intergenic
1087189225 11:95234750-95234772 ACTCTATCCCTGCCTTCAAGGGG - Intergenic
1089181475 11:116586206-116586228 CTTCTGCCCCAGCCATAAAAAGG - Intergenic
1092728347 12:11506063-11506085 TTTGTGTCCCTGCCAGAAAATGG - Intergenic
1096232948 12:49907021-49907043 ATTCTGTCTCTACCAAAAATAGG - Intergenic
1096828716 12:54298560-54298582 ATTCAGTCCCTTCCATTAAATGG + Intronic
1098029287 12:66237586-66237608 GTTCTGGCCCTGCTATTAAGCGG + Intronic
1099322036 12:81162602-81162624 AGGCTGTCCCTGCCTTGAAGGGG + Intronic
1101032727 12:100676266-100676288 ACTGGGTCCCTCCCATAAAGTGG - Intergenic
1101259954 12:103019001-103019023 ATTCTCTTCCTGCCATGAATGGG - Intergenic
1101778964 12:107818448-107818470 AGTCTGTTGCTGCCATAAGGGGG - Intergenic
1103583558 12:121934409-121934431 ATTCTGTCACTGTCACACAGTGG - Intronic
1104028636 12:125048377-125048399 ATCCAGGCCCTGCCCTAAAGAGG + Intergenic
1106188522 13:27429050-27429072 ATTCTGTCCCTGCAGTTAGGGGG + Intronic
1110430731 13:75420082-75420104 ATTCTGTCTCTGCCAAAATGTGG - Intronic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1114913437 14:27230736-27230758 ATTCTGACTCTGCCATATACTGG - Intergenic
1119099755 14:71868932-71868954 AGTCTGTCCCTGGAAGAAAGGGG - Intergenic
1119637314 14:76285429-76285451 ATTGTGTCCCTGCAGTGAAGTGG - Intergenic
1120080474 14:80210891-80210913 ATTCTGCTCTTGCCATAAACTGG - Intronic
1130630655 15:85565511-85565533 CTTGTGTTTCTGCCATAAAGAGG - Intronic
1131160191 15:90100685-90100707 ATTCTTTCCTTGTCATCAAGGGG + Intronic
1133181594 16:4058784-4058806 ATTCTGTCCTTGCCAGGAAAGGG + Intronic
1134327280 16:13218555-13218577 ACTCTGTCACTGCCAATAAGTGG - Intronic
1134470102 16:14517168-14517190 TTTCTGCTCCTGCCATCAAGAGG + Intronic
1135384484 16:22024757-22024779 CATATGTCCCTGCCATAAATAGG - Intronic
1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG + Intronic
1136986354 16:35109077-35109099 AGTCTGTTCCTGTCATAGAGGGG - Intergenic
1137457009 16:48625012-48625034 ATCCTGTCCCTGCCATTTACTGG - Intergenic
1139219058 16:65160420-65160442 AATGTGTGCATGCCATAAAGAGG - Intergenic
1139393202 16:66619148-66619170 ATGTTTTCCCTGCCTTAAAGAGG - Intronic
1140971840 16:80020844-80020866 ATTCTGTACCTGCAACAGAGTGG + Intergenic
1147625343 17:41896483-41896505 TTTCTGTCCCTGCCTTGATGTGG - Intronic
1149310757 17:55391019-55391041 ACTCTGTCCCTGCCTGAAGGAGG + Intergenic
1149391902 17:56200348-56200370 ATTCTGACTCTGCCATGAATTGG + Intronic
1149428098 17:56574718-56574740 AATCAGTCCCTGCCCTTAAGGGG + Intergenic
1154461837 18:14597727-14597749 CTTCAGTCCCTGGTATAAAGTGG + Intergenic
1155506877 18:26542064-26542086 ATTCAGTCCTTGCCCTCAAGAGG - Intronic
1155567602 18:27153371-27153393 ATTCTGTCCTTGCCTCCAAGGGG - Intronic
1156067207 18:33158189-33158211 TTTCTGTGCCTTCCCTAAAGGGG + Intronic
1156199010 18:34808779-34808801 CTTCTTTCACTGCCCTAAAGAGG - Intronic
1157046157 18:44104007-44104029 AGCCTGTCCCTGACATTAAGAGG - Intergenic
1159305488 18:66636469-66636491 ACTCTGTCCCTCCCATAACGTGG + Intergenic
1160355447 18:78224467-78224489 ATTCCTTGCCTGCCATGAAGAGG + Intergenic
1161916820 19:7234562-7234584 ATCCAGTCCCTGACATAAAATGG - Intronic
1161955079 19:7489145-7489167 ACTCTGTCCCTCCCCTACAGCGG - Intronic
1163204243 19:15790608-15790630 GTTGTGTCCCTGCTATAGAGGGG + Intergenic
1166453581 19:42921151-42921173 ATTGTTAACCTGCCATAAAGAGG - Intronic
1168488807 19:56789914-56789936 ACTCTGTCCCTGCAGAAAAGAGG - Exonic
925986011 2:9215744-9215766 ATACTGTCCTTGCCATGAATTGG + Intronic
927574397 2:24189523-24189545 ATGCAGTCCCTGCCCTCAAGGGG - Intronic
929204011 2:39269403-39269425 ATTCAGTCCCTCCAATAAAGAGG + Intronic
929407216 2:41656551-41656573 CTGCTGTCCTTGCGATAAAGAGG + Intergenic
929694545 2:44103009-44103031 ATGCTGTCCCTGTGATACAGTGG + Intergenic
930407390 2:50976241-50976263 ATTCTGTCTCTGCAACTAAGTGG + Intronic
930430309 2:51266968-51266990 TTTCTGTCTCTGCAATAAATAGG - Intergenic
930919002 2:56728228-56728250 ACTCTGTCCCTGCCATGAGCAGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
933454276 2:82501703-82501725 ATTTTGCCCCTGCCCTAGAGAGG + Intergenic
934136756 2:89002965-89002987 TTTCTGTCCCTACTACAAAGAGG - Intergenic
935117650 2:100150636-100150658 ATTCTGTCTCTGACATATTGTGG + Intergenic
936868145 2:117100741-117100763 ATTCTGTCCCAGCCACAGTGAGG + Intergenic
937193252 2:120125292-120125314 ATTCTTGCCCTGCCAAACAGTGG + Intronic
937460577 2:122082227-122082249 ATTCTGTCCTTACCATCAATCGG + Intergenic
939060631 2:137417830-137417852 ATTCAGTCCCTTCCATGAACTGG - Intronic
940100907 2:150037237-150037259 GTTTTGTTCCTGCCATAATGTGG - Intergenic
941448165 2:165627253-165627275 TTACTGTACCTGCTATAAAGAGG - Intronic
941785589 2:169495097-169495119 ATACAGTTCCTGCCATCAAGGGG + Intronic
941890071 2:170571239-170571261 ATTCTGTACCTGCCCTCAGGTGG + Intronic
942846730 2:180435653-180435675 TTTCTGTCTCTGTCATAATGTGG - Intergenic
944360353 2:198847507-198847529 ATACTGTCCCTGCCCTAATTGGG + Intergenic
948633352 2:239316724-239316746 ATTCTTTCCGTGCAAGAAAGTGG + Intronic
948732939 2:239978609-239978631 CTTCTGTCCCTCCCACCAAGTGG + Intronic
949012350 2:241687944-241687966 AAACTGTCTCTGCCATAGAGAGG + Intergenic
1168895965 20:1323674-1323696 CTTATGTCCCTTACATAAAGTGG + Intronic
1172987212 20:39001217-39001239 ACACTATCCCTGCCATCAAGTGG + Intronic
1174453038 20:50631346-50631368 AATCTGACCCAGCCATGAAGAGG + Intronic
1176663119 21:9659444-9659466 ATTCAGTGCCTCCCATCAAGCGG + Intergenic
1176812718 21:13560863-13560885 CTTCAGTCCCTGGTATAAAGTGG - Intergenic
1183464642 22:37973490-37973512 ACACTGTCCCGGCCCTAAAGGGG - Exonic
949870722 3:8585712-8585734 TTGCTGTCCCTCCCATCAAGAGG + Intergenic
950077254 3:10195921-10195943 AGTCTCTCCCTGCCAGAGAGGGG + Intronic
950186158 3:10946962-10946984 ATCCTTTCCTTGCCATCAAGAGG + Intergenic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
952948967 3:38502803-38502825 ATGATTTCCCTGCCAAAAAGTGG + Intronic
955779457 3:62468811-62468833 ATTCTGTCTCTCCCATCCAGGGG + Intronic
956358705 3:68422284-68422306 ACTCTGTAAATGCCATAAAGTGG - Intronic
956652699 3:71519900-71519922 ATGCAGTCCCTCCCATAAAGGGG + Intronic
960326814 3:116306791-116306813 TTTATGTCCCAGCAATAAAGGGG + Intronic
962595590 3:136940344-136940366 GTTCTGTCCCTTACAGAAAGTGG + Intronic
963361763 3:144282648-144282670 TTTCTGCCCCTCCCTTAAAGGGG - Intergenic
963575802 3:147059552-147059574 ATACTTTCCCTGCCCCAAAGTGG + Intergenic
966258018 3:177941408-177941430 ATACTTTCCCTGACATAAAGGGG - Intergenic
966817158 3:183898657-183898679 ATTCTGTCCTTGGCAGAAATTGG - Intergenic
968597913 4:1494884-1494906 TTTCTGCCCCTGCCATCAACAGG + Intergenic
976310292 4:83604894-83604916 GTTCTGCCTCTGGCATAAAGAGG - Exonic
976935448 4:90625646-90625668 ATTCTGTCACTGACTTTAAGAGG - Intronic
977045733 4:92066798-92066820 ATTGTGCCCCTGCCCTAGAGAGG + Intergenic
978292366 4:107156969-107156991 AACCTATCCCTGCCATTAAGTGG + Intronic
982906269 4:161078119-161078141 ATTCTGGCCCTGCCACAGATCGG + Intergenic
985412202 4:189696596-189696618 ATTCAGTGCCTCCCATCAAGCGG - Intergenic
987005730 5:13707391-13707413 CCTCTGTCCTTGCGATAAAGAGG + Intronic
993694284 5:91041683-91041705 GTTCAGTTTCTGCCATAAAGAGG - Intronic
995697570 5:114897723-114897745 ATTCTGTGCCTGAAAGAAAGAGG - Intergenic
997563367 5:134867998-134868020 ATTCTGCACCTGGCATAATGAGG - Intergenic
1000734567 5:164882861-164882883 ATTCAGTGCCTCCCATAAGGTGG + Intergenic
1003623094 6:7719547-7719569 ATGCTGACCATGCCAAAAAGTGG - Intergenic
1005071997 6:21870562-21870584 CTTCAGTCCCTGCCTCAAAGAGG - Intergenic
1005766626 6:29017294-29017316 ATTTTGTCACTGCCACAAGGTGG - Intergenic
1008571365 6:52820336-52820358 ATTTGGTCTCTGCCCTAAAGTGG + Intergenic
1008735706 6:54541276-54541298 AATCTGCCCCTGCCATATACAGG - Intergenic
1009675815 6:66819212-66819234 ATTCAGTGCCTGTTATAAAGTGG - Intergenic
1011149620 6:84255996-84256018 ATTCTGTGTCTGATATAAAGTGG - Intergenic
1011530252 6:88312994-88313016 ATTCTGTGCCTGACTTCAAGGGG - Intergenic
1013635789 6:112027920-112027942 ACTCAGTCCCTGCTGTAAAGTGG - Intergenic
1015113097 6:129616473-129616495 ATCCTGGCCCTGCCTTATAGAGG + Intronic
1018007923 6:159640721-159640743 AATCACTCCCTCCCATAAAGTGG + Intergenic
1018185449 6:161262377-161262399 CGTCTGTCCCTGCCACACAGGGG + Intronic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1020904720 7:14051150-14051172 TTTCTGTCACTGCAATACAGAGG - Intergenic
1021058134 7:16076282-16076304 CTTCTCTCCCTGCTATACAGGGG + Intergenic
1022583329 7:31579409-31579431 TTTCTGTGCCTGCCACATAGAGG - Intronic
1024349344 7:48347935-48347957 ATCATTTCCCTTCCATAAAGAGG + Intronic
1024516148 7:50259523-50259545 GTTCAGTCCCTGATATAAAGTGG - Intergenic
1026601657 7:71782544-71782566 TTTTTGGCCCTGCCATAAATAGG - Exonic
1027336536 7:77156814-77156836 ATTCTGAGCCTGTCATATAGTGG + Intronic
1028409320 7:90511055-90511077 ATACTGTCCTTGCCCTCAAGGGG - Intronic
1028559990 7:92164607-92164629 ATTCTATCCCTGCAAGAAAATGG - Exonic
1028609708 7:92696738-92696760 ATGCTGTCCATTCAATAAAGGGG - Intronic
1028823466 7:95241352-95241374 ATTCTGTCCCAAGCAAAAAGTGG - Intronic
1029779255 7:102714295-102714317 ATTCTGAGCCTGTCATATAGTGG - Intergenic
1030073080 7:105714175-105714197 ATTCTGACCCTGCCAATTAGTGG - Intronic
1034395807 7:150824364-150824386 TGTCTGTCCCTGCCATGTAGAGG + Intergenic
1034982908 7:155489975-155489997 CTTCTGTCCCAGCCTCAAAGTGG - Intronic
1035970627 8:4243987-4244009 TTTCAGTCCCTGCCATGGAGTGG + Intronic
1037146950 8:15583989-15584011 ATACTGCCCCTGCAATACAGAGG - Intronic
1042051347 8:64711510-64711532 AATGAGTCCCTGCCTTAAAGAGG + Intronic
1042574228 8:70200154-70200176 CTTATGTCCCTGATATAAAGTGG - Intronic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045784398 8:105903584-105903606 ATTCTCACACTGCTATAAAGTGG + Intergenic
1048411407 8:134177859-134177881 AGATTGTCCCTGGCATAAAGTGG + Intergenic
1050328083 9:4516953-4516975 GTTCTGTTTCTTCCATAAAGAGG - Intronic
1056327671 9:85493502-85493524 CTTCTGAACTTGCCATAAAGGGG - Intergenic
1057693961 9:97310682-97310704 GGTCTGTCCCTGCCCCAAAGAGG - Intronic
1057861573 9:98644919-98644941 CTCCTGTCCCTGCTACAAAGAGG + Intronic
1059164192 9:112063152-112063174 ATTCTGTACATGCCACAATGTGG + Intronic
1061411177 9:130422557-130422579 ATTCTTTCCCTTCCTTACAGGGG + Exonic
1061814825 9:133188398-133188420 CTTCTTTCCCTGCCATTAGGGGG + Intergenic
1062652362 9:137584528-137584550 CTTCTGTCCCTGCCATGGTGCGG - Intronic
1203662980 Un_KI270753v1:62321-62343 ATTCAGTGCCTCCCATCAAGCGG - Intergenic
1203670392 Un_KI270755v1:6385-6407 ATTCAGTGCCTCCCATCAAGCGG + Intergenic
1187485666 X:19700846-19700868 GTTCTGGCCCAGCCAGAAAGAGG - Intronic
1189718086 X:43884973-43884995 AGTCTGTCCCTGCCTTCATGGGG + Intergenic
1189799684 X:44680798-44680820 ATTCTGTCTTTGGTATAAAGTGG + Intergenic
1189950650 X:46226730-46226752 ATTCTAGCCCTGCCCTAATGGGG - Intergenic
1190908191 X:54748852-54748874 TTACTGTCCCTGTCACAAAGAGG - Intergenic
1191678257 X:63814685-63814707 AATCTGCTCCTGCCATAAGGGGG + Intergenic
1193353796 X:80492762-80492784 TTTCTGTCTCTTCTATAAAGAGG - Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199760351 X:150899672-150899694 AGCCTGTCCCTGCCATTATGCGG + Intergenic
1201337512 Y:12896443-12896465 CTACTGTCCCTGCAATAAGGAGG - Intergenic
1201679733 Y:16631038-16631060 ATTCTGTCTCTGCCAGAAATGGG + Intergenic