ID: 1113320467

View in Genome Browser
Species Human (GRCh38)
Location 13:109227765-109227787
Sequence CTGAAACAGAAGTCACTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113320467_1113320470 24 Left 1113320467 13:109227765-109227787 CCCTGGAGTGACTTCTGTTTCAG No data
Right 1113320470 13:109227812-109227834 TTCTCAGTTGAATGTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113320467 Original CRISPR CTGAAACAGAAGTCACTCCA GGG (reversed) Intergenic
No off target data available for this crispr