ID: 1113321228

View in Genome Browser
Species Human (GRCh38)
Location 13:109234525-109234547
Sequence CAGCACTCCATGGACACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113321223_1113321228 -3 Left 1113321223 13:109234505-109234527 CCAATGGGGGGCAGATCCCACAG No data
Right 1113321228 13:109234525-109234547 CAGCACTCCATGGACACAAAGGG No data
1113321222_1113321228 3 Left 1113321222 13:109234499-109234521 CCATGGCCAATGGGGGGCAGATC No data
Right 1113321228 13:109234525-109234547 CAGCACTCCATGGACACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113321228 Original CRISPR CAGCACTCCATGGACACAAA GGG Intergenic
No off target data available for this crispr