ID: 1113325497

View in Genome Browser
Species Human (GRCh38)
Location 13:109277592-109277614
Sequence CCCCTTACTTTAAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113325497_1113325508 22 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325508 13:109277637-109277659 AGGAGCCTTGGTTGTCTAAGGGG No data
1113325497_1113325506 20 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325506 13:109277635-109277657 GCAGGAGCCTTGGTTGTCTAAGG No data
1113325497_1113325507 21 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325507 13:109277636-109277658 CAGGAGCCTTGGTTGTCTAAGGG No data
1113325497_1113325502 2 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325502 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
1113325497_1113325503 10 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325503 13:109277625-109277647 TTCCAGCCTTGCAGGAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113325497 Original CRISPR CCCCTTACTTTAAAGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr