ID: 1113325501

View in Genome Browser
Species Human (GRCh38)
Location 13:109277617-109277639
Sequence CCTGCAAGGCTGGAAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113325501_1113325506 -5 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325506 13:109277635-109277657 GCAGGAGCCTTGGTTGTCTAAGG No data
1113325501_1113325511 8 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325511 13:109277648-109277670 TTGTCTAAGGGGAGTAACCTGGG No data
1113325501_1113325507 -4 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325507 13:109277636-109277658 CAGGAGCCTTGGTTGTCTAAGGG No data
1113325501_1113325510 7 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325510 13:109277647-109277669 GTTGTCTAAGGGGAGTAACCTGG No data
1113325501_1113325508 -3 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325508 13:109277637-109277659 AGGAGCCTTGGTTGTCTAAGGGG No data
1113325501_1113325514 27 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325514 13:109277667-109277689 TGGGGAAAGATCCCAAGTGCAGG No data
1113325501_1113325512 9 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325512 13:109277649-109277671 TGTCTAAGGGGAGTAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113325501 Original CRISPR CCTGCAAGGCTGGAAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr