ID: 1113325502

View in Genome Browser
Species Human (GRCh38)
Location 13:109277617-109277639
Sequence CCTTTCTCTTCCAGCCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113325497_1113325502 2 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325502 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113325502 Original CRISPR CCTTTCTCTTCCAGCCTTGC AGG Intergenic
No off target data available for this crispr