ID: 1113325506

View in Genome Browser
Species Human (GRCh38)
Location 13:109277635-109277657
Sequence GCAGGAGCCTTGGTTGTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113325497_1113325506 20 Left 1113325497 13:109277592-109277614 CCATTTTTCTTTAAAGTAAGGGG No data
Right 1113325506 13:109277635-109277657 GCAGGAGCCTTGGTTGTCTAAGG No data
1113325501_1113325506 -5 Left 1113325501 13:109277617-109277639 CCTTTCTCTTCCAGCCTTGCAGG No data
Right 1113325506 13:109277635-109277657 GCAGGAGCCTTGGTTGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113325506 Original CRISPR GCAGGAGCCTTGGTTGTCTA AGG Intergenic
No off target data available for this crispr