ID: 1113329759

View in Genome Browser
Species Human (GRCh38)
Location 13:109316796-109316818
Sequence TGGGTGTCCCAGCTCTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113329751_1113329759 25 Left 1113329751 13:109316748-109316770 CCTAAGACCTAAGAATCTGGGGC No data
Right 1113329759 13:109316796-109316818 TGGGTGTCCCAGCTCTAAAAGGG No data
1113329755_1113329759 1 Left 1113329755 13:109316772-109316794 CCAATGTTCAAGGATAGGAGAAG No data
Right 1113329759 13:109316796-109316818 TGGGTGTCCCAGCTCTAAAAGGG No data
1113329752_1113329759 18 Left 1113329752 13:109316755-109316777 CCTAAGAATCTGGGGCTCCAATG No data
Right 1113329759 13:109316796-109316818 TGGGTGTCCCAGCTCTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113329759 Original CRISPR TGGGTGTCCCAGCTCTAAAA GGG Intergenic
No off target data available for this crispr