ID: 1113332757

View in Genome Browser
Species Human (GRCh38)
Location 13:109346358-109346380
Sequence ATTGAGAAGTCCTATCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113332757_1113332761 22 Left 1113332757 13:109346358-109346380 CCTGCCTGATAGGACTTCTCAAT No data
Right 1113332761 13:109346403-109346425 GCATATAATGCCTGACACCTGGG No data
1113332757_1113332760 21 Left 1113332757 13:109346358-109346380 CCTGCCTGATAGGACTTCTCAAT No data
Right 1113332760 13:109346402-109346424 AGCATATAATGCCTGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113332757 Original CRISPR ATTGAGAAGTCCTATCAGGC AGG (reversed) Intergenic
No off target data available for this crispr