ID: 1113335318

View in Genome Browser
Species Human (GRCh38)
Location 13:109371214-109371236
Sequence GAGGAGTGCAGGGGTTTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113335318_1113335333 25 Left 1113335318 13:109371214-109371236 CCGCTGAAACCCCTGCACTCCTC No data
Right 1113335333 13:109371262-109371284 CTTTGGAAAATTCACCCCTCTGG No data
1113335318_1113335328 8 Left 1113335318 13:109371214-109371236 CCGCTGAAACCCCTGCACTCCTC No data
Right 1113335328 13:109371245-109371267 AGCTGTGCCCATCTGCCCTTTGG No data
1113335318_1113335335 30 Left 1113335318 13:109371214-109371236 CCGCTGAAACCCCTGCACTCCTC No data
Right 1113335335 13:109371267-109371289 GAAAATTCACCCCTCTGGGCAGG No data
1113335318_1113335334 26 Left 1113335318 13:109371214-109371236 CCGCTGAAACCCCTGCACTCCTC No data
Right 1113335334 13:109371263-109371285 TTTGGAAAATTCACCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113335318 Original CRISPR GAGGAGTGCAGGGGTTTCAG CGG (reversed) Intergenic
No off target data available for this crispr