ID: 1113339690

View in Genome Browser
Species Human (GRCh38)
Location 13:109409840-109409862
Sequence ACGGGGAGATGATGTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113339690_1113339695 15 Left 1113339690 13:109409840-109409862 CCATCAGCACATCATCTCCCCGT No data
Right 1113339695 13:109409878-109409900 TGTTGTTGTTGTTGTTGAGACGG 0: 449
1: 1000
2: 942
3: 2768
4: 7033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113339690 Original CRISPR ACGGGGAGATGATGTGCTGA TGG (reversed) Intergenic
No off target data available for this crispr