ID: 1113340285

View in Genome Browser
Species Human (GRCh38)
Location 13:109416284-109416306
Sequence TGGATGGGCGGGTGAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113340285_1113340292 -10 Left 1113340285 13:109416284-109416306 CCTCCTCTTCACCCGCCCATCCA No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113340285 Original CRISPR TGGATGGGCGGGTGAAGAGG AGG (reversed) Intergenic
No off target data available for this crispr