ID: 1113340292

View in Genome Browser
Species Human (GRCh38)
Location 13:109416297-109416319
Sequence CGCCCATCCAGGGTCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113340279_1113340292 15 Left 1113340279 13:109416259-109416281 CCTCCTCAGGTGCTGGAAGCCAC No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340280_1113340292 12 Left 1113340280 13:109416262-109416284 CCTCAGGTGCTGGAAGCCACCCC No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340285_1113340292 -10 Left 1113340285 13:109416284-109416306 CCTCCTCTTCACCCGCCCATCCA No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340283_1113340292 -8 Left 1113340283 13:109416282-109416304 CCCCTCCTCTTCACCCGCCCATC No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340278_1113340292 16 Left 1113340278 13:109416258-109416280 CCCTCCTCAGGTGCTGGAAGCCA No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340282_1113340292 -7 Left 1113340282 13:109416281-109416303 CCCCCTCCTCTTCACCCGCCCAT No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340284_1113340292 -9 Left 1113340284 13:109416283-109416305 CCCTCCTCTTCACCCGCCCATCC No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data
1113340281_1113340292 -4 Left 1113340281 13:109416278-109416300 CCACCCCCTCCTCTTCACCCGCC No data
Right 1113340292 13:109416297-109416319 CGCCCATCCAGGGTCCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113340292 Original CRISPR CGCCCATCCAGGGTCCACGG AGG Intergenic
No off target data available for this crispr