ID: 1113342803

View in Genome Browser
Species Human (GRCh38)
Location 13:109443349-109443371
Sequence GCTGATAAGCAACTTTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113342803_1113342807 5 Left 1113342803 13:109443349-109443371 CCTTGCTAAAGTTGCTTATCAGC No data
Right 1113342807 13:109443377-109443399 GAGATTTTGGGCTGAGACGATGG 0: 2968
1: 8057
2: 4168
3: 2267
4: 1715
1113342803_1113342808 6 Left 1113342803 13:109443349-109443371 CCTTGCTAAAGTTGCTTATCAGC No data
Right 1113342808 13:109443378-109443400 AGATTTTGGGCTGAGACGATGGG 0: 2924
1: 8055
2: 4417
3: 2229
4: 1474
1113342803_1113342809 7 Left 1113342803 13:109443349-109443371 CCTTGCTAAAGTTGCTTATCAGC No data
Right 1113342809 13:109443379-109443401 GATTTTGGGCTGAGACGATGGGG 0: 2849
1: 7775
2: 4303
3: 2198
4: 1450
1113342803_1113342805 -8 Left 1113342803 13:109443349-109443371 CCTTGCTAAAGTTGCTTATCAGC No data
Right 1113342805 13:109443364-109443386 TTATCAGCTTAAGGAGATTTTGG 0: 9766
1: 5142
2: 2748
3: 1620
4: 1461
1113342803_1113342806 -7 Left 1113342803 13:109443349-109443371 CCTTGCTAAAGTTGCTTATCAGC No data
Right 1113342806 13:109443365-109443387 TATCAGCTTAAGGAGATTTTGGG 0: 9796
1: 4749
2: 2543
3: 1734
4: 1735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113342803 Original CRISPR GCTGATAAGCAACTTTAGCA AGG (reversed) Intergenic
No off target data available for this crispr