ID: 1113352213

View in Genome Browser
Species Human (GRCh38)
Location 13:109540418-109540440
Sequence TGAGATCCACAGTAAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113352210_1113352213 1 Left 1113352210 13:109540394-109540416 CCAGATCTGTTGGCATTTTGCAG No data
Right 1113352213 13:109540418-109540440 TGAGATCCACAGTAAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113352213 Original CRISPR TGAGATCCACAGTAAGTGGG CGG Intergenic
No off target data available for this crispr