ID: 1113354020

View in Genome Browser
Species Human (GRCh38)
Location 13:109560850-109560872
Sequence ATGTATCTGTACATGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113354017_1113354020 14 Left 1113354017 13:109560813-109560835 CCTGATGTACATGTATCTGTACA No data
Right 1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113354020 Original CRISPR ATGTATCTGTACATGTATCT GGG Intergenic
No off target data available for this crispr