ID: 1113355225

View in Genome Browser
Species Human (GRCh38)
Location 13:109572662-109572684
Sequence GTGGAATACAGCATTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113355218_1113355225 27 Left 1113355218 13:109572612-109572634 CCTGTGGCTGCGGGTTAGGGGTC No data
Right 1113355225 13:109572662-109572684 GTGGAATACAGCATTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113355225 Original CRISPR GTGGAATACAGCATTCAGGA GGG Intergenic
No off target data available for this crispr