ID: 1113355457

View in Genome Browser
Species Human (GRCh38)
Location 13:109575932-109575954
Sequence TAGGAAAAGCACTACCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113355457_1113355459 -9 Left 1113355457 13:109575932-109575954 CCCAGAAGGTAGTGCTTTTCCTA No data
Right 1113355459 13:109575946-109575968 CTTTTCCTACGCTCATAGAGAGG No data
1113355457_1113355462 29 Left 1113355457 13:109575932-109575954 CCCAGAAGGTAGTGCTTTTCCTA No data
Right 1113355462 13:109575984-109576006 ACCAACCCTATTCCTTGACTGGG No data
1113355457_1113355461 28 Left 1113355457 13:109575932-109575954 CCCAGAAGGTAGTGCTTTTCCTA No data
Right 1113355461 13:109575983-109576005 AACCAACCCTATTCCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113355457 Original CRISPR TAGGAAAAGCACTACCTTCT GGG (reversed) Intergenic
No off target data available for this crispr