ID: 1113358853

View in Genome Browser
Species Human (GRCh38)
Location 13:109609909-109609931
Sequence CTGGACTGCTGGGAAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113358845_1113358853 3 Left 1113358845 13:109609883-109609905 CCAACCAGACCTTTAAGCTTTGG No data
Right 1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG No data
1113358847_1113358853 -1 Left 1113358847 13:109609887-109609909 CCAGACCTTTAAGCTTTGGATCC No data
Right 1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG No data
1113358844_1113358853 15 Left 1113358844 13:109609871-109609893 CCAAAAGGGGAACCAACCAGACC No data
Right 1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG No data
1113358849_1113358853 -6 Left 1113358849 13:109609892-109609914 CCTTTAAGCTTTGGATCCTGGAC No data
Right 1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113358853 Original CRISPR CTGGACTGCTGGGAAAATAC TGG Intergenic
No off target data available for this crispr