ID: 1113362260

View in Genome Browser
Species Human (GRCh38)
Location 13:109642475-109642497
Sequence CAGGGAATATACTCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113362260_1113362264 4 Left 1113362260 13:109642475-109642497 CCAGGAACAGAGTATATTCCCTG No data
Right 1113362264 13:109642502-109642524 TGCACACTTGTGTCTGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113362260 Original CRISPR CAGGGAATATACTCTGTTCC TGG (reversed) Intergenic
No off target data available for this crispr