ID: 1113363795

View in Genome Browser
Species Human (GRCh38)
Location 13:109656865-109656887
Sequence GGCTCCGTGCGGTCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113363795_1113363805 1 Left 1113363795 13:109656865-109656887 CCCACCCAAGACCGCACGGAGCC No data
Right 1113363805 13:109656889-109656911 GAGGACCCTGCCTGGGCTTGAGG No data
1113363795_1113363802 -6 Left 1113363795 13:109656865-109656887 CCCACCCAAGACCGCACGGAGCC No data
Right 1113363802 13:109656882-109656904 GGAGCCCGAGGACCCTGCCTGGG No data
1113363795_1113363801 -7 Left 1113363795 13:109656865-109656887 CCCACCCAAGACCGCACGGAGCC No data
Right 1113363801 13:109656881-109656903 CGGAGCCCGAGGACCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113363795 Original CRISPR GGCTCCGTGCGGTCTTGGGT GGG (reversed) Intergenic
No off target data available for this crispr