ID: 1113363801

View in Genome Browser
Species Human (GRCh38)
Location 13:109656881-109656903
Sequence CGGAGCCCGAGGACCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113363795_1113363801 -7 Left 1113363795 13:109656865-109656887 CCCACCCAAGACCGCACGGAGCC No data
Right 1113363801 13:109656881-109656903 CGGAGCCCGAGGACCCTGCCTGG No data
1113363796_1113363801 -8 Left 1113363796 13:109656866-109656888 CCACCCAAGACCGCACGGAGCCC No data
Right 1113363801 13:109656881-109656903 CGGAGCCCGAGGACCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113363801 Original CRISPR CGGAGCCCGAGGACCCTGCC TGG Intergenic
No off target data available for this crispr