ID: 1113363802

View in Genome Browser
Species Human (GRCh38)
Location 13:109656882-109656904
Sequence GGAGCCCGAGGACCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113363797_1113363802 -10 Left 1113363797 13:109656869-109656891 CCCAAGACCGCACGGAGCCCGAG No data
Right 1113363802 13:109656882-109656904 GGAGCCCGAGGACCCTGCCTGGG No data
1113363796_1113363802 -7 Left 1113363796 13:109656866-109656888 CCACCCAAGACCGCACGGAGCCC No data
Right 1113363802 13:109656882-109656904 GGAGCCCGAGGACCCTGCCTGGG No data
1113363795_1113363802 -6 Left 1113363795 13:109656865-109656887 CCCACCCAAGACCGCACGGAGCC No data
Right 1113363802 13:109656882-109656904 GGAGCCCGAGGACCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113363802 Original CRISPR GGAGCCCGAGGACCCTGCCT GGG Intergenic
No off target data available for this crispr