ID: 1113363805

View in Genome Browser
Species Human (GRCh38)
Location 13:109656889-109656911
Sequence GAGGACCCTGCCTGGGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113363798_1113363805 -4 Left 1113363798 13:109656870-109656892 CCAAGACCGCACGGAGCCCGAGG No data
Right 1113363805 13:109656889-109656911 GAGGACCCTGCCTGGGCTTGAGG No data
1113363796_1113363805 0 Left 1113363796 13:109656866-109656888 CCACCCAAGACCGCACGGAGCCC No data
Right 1113363805 13:109656889-109656911 GAGGACCCTGCCTGGGCTTGAGG No data
1113363797_1113363805 -3 Left 1113363797 13:109656869-109656891 CCCAAGACCGCACGGAGCCCGAG No data
Right 1113363805 13:109656889-109656911 GAGGACCCTGCCTGGGCTTGAGG No data
1113363800_1113363805 -10 Left 1113363800 13:109656876-109656898 CCGCACGGAGCCCGAGGACCCTG No data
Right 1113363805 13:109656889-109656911 GAGGACCCTGCCTGGGCTTGAGG No data
1113363795_1113363805 1 Left 1113363795 13:109656865-109656887 CCCACCCAAGACCGCACGGAGCC No data
Right 1113363805 13:109656889-109656911 GAGGACCCTGCCTGGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113363805 Original CRISPR GAGGACCCTGCCTGGGCTTG AGG Intergenic
No off target data available for this crispr