ID: 1113364297

View in Genome Browser
Species Human (GRCh38)
Location 13:109661869-109661891
Sequence TGCCTCTGGGCAGGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113364286_1113364297 24 Left 1113364286 13:109661822-109661844 CCAGAAAAATGAATGGGGTTTAA No data
Right 1113364297 13:109661869-109661891 TGCCTCTGGGCAGGGCAAGGAGG No data
1113364285_1113364297 25 Left 1113364285 13:109661821-109661843 CCCAGAAAAATGAATGGGGTTTA No data
Right 1113364297 13:109661869-109661891 TGCCTCTGGGCAGGGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113364297 Original CRISPR TGCCTCTGGGCAGGGCAAGG AGG Intergenic