ID: 1113371082

View in Genome Browser
Species Human (GRCh38)
Location 13:109726105-109726127
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113371074_1113371082 -2 Left 1113371074 13:109726084-109726106 CCCTACATTCCTTGCTTTAGATA No data
Right 1113371082 13:109726105-109726127 TAGGATTCTGAATGTGGGGCGGG No data
1113371075_1113371082 -3 Left 1113371075 13:109726085-109726107 CCTACATTCCTTGCTTTAGATAG No data
Right 1113371082 13:109726105-109726127 TAGGATTCTGAATGTGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113371082 Original CRISPR TAGGATTCTGAATGTGGGGC GGG Intergenic
No off target data available for this crispr