ID: 1113373097

View in Genome Browser
Species Human (GRCh38)
Location 13:109740429-109740451
Sequence CTGCTGTTATAAAGGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113373095_1113373097 -2 Left 1113373095 13:109740408-109740430 CCGGAATTGAATGTGCGAGCACT No data
Right 1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG No data
1113373094_1113373097 3 Left 1113373094 13:109740403-109740425 CCGTGCCGGAATTGAATGTGCGA No data
Right 1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113373097 Original CRISPR CTGCTGTTATAAAGGAAAAG AGG Intergenic
No off target data available for this crispr