ID: 1113374832

View in Genome Browser
Species Human (GRCh38)
Location 13:109755513-109755535
Sequence GAGGGAAGGGCTTTGGGAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 858}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113374832_1113374848 18 Left 1113374832 13:109755513-109755535 CCCCTTCCCAAAGCCCTTCCCTC 0: 1
1: 0
2: 12
3: 93
4: 858
Right 1113374848 13:109755554-109755576 TACAGTTGATTTTCAAAAGTAGG 0: 1
1: 0
2: 1
3: 36
4: 703

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113374832 Original CRISPR GAGGGAAGGGCTTTGGGAAG GGG (reversed) Exonic
900244075 1:1629761-1629783 GAGGGAAGGGGTGGGGGACGGGG - Intronic
900353231 1:2247292-2247314 GAGGGAAGGGCCTGGGTCAGGGG + Intronic
900363308 1:2300261-2300283 GCCTGAAGGGCTTTGGGATGGGG + Intronic
900997324 1:6129730-6129752 GATGGAAGGGCTGTGGGGGGAGG - Intronic
901290901 1:8123575-8123597 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
901778244 1:11575414-11575436 AAGGCAAGGGCTGTGGGAAGGGG - Intergenic
901858070 1:12056929-12056951 AAGGGAAGGGCTTGGGGGATGGG + Intergenic
901877518 1:12175347-12175369 GAGTGAGTGGCTTTGGGCAGGGG + Intronic
902563363 1:17292894-17292916 GAGGGAGGGGAATGGGGAAGGGG + Intergenic
902571962 1:17352681-17352703 GAGGGGAGGACTGTGGGAGGAGG + Intronic
902652566 1:17846107-17846129 GAGGGCAGGGATTTGGTGAGGGG - Intergenic
902969294 1:20034962-20034984 GAGGGAAGGGGGCTGGGAACAGG + Intronic
903176619 1:21585346-21585368 GAGGGAAACGCTGTGGGGAGAGG + Intergenic
903421534 1:23220761-23220783 CAGGGAAGGGCTTTGAGCAAGGG + Intergenic
903658106 1:24961081-24961103 GAGAGAAGGGGTGTGGGAAAAGG - Intronic
903702780 1:25263052-25263074 GAAGGAAGGGCTCTCTGAAGAGG + Intronic
903707165 1:25294833-25294855 GAGGGATGGGGTTTGCGGAGAGG + Intronic
903712045 1:25333378-25333400 GAAGGAAGGGCTCTCTGAAGAGG + Intronic
903720074 1:25398509-25398531 GAGGGATGGGGTTTGCGGAGAGG - Intronic
903755777 1:25659427-25659449 GAGGGAAGAGCTTGAGAAAGAGG - Intronic
904416163 1:30362239-30362261 CATGGAAGGGCTTTGAGAGGGGG - Intergenic
905247760 1:36626778-36626800 GTGGGAAGGGCTCTGGGAGGAGG + Intergenic
905256435 1:36688465-36688487 AAAGGAAGGGATATGGGAAGGGG + Intergenic
905256440 1:36688477-36688499 ATGGGAAGGGGTATGGGAAGGGG + Intergenic
905256459 1:36688531-36688553 AGGGGAAGGGGTGTGGGAAGGGG + Intergenic
905256480 1:36688585-36688607 AGGGGAAGGGGTGTGGGAAGGGG + Intergenic
905256501 1:36688639-36688661 AGGGGAAGGGGTGTGGGAAGGGG + Intergenic
905256529 1:36688711-36688733 AGGGGAAGGGGTATGGGAAGGGG + Intergenic
905256544 1:36688747-36688769 AGGGGAAGGGGTGTGGGAAGGGG + Intergenic
905256607 1:36688927-36688949 AAGGGAAGGGGTATGGGAAGGGG + Intergenic
905256652 1:36689045-36689067 AGGGGAAGGGGTATGGGAAGGGG + Intergenic
905393060 1:37650527-37650549 GAGGGAGGGGGCTGGGGAAGAGG + Intergenic
905449646 1:38047898-38047920 GAAGGATGGGCTCAGGGAAGGGG + Intergenic
905463413 1:38135754-38135776 GAGAGAAGGGCTTGGGGATTGGG + Intergenic
905712342 1:40116838-40116860 AAGGGCAAGGCTGTGGGAAGGGG + Intergenic
905767382 1:40612662-40612684 GTGGGGAGGGCTGTGGGAGGTGG - Intergenic
905867574 1:41384489-41384511 GAGGAACTGGCATTGGGAAGGGG + Intergenic
906494819 1:46297439-46297461 GATGGAATGGATTTGGGAGGAGG - Intronic
907092576 1:51741501-51741523 AAGGGAAGGGCAAGGGGAAGAGG - Intronic
907166321 1:52414672-52414694 AAGGATAGGGCTTTGGGGAGGGG + Intronic
907559811 1:55378062-55378084 GGGGGAAGGCCTTTGACAAGTGG + Intergenic
907666099 1:56434946-56434968 CAGGGAAGGGCATGGGGTAGGGG + Intergenic
909358168 1:74732492-74732514 GAGAGCTGGGCTGTGGGAAGGGG + Intronic
909439947 1:75685997-75686019 GAGGGAAGTGCTGAGTGAAGGGG + Intergenic
909528696 1:76657581-76657603 GAGAGAGGGGCTTGGGGGAGGGG - Intergenic
909633643 1:77792162-77792184 GAGGGAAGGGGTTTAAAAAGAGG + Intronic
909662089 1:78095574-78095596 GAGGAAAGGTATTGGGGAAGGGG - Intronic
910810174 1:91227650-91227672 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
911068343 1:93812264-93812286 GACGGAAGGGCCTGGGGAAAGGG - Intronic
911169344 1:94754932-94754954 GAGGGAAGGGTTTTGAGCAAGGG - Intergenic
911581040 1:99633672-99633694 GAGGGAAGGAATATGAGAAGGGG + Intergenic
911592848 1:99767749-99767771 GCGGGTAGGGGCTTGGGAAGTGG + Intergenic
912383506 1:109260121-109260143 GAGGGACGGGCTTGGGGGAGGGG + Intronic
913123964 1:115768238-115768260 GAGGGAATGCCTTTGGCCAGGGG - Intronic
913159571 1:116132922-116132944 GAGGGAATAGATTAGGGAAGAGG + Intronic
913390556 1:118306736-118306758 AAGGGAAGGGATTTGGGAAGAGG + Intergenic
913639853 1:120802019-120802041 GTGGGAAGGGGATGGGGAAGAGG + Intergenic
913975501 1:143451582-143451604 GAGGGAGGGGCTGGGGGAAGCGG - Intergenic
914069894 1:144277198-144277220 GAGGGAGGGGCTGGGGGAAGCGG - Intergenic
914109261 1:144689156-144689178 GAGGGAGGGGCTGGGGGAAGCGG + Intergenic
914212646 1:145594500-145594522 GTGGGAAGGGGATGGGGAAGAGG - Intergenic
914278627 1:146148319-146148341 GTGGGAAGGGGATGGGGAAGAGG - Intronic
914382593 1:147131076-147131098 GTGGGAAGGGGATGGGGAAGAGG - Intergenic
914539675 1:148599267-148599289 GTGGGAAGGGGATGGGGAAGAGG - Intronic
914627003 1:149472361-149472383 GTGGGAAGGGGATGGGGAAGAGG + Intergenic
915324750 1:155075640-155075662 GAGGCTAGGGCCTGGGGAAGGGG - Intergenic
915904208 1:159866125-159866147 GAGGGCAGGGCTTAGAGGAGTGG - Intronic
916340199 1:163724985-163725007 GAGAAAAGGCCTTTAGGAAGAGG + Intergenic
917262119 1:173181624-173181646 GAGGGAACTGCCTTAGGAAGAGG - Intergenic
917918596 1:179729783-179729805 GATGAAAGGGCTTTGGAGAGTGG - Intergenic
918914830 1:190621701-190621723 AAGGGAAGGTCTTGGGGTAGAGG + Intergenic
919530846 1:198717795-198717817 AAGGGAAGGGAGTGGGGAAGAGG - Intronic
919678731 1:200411875-200411897 GGGGGAAAGTCTGTGGGAAGGGG - Intergenic
919870014 1:201813128-201813150 GAAGCAAGGGCCTAGGGAAGAGG - Exonic
920194480 1:204217808-204217830 GTGGCAAGGGCTTGGGGAGGAGG - Intergenic
920244397 1:204576852-204576874 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
920249892 1:204616643-204616665 GAGGGGAGGGCTATGGGATAAGG - Intergenic
920252197 1:204629130-204629152 GAGGCAAGGGCGGGGGGAAGGGG + Intronic
920656039 1:207875843-207875865 GAGGGAAAGGATTGGGGAAAGGG - Intergenic
920840396 1:209549141-209549163 CAGGGAAGGCTTTGGGGAAGAGG + Intergenic
920858841 1:209688306-209688328 CAGGAAAGGGCTCTGGGAGGTGG - Intronic
921245016 1:213229096-213229118 GAAGGCAGGGCCTTGGGAAGAGG + Intronic
921726578 1:218531047-218531069 GAAGGAAGGGCTTTCTGAATTGG - Intergenic
921921253 1:220672688-220672710 GAGGGATGGGAGTGGGGAAGAGG - Intergenic
922035306 1:221841924-221841946 GTGTTAAGTGCTTTGGGAAGAGG + Intergenic
922615877 1:226960940-226960962 CAGGGAAGTTCTTTGGGAATTGG + Intronic
922701506 1:227763813-227763835 GAGGCCAGGGCTGAGGGAAGGGG + Intronic
922987545 1:229877618-229877640 GAGGATAGGGCTGAGGGAAGCGG + Intergenic
923371552 1:233319078-233319100 GAGGGACAGGCTTTGTGGAGTGG - Intergenic
923644446 1:235802543-235802565 GAGGGAAGTCCTTTCTGAAGAGG - Intronic
924320354 1:242842467-242842489 GAGGGAGGGGCTTGGGTCAGTGG + Intergenic
924485103 1:244475087-244475109 AATGAAAGGGCATTGGGAAGGGG - Intronic
1063311617 10:4957844-4957866 GAGGAAAGGGAGATGGGAAGAGG - Intronic
1063316179 10:5008626-5008648 GAGGAAAGGGAGATGGGAAGAGG + Intronic
1063461366 10:6216822-6216844 GAGGAAAAGGCTTCAGGAAGCGG + Intronic
1063495974 10:6508681-6508703 GATGGAAGAGCTATGGTAAGGGG + Intronic
1063543230 10:6955495-6955517 GTGGGAAGGGATGTGGGCAGTGG + Intergenic
1063663211 10:8047804-8047826 GAGGGAGGGGCTGCGGGTAGGGG + Intergenic
1063945443 10:11171642-11171664 GAGGGTAGGCCCTGGGGAAGAGG + Intronic
1064464064 10:15562164-15562186 GTGGGGAGGGGTTTGGGATGGGG + Intronic
1065813864 10:29467246-29467268 GACTGAAGGGCTCTGGAAAGGGG + Intronic
1065964319 10:30758702-30758724 GAGGGCAGGGCTTGGGGGACTGG + Intergenic
1067728538 10:48791897-48791919 GAGGGACAGGCTGGGGGAAGGGG - Intronic
1067733982 10:48834785-48834807 GGGAGAAGGGCATTGGCAAGAGG - Intronic
1067804674 10:49384566-49384588 GCCAGAAGGGCTTAGGGAAGGGG + Intronic
1068000477 10:51328121-51328143 GTGGGGAGGGATTTTGGAAGCGG - Intronic
1068334084 10:55608303-55608325 GAGGGAAGGGGAGGGGGAAGAGG + Intronic
1068712565 10:60150329-60150351 GAAGGATGGGGATTGGGAAGAGG - Intronic
1069752654 10:70754026-70754048 GTGGGAGGGGCTTGGGGAGGAGG + Intronic
1069994506 10:72334301-72334323 GTGGGAAGGGCTGGGGGAGGGGG - Exonic
1070339002 10:75479543-75479565 GAAGGAAGGGCATCAGGAAGAGG + Intronic
1071350923 10:84743819-84743841 GAGGGAATAGCTTGGGAAAGAGG - Intergenic
1071718207 10:88117986-88118008 GAGGAAAGGGGTTGGGGGAGGGG + Intergenic
1072973404 10:100037173-100037195 GTGGGCAGGGTCTTGGGAAGTGG - Intergenic
1073048494 10:100653778-100653800 CAGGGAATGGCTGTGGGAACGGG - Intergenic
1073209074 10:101783646-101783668 GAGCGAGGAGCTTGGGGAAGTGG - Intergenic
1073245568 10:102087934-102087956 GAGGGGTGGGCTCTGGGTAGGGG - Intergenic
1073326562 10:102646738-102646760 GATGGAAGGGCTGGGGGAGGAGG + Intronic
1073750897 10:106526161-106526183 GAATGAAGAGCTTTGGGAAAAGG - Intergenic
1073988843 10:109240664-109240686 GAGGGAAGGGGAAAGGGAAGGGG + Intergenic
1074088857 10:110227936-110227958 GAGAGAAGGATTTTGGAAAGGGG + Intronic
1074430788 10:113392593-113392615 GAAGGAATGGCTTGGAGAAGAGG + Intergenic
1074784807 10:116829485-116829507 AGAGGAAGGGCTCTGGGAAGGGG + Intergenic
1074815669 10:117139670-117139692 GAGGGGAGGGGGTTGGGGAGGGG + Intergenic
1074950751 10:118332500-118332522 GAGGGAGGGGCATAGGGATGTGG - Intronic
1074950759 10:118332522-118332544 GAGGGAGGGGCATTAGGATGTGG - Intronic
1074950766 10:118332544-118332566 GAGGGAGGGGCATAGGGATGTGG - Intronic
1075161820 10:120031039-120031061 GAAGTAGGGCCTTTGGGAAGTGG + Intergenic
1075510583 10:123069552-123069574 GAGGGACGGGCTTTGTGGAGCGG - Intergenic
1075590144 10:123685183-123685205 GAGGGAAGGGCACAAGGAAGGGG + Intronic
1075849475 10:125575378-125575400 GAGGGAATGGGTTGGGGAGGTGG - Intergenic
1076301827 10:129433966-129433988 AAGGGAAGGGCAGTGGGGAGAGG - Intergenic
1076990694 11:271969-271991 GGGGCCAGGGCTGTGGGAAGGGG - Intergenic
1077026689 11:442774-442796 GAGGGAAGGGCTGCGGGGAGTGG + Intergenic
1077445608 11:2589236-2589258 GAGGGAAGGGGTTTGGGGATGGG + Intronic
1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG + Intronic
1077457897 11:2691976-2691998 GAGGGAACAGCTTAGGGAAATGG - Intronic
1077571910 11:3346454-3346476 GAGGGAAGGGGATAGGGATGGGG + Intronic
1077603067 11:3587257-3587279 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1078268906 11:9776552-9776574 GAGTGAAGGGGTTTGGGAGGTGG + Intergenic
1078835796 11:15028094-15028116 GTGGGCTGGGCTGTGGGAAGTGG + Intronic
1079110608 11:17603068-17603090 CATGGAAGGGCTTTGTGGAGGGG + Intronic
1080954901 11:37081923-37081945 GAAGGAATGGCAATGGGAAGGGG + Intergenic
1081486894 11:43537775-43537797 GAAGGAAGGGTGCTGGGAAGGGG - Intergenic
1081601737 11:44500210-44500232 GCGGGGAGGGCTTTGGGTGGAGG + Intergenic
1081615271 11:44587157-44587179 TAGGGAGGGCCTTTGGGAGGAGG + Intronic
1082029417 11:47593961-47593983 GAGGGAAGGTCTCGGGGGAGAGG - Intronic
1082728972 11:56772058-56772080 GAGGAAAAGAATTTGGGAAGAGG + Intergenic
1083631084 11:64095859-64095881 GAGGGGAGGGTCTGGGGAAGGGG + Intronic
1083755658 11:64790360-64790382 GGGGGCAGGGCTTAGGGCAGGGG - Intronic
1083997549 11:66279598-66279620 GAGGGAAGGGCTATGGGAAATGG - Intronic
1084006280 11:66325170-66325192 GAGGAATAGGCTTGGGGAAGGGG + Intergenic
1084192075 11:67503951-67503973 TGGGGAAGGACTGTGGGAAGAGG - Intronic
1084238522 11:67803731-67803753 ATGGGAAGGGCTTGGGGAACAGG - Intergenic
1084258950 11:67961795-67961817 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1084405855 11:68972741-68972763 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1084431034 11:69111403-69111425 GAAGGAAGGGCTTGTTGAAGTGG + Intergenic
1084605379 11:70169048-70169070 GAGGGACGGGGTCTGGGAGGTGG + Intronic
1084654695 11:70508319-70508341 GAGGGATGGGATGTGGGGAGGGG - Intronic
1084669490 11:70596660-70596682 GAAGGAAGGCCTGAGGGAAGGGG - Intronic
1084833893 11:71789102-71789124 ATGGGAAGGGCTTGGGGAACAGG + Intronic
1084982142 11:72835354-72835376 GAGGGAAGGACACTGAGAAGAGG + Intronic
1085045030 11:73347714-73347736 CAGCGAAGGGCTTTGAGCAGGGG + Intronic
1085263655 11:75223819-75223841 AAGGGAAGAGGTTTGGGGAGAGG - Intergenic
1085401950 11:76240822-76240844 GAGGGCAGGTCTGTGGGGAGGGG + Intergenic
1085446171 11:76602606-76602628 GTGGGAAAGGCTGTGGGGAGGGG + Intergenic
1085707577 11:78800473-78800495 GAGGGAAGGGGTTTATGAGGAGG + Intronic
1085784844 11:79440215-79440237 GAGGGCAGGGAGGTGGGAAGCGG - Intronic
1085803935 11:79617418-79617440 TATGGAAGGGTTTTGGGCAGAGG - Intergenic
1086576050 11:88340064-88340086 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1087870498 11:103287972-103287994 GTGGGTAGGGGCTTGGGAAGTGG + Intronic
1088126020 11:106424214-106424236 GAGGGAAGGGGGGAGGGAAGAGG + Intergenic
1088229978 11:107663613-107663635 GAGGGAAGGGTCTGTGGAAGTGG + Intronic
1088708150 11:112482258-112482280 GAGGGAAGCTCTCTGGGGAGAGG + Intergenic
1088914306 11:114215946-114215968 AATGGAAGGGCTTTTGGAGGAGG + Intronic
1089115325 11:116090203-116090225 GAGAGAAGGGCAGTGGGCAGGGG - Intergenic
1089389601 11:118091508-118091530 GAGAGGAGGGCTAGGGGAAGGGG - Intronic
1090038499 11:123269690-123269712 AAGGGAATGGCTTTGGGAGGGGG + Intergenic
1090276855 11:125426296-125426318 GAAGGAAGTCCTTAGGGAAGGGG - Intronic
1090359647 11:126163518-126163540 CAGGGAAGGGGTTAGGGCAGAGG - Intergenic
1090773439 11:129943120-129943142 TAGGAAAGGGCAGTGGGAAGGGG - Intronic
1091113670 11:132994393-132994415 GAGGGAAGGGCTGGGGAAAAGGG + Intronic
1091905893 12:4188903-4188925 GAGGGCAGGGGTTGGGGGAGGGG + Intergenic
1091967637 12:4758679-4758701 GATGGAAGGAATTTGGCAAGTGG + Intronic
1092160952 12:6315239-6315261 GAGGGAAAGGCCTTGGGAAGTGG + Intronic
1092231970 12:6781010-6781032 GAGTGGGGGGCTGTGGGAAGAGG - Intergenic
1092263171 12:6963119-6963141 GAGGGAAGGGGTTAAGGCAGTGG + Intergenic
1092430271 12:8402802-8402824 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1092514526 12:9195383-9195405 AAGGGAAGGGCCAGGGGAAGGGG - Intronic
1092545626 12:9448928-9448950 AAGGGAAGGCTTTTGGGGAGAGG + Intergenic
1093064896 12:14647042-14647064 GAGGCAAGAGTTTTGGGAAGAGG + Intronic
1093354961 12:18155472-18155494 GTGAGCAGGGGTTTGGGAAGTGG - Intronic
1094708343 12:32936548-32936570 GCGGGAATGGCTTTGGGAACTGG + Intergenic
1095585381 12:43843950-43843972 GAGGAGAGGGATTTGGGCAGAGG + Intronic
1096241021 12:49960411-49960433 GAGGGAAGGGGGATGGGAACTGG + Intergenic
1096429966 12:51534814-51534836 CAGGGGAGGCCTTTCGGAAGGGG + Intergenic
1097240181 12:57569703-57569725 GAGTGAGGGGCAGTGGGAAGAGG + Intronic
1098035959 12:66302403-66302425 GAGGGGAGGGCATGTGGAAGGGG - Intergenic
1098729258 12:74012019-74012041 GCGGGTAGGGGCTTGGGAAGTGG - Intergenic
1099987664 12:89686368-89686390 GAGGAAAGGAATTTGAGAAGGGG - Intronic
1100680553 12:96915367-96915389 GGGGGAAGGGCTAGAGGAAGGGG + Intronic
1101701363 12:107177433-107177455 GAGTGAAAGGGTTTGGCAAGTGG - Intergenic
1101726143 12:107389924-107389946 CATGGAAAGGCTTTGGGAAGAGG - Intronic
1101727386 12:107399386-107399408 GAGGGAATGGGTTTGGGGGGTGG - Intronic
1101858320 12:108462736-108462758 GTGTGGAGGCCTTTGGGAAGTGG - Intergenic
1102351818 12:112198255-112198277 GAGGGCAGAGCTTTTTGAAGAGG + Intronic
1102513203 12:113429297-113429319 AAGGTAAGGGCTCTGGGAAGGGG + Exonic
1102779688 12:115553389-115553411 GGGGTGAGGGCTTTGGGAGGTGG - Intergenic
1102877515 12:116459347-116459369 GAGGGGAGGGCTGTGCAAAGAGG - Intergenic
1103166043 12:118771600-118771622 AAAGAAAGGGCTTTGGGCAGAGG + Intergenic
1103371834 12:120425115-120425137 CAGGGAAGGCTTTTGGGAGGAGG + Intergenic
1103400490 12:120640442-120640464 GAGGGAAGGGGCTTGGCAATGGG - Intergenic
1103681424 12:122697033-122697055 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1103986259 12:124769548-124769570 GGGGAAAGGGCATGGGGAAGGGG - Intergenic
1104033915 12:125085120-125085142 GAGGGAAGGGTTTGGGGTGGTGG + Intronic
1104149753 12:126071102-126071124 GAGGGAAGGGCTTAGGGTGAGGG + Intergenic
1104393166 12:128408427-128408449 GAGCCAAGGGCTCTGTGAAGGGG - Intronic
1104401827 12:128482752-128482774 GAAGCTGGGGCTTTGGGAAGAGG - Intronic
1104674701 12:130704668-130704690 GAGGGAACACCTTTGGAAAGTGG - Intronic
1104776249 12:131391829-131391851 GAGGGAATGGCATTGGGCAGAGG + Intergenic
1105287032 13:19012883-19012905 CAGGGAAGGGATATGGGAGGTGG - Intergenic
1105404799 13:20124635-20124657 GGGGAAAGGGCACTGGGAAGAGG + Intergenic
1106041385 13:26096994-26097016 GAGGGAATGCCCTTGGGGAGAGG + Intergenic
1106076980 13:26468636-26468658 GAGAGAAGGGCTTTGGAATCAGG + Intergenic
1106293300 13:28386224-28386246 AAGGGAAAGGTTTTGGGACGTGG - Intronic
1106420094 13:29578845-29578867 AAGGGCAGGGCTGTGGAAAGAGG - Intronic
1106550277 13:30765146-30765168 GTGGTAGGGCCTTTGGGAAGAGG - Intergenic
1106630270 13:31464927-31464949 CAGGGAGTGGCTTTGGAAAGCGG - Intergenic
1107021590 13:35757738-35757760 GTGGGTAGGGGTTTGAGAAGTGG - Intergenic
1107360577 13:39613351-39613373 GAGGCAGGGCCTTTGGGAGGTGG - Intergenic
1107705849 13:43104187-43104209 GAGGGATTGGCAATGGGAAGGGG - Intronic
1107735195 13:43391800-43391822 AAGAGAATGGATTTGGGAAGTGG - Intronic
1107787746 13:43971526-43971548 AGGGGAAGGCCTTCGGGAAGAGG + Intergenic
1107938008 13:45361341-45361363 GAGGGAAGGGGTGAGGGGAGGGG - Intergenic
1108470838 13:50765465-50765487 GAGGGAAGGAAGTTTGGAAGAGG + Intronic
1109368800 13:61394465-61394487 GAGGAAAGGCATTTGGGCAGAGG + Intergenic
1110299612 13:73910781-73910803 GAGGTAAGGGCTTTATGAAGTGG + Intronic
1111047603 13:82835153-82835175 GAAGGAAGGGAGGTGGGAAGAGG + Intergenic
1111671121 13:91331758-91331780 GAGGGCAGGCCTTTTGGCAGGGG + Intergenic
1112127419 13:96483402-96483424 GAGGGCAGTGGTTTGGGATGGGG + Intronic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1113955199 13:114096627-114096649 AAGGGAAGGCGTTTGGGAAATGG - Intronic
1114052881 14:18936928-18936950 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1114109675 14:19464997-19465019 GTGGGTAGGGGCTTGGGAAGTGG - Intergenic
1114193691 14:20459603-20459625 GAGGAAGGGGTATTGGGAAGGGG - Intronic
1114628834 14:24146803-24146825 GAGGGAGGGGCTAGGGTAAGTGG + Exonic
1115498267 14:34027402-34027424 GAGGGAAGGGGGAGGGGAAGGGG + Intronic
1115654299 14:35428555-35428577 TAGGGCAGGGCATTGGAAAGAGG + Intergenic
1116505849 14:45680239-45680261 GAGTGAAGAGCTTTTGAAAGAGG + Intergenic
1117567224 14:57006364-57006386 GAGGGAAAGGCTCAGAGAAGAGG - Intergenic
1118038891 14:61896395-61896417 GTGGAAAGGGTTTTGGGAAGAGG + Intergenic
1118336815 14:64860439-64860461 GAGGGCAGGGCTCTGAGAAAAGG + Intronic
1118764313 14:68899791-68899813 AAGGAAGGAGCTTTGGGAAGAGG + Intronic
1118804621 14:69224656-69224678 AATGGAAGGGTTTTGGGCAGAGG - Intronic
1118941509 14:70343960-70343982 GTGGGTAGGGGCTTGGGAAGTGG + Intronic
1119791716 14:77356284-77356306 TAGGAAAGGGCATTGGGTAGGGG - Intronic
1120004640 14:79342955-79342977 GCGGGTAGGGGCTTGGGAAGTGG + Intronic
1120006010 14:79358745-79358767 AGGGGGAGGGCTTTGGGAGGAGG - Intronic
1120091886 14:80341680-80341702 GAGAGATGTGCTTTAGGAAGAGG - Intronic
1121994735 14:98593218-98593240 GAGGGAAGGGGATGGAGAAGGGG - Intergenic
1122165277 14:99818524-99818546 GAGGTGAGGGGTGTGGGAAGAGG + Intronic
1122295211 14:100701659-100701681 GTGGGAAGGGCCTGGGGAGGAGG + Intergenic
1122343273 14:101042671-101042693 GAGGCAGTGGCTTTGGGCAGAGG + Intergenic
1122493903 14:102139043-102139065 CGGGGAAGCGCTTTGGGAACCGG - Intronic
1122546254 14:102524376-102524398 AAGGGAAGGGTGTTGGGGAGCGG - Intergenic
1123463478 15:20495612-20495634 GAGAGGCGGGATTTGGGAAGAGG + Intergenic
1123654583 15:22504805-22504827 GAGAGGCGGGATTTGGGAAGAGG - Intergenic
1124025111 15:25958707-25958729 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1124274320 15:28313020-28313042 GAGAGGTGGGATTTGGGAAGAGG + Intronic
1124308494 15:28600002-28600024 GAGAGGCGGGATTTGGGAAGAGG - Intergenic
1124635092 15:31360206-31360228 CAGGGAAGGGCTTAGGAAACAGG + Intronic
1126023178 15:44421968-44421990 CAGGGAAGGCCTTTCTGAAGAGG + Intergenic
1126061432 15:44786335-44786357 TAGAGAATGACTTTGGGAAGAGG + Intergenic
1126095994 15:45091126-45091148 GATGGAAGGGCTTTGGGGCCAGG - Intergenic
1126450673 15:48805041-48805063 GAGGGAGGGTCTGTGGGAGGAGG - Intronic
1127060119 15:55173932-55173954 GAGGGAAGGGTATTAAGAAGAGG + Intergenic
1127123193 15:55788674-55788696 GAGGGAAGGGGATTTTGAAGGGG - Intergenic
1127271543 15:57406249-57406271 GGGGGAAGGGCACTGTGAAGAGG + Intronic
1127281497 15:57497226-57497248 GAAAGAAGGCCTTTGGCAAGAGG + Intronic
1127370205 15:58332059-58332081 GTGAGGAGGGCTCTGGGAAGAGG - Intronic
1127850753 15:62909999-62910021 AAGGGAAGGGCTTCAGAAAGGGG - Intergenic
1127870561 15:63069397-63069419 GAGGAAAGGGGTTCTGGAAGAGG + Intronic
1127951138 15:63807377-63807399 GAGGAAATGGCTTTGTGAGGTGG - Intronic
1127964954 15:63916464-63916486 GAGGGAAGGGCAGCGGGGAGGGG - Intronic
1128372923 15:67053678-67053700 GAGGAAAAGGCTTCAGGAAGTGG + Intergenic
1128705015 15:69832272-69832294 GAGGGAAGGGAGAAGGGAAGGGG + Intergenic
1129001646 15:72340242-72340264 AAGGGAATAGCATTGGGAAGGGG + Intronic
1129384017 15:75185778-75185800 GAGGGAAGGGAGTGGGGATGGGG + Intergenic
1129414325 15:75366829-75366851 ATGGGAAGGGCCCTGGGAAGGGG + Intronic
1129692436 15:77721411-77721433 CAGGGAAGGGCTTTGGGAGGAGG - Intronic
1130411285 15:83650665-83650687 GAGGGAAGGGGTGAGGGAAGAGG + Intergenic
1130989168 15:88865638-88865660 GAGGGAAGGGCTTTGGGCAATGG - Intronic
1131095445 15:89651816-89651838 GAAGTGAGGGCTTTGGGAAGTGG + Intronic
1131303876 15:91224142-91224164 CAGGGATGGGCTGTGGGCAGAGG + Intronic
1131370538 15:91877632-91877654 TAGGGAAGGCCTTTGGGAAGGGG + Intronic
1131399354 15:92112160-92112182 GAGAGAAGAGCTTTGGGATGGGG + Intronic
1132087550 15:98920865-98920887 GAGCAGAGGGCTTTGGGAAAGGG - Intronic
1132214276 15:100051183-100051205 GAGGGAAGGGAATTTGGGAGCGG + Intronic
1132609788 16:809724-809746 GACGGAAGGGCTGAGGAAAGCGG + Intronic
1132734196 16:1377557-1377579 GAGGGAAGGGCCCGGGGCAGCGG - Intronic
1132742544 16:1422353-1422375 GAGGGTAGAGGCTTGGGAAGTGG - Intergenic
1132744609 16:1431516-1431538 GTAGGAAGGGCTGTGGGGAGCGG - Intergenic
1132840601 16:1976869-1976891 GACAGCAAGGCTTTGGGAAGAGG - Exonic
1133350183 16:5096159-5096181 ATGGGAAGGGCTTGGGGAACAGG - Intronic
1133365913 16:5210070-5210092 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1133427229 16:5703250-5703272 GGGGTAAGGGCATTGGGAAAAGG + Intergenic
1133595275 16:7285008-7285030 GAGGGAAGGCTTTTCTGAAGAGG - Intronic
1134884309 16:17776181-17776203 GAGGGAAATGCTTTGGGATTGGG - Intergenic
1135696942 16:24596639-24596661 GATTGATGGGCTCTGGGAAGAGG - Intergenic
1135947977 16:26882143-26882165 GATGGAAAGGCTTGGGGGAGAGG + Intergenic
1136332250 16:29587909-29587931 AAGTAAAGGGCTTTGTGAAGGGG - Intergenic
1136631634 16:31492379-31492401 GATAGAAGGGGTTTGGGAGGTGG - Intronic
1137813944 16:51380261-51380283 GTTGGTAGGGCTTTGGGATGTGG + Intergenic
1137844039 16:51669445-51669467 GGGGAAAGTTCTTTGGGAAGGGG + Intergenic
1137887764 16:52125216-52125238 TGGGGAAAGGCTTTGTGAAGAGG - Intergenic
1138026069 16:53523451-53523473 GAGGGAAGGGAGTGGGGAGGAGG - Intergenic
1138077150 16:54053753-54053775 GAAGGCAGGGGTTTGGGCAGGGG - Intronic
1138104489 16:54280417-54280439 GAGGGGAGGGCTTAGGGAGGAGG + Intergenic
1138552196 16:57754079-57754101 GAGGGGAGGGTCCTGGGAAGGGG - Intronic
1138553498 16:57759509-57759531 AATGGAAGGTCTGTGGGAAGGGG - Intronic
1138725891 16:59138982-59139004 GAGGAAAGGCCTTTGCTAAGGGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139496707 16:67325644-67325666 GAGGGTAGGGGTTAGGGATGCGG + Intronic
1139514049 16:67443038-67443060 GTGGGTGGGGCTGTGGGAAGTGG - Intronic
1139529098 16:67533517-67533539 GAAGGAAGGGCTTAAAGAAGAGG + Intronic
1139579174 16:67862047-67862069 GAGGGAATGGCTTAGGGAGATGG + Intronic
1139633283 16:68243511-68243533 GAGGCAGGGGCTTTGGGAGTGGG + Intergenic
1140055856 16:71525151-71525173 CAGTGAAGGACTTTGGGCAGAGG - Intronic
1140886499 16:79249057-79249079 GAGACAGGGCCTTTGGGAAGTGG + Intergenic
1141207637 16:81945670-81945692 GAGGGAATGGCTTTAGGAGGAGG + Intronic
1141262731 16:82468490-82468512 GTGGGTAGGGTCTTGGGAAGTGG + Intergenic
1141437268 16:84007384-84007406 CAGGCAAGGGCCTTGGGAATTGG - Intergenic
1141762482 16:86038016-86038038 GAGGGAAGGTCTCCGGGATGAGG + Intergenic
1141917476 16:87109590-87109612 GTGGGTAGGGGCTTGGGAAGTGG + Intronic
1141988424 16:87594858-87594880 CTGGGCAAGGCTTTGGGAAGGGG - Intergenic
1142226244 16:88878991-88879013 GAGGTCACGGCCTTGGGAAGCGG - Intronic
1142608617 17:1095982-1096004 GTGGGAGGGGCTCTGGGGAGTGG + Intronic
1142978576 17:3658986-3659008 GAGGGGAAGGTTTGGGGAAGTGG + Intronic
1143056315 17:4164676-4164698 GAGGGAACGTCTTGGGAAAGGGG - Intronic
1143094778 17:4472694-4472716 TAGTGAATGGCTTTGGGGAGGGG + Intronic
1143406201 17:6678560-6678582 GAGGGTCAGGCTCTGGGAAGGGG - Intergenic
1143476325 17:7205698-7205720 GGGGGACGGGCTGTGGGATGGGG - Intronic
1143476333 17:7205717-7205739 GGGGGACGGGCTGTGGGATGGGG - Intronic
1143501503 17:7342091-7342113 GAGGGAAGGGGTCTGGGATGAGG + Intronic
1143573610 17:7776739-7776761 AAGGACAGGGCTTTGGGACGTGG + Intronic
1143657241 17:8302494-8302516 GCGGGTAGGGACTTGGGAAGTGG + Intergenic
1143812072 17:9479943-9479965 GAGGGAAGGGCATAGGCAAAGGG - Intronic
1144147997 17:12416589-12416611 GGAGGTGGGGCTTTGGGAAGTGG - Intergenic
1144568710 17:16381279-16381301 GAGGGGAGGGCGTGGGGGAGGGG + Intronic
1144682536 17:17205371-17205393 GACTGAAGGGCTCTGGGGAGAGG - Intronic
1145199855 17:20933739-20933761 GAGGCAAGCGTTTAGGGAAGTGG + Intergenic
1145404168 17:22571039-22571061 GGGGGAAGGTTTTTGGGTAGAGG + Intergenic
1146215424 17:30975499-30975521 GAGGGCAGGGGTTTGGGTATGGG - Intronic
1146224360 17:31052758-31052780 GAAGGAAAGGCTTTGGCAGGGGG + Intergenic
1146241405 17:31231476-31231498 GTGGGCAGGGGTTTGGGGAGTGG - Intronic
1146356850 17:32142026-32142048 GGGTGACGGGCTTTGGGGAGTGG + Exonic
1146372211 17:32272291-32272313 GAGGGCAGGGAACTGGGAAGGGG - Intronic
1146610928 17:34304374-34304396 GAGGGCATGGCTTTAGGAAGTGG + Intergenic
1147215538 17:38896994-38897016 GTGGGAGGCCCTTTGGGAAGCGG - Intronic
1147652162 17:42068879-42068901 CAGAGAAGGGCTCTGGGGAGGGG + Intergenic
1147655700 17:42089449-42089471 GAGAGAAGGGCTTGGGGGAGGGG - Intergenic
1147656373 17:42093336-42093358 GAGGGAAGGGTGTTGGGACTTGG - Intergenic
1147780130 17:42935017-42935039 GAGGGAAAGACGATGGGAAGAGG - Intergenic
1147875591 17:43618379-43618401 GAGAGGGGAGCTTTGGGAAGCGG - Intergenic
1147914420 17:43878068-43878090 CAGGGTTGGGCTTTGGGGAGGGG - Intronic
1147948763 17:44095499-44095521 GAGGGAGAGGCTGTGGGAATGGG + Intronic
1148283716 17:46369662-46369684 GAAGGAAGGGCTTTGAGTGGGGG - Intergenic
1148305934 17:46587579-46587601 GAAGGAAGGGCTTTGAGTGGGGG - Intergenic
1148790427 17:50169558-50169580 TAGGGAAAGGGTTTGGGAACTGG - Intronic
1149062070 17:52434349-52434371 GAGGTAAAGTCTTTAGGAAGTGG + Intergenic
1149558928 17:57594312-57594334 GAGGGTGGGGCTGGGGGAAGGGG + Intronic
1150363021 17:64554423-64554445 GAGGGAGTGGCTATGGGGAGAGG + Intronic
1150828687 17:68499158-68499180 GTGTGAAGGGCATTGGCAAGAGG - Intergenic
1150947800 17:69765922-69765944 GAGGGAAGGGGATTGTGGAGGGG - Intergenic
1151770675 17:76158477-76158499 CACGGAAGAGTTTTGGGAAGTGG + Exonic
1151875351 17:76864976-76864998 GAGGGATGGGGTTTGGAAATGGG + Intergenic
1152469028 17:80480823-80480845 GCGGGAAGGGCTGAGGCAAGTGG - Intergenic
1152480694 17:80550291-80550313 GAGGAAAGAGCTTTATGAAGAGG - Intronic
1153054552 18:933253-933275 GAGGGAAAGGAGCTGGGAAGTGG + Intergenic
1153599954 18:6770767-6770789 GAGGGAAGAGGTGTGGGAGGTGG + Intronic
1153987909 18:10369140-10369162 GATGTAAGGGATGTGGGAAGAGG - Intergenic
1154170952 18:12049602-12049624 GAGAGAAGGGCCATGGCAAGAGG - Intergenic
1155162690 18:23208487-23208509 GAAGGAACGGCTGTGGGAAAAGG + Intronic
1155226954 18:23737379-23737401 GAGGGAAGGTGGCTGGGAAGGGG - Intronic
1155613874 18:27699796-27699818 GTGGGAAGTGCTTGGGGATGAGG - Intergenic
1155650425 18:28134348-28134370 GGGGGAAAGGCTGGGGGAAGGGG - Intronic
1155696263 18:28690574-28690596 GAGGGAAGGGCAAAGGGAACAGG + Intergenic
1155877006 18:31101281-31101303 GAGAGAAGGGCGGGGGGAAGTGG - Intronic
1156396910 18:36707216-36707238 GAGGGGAAGGCTTTAGGAACTGG - Intronic
1156527207 18:37778406-37778428 AAGGGAAGGGCTGGGGGAGGGGG - Intergenic
1156891747 18:42198224-42198246 GTGGGAAGGGCTTTTGAAAGGGG + Intergenic
1156916936 18:42472679-42472701 GAGGGAGGAGCATGGGGAAGTGG + Intergenic
1157164400 18:45344956-45344978 GAGGGAAATTCCTTGGGAAGAGG - Intronic
1157164969 18:45350420-45350442 GAGGGAAATTCCTTGGGAAGAGG + Intronic
1157513894 18:48297404-48297426 CAGGGAAGGGCAGTGGGGAGTGG - Intronic
1157580107 18:48769125-48769147 GAGGGAGGGGGTCTGAGAAGAGG - Intronic
1157583328 18:48786045-48786067 GAATGATGGGCTTTGGGATGAGG - Intronic
1158831390 18:61283393-61283415 GAGAGAAGGGGTTGGGGGAGTGG + Intergenic
1159545761 18:69838795-69838817 TAGGGAAGGGATTAGGGAAGGGG - Intronic
1159851750 18:73533782-73533804 GTGGGTAGGGGCTTGGGAAGTGG - Intergenic
1160358649 18:78250867-78250889 TAGGAGAGGACTTTGGGAAGTGG + Intergenic
1160809815 19:1008508-1008530 GAGAGAGGGGCTTGGGGCAGTGG - Intronic
1161238249 19:3208438-3208460 GAGGGATGGGCTGGGAGAAGAGG - Exonic
1161352582 19:3802092-3802114 GAGGGAAGGGACAGGGGAAGGGG - Intronic
1161424174 19:4193356-4193378 CAGAGAAGGGCTCTTGGAAGAGG + Intronic
1161678735 19:5668042-5668064 GAGGGGAGGGCATTAGGAAGGGG + Intronic
1162299930 19:9838660-9838682 GAGGGCAGGGGCTTGGGAGGGGG + Intronic
1163081871 19:14950143-14950165 GAGGGAAGGGGGCTGGGGAGGGG - Intronic
1163131063 19:15273303-15273325 GAGGGTAAGTCTTTGGGGAGAGG - Intronic
1163501699 19:17680118-17680140 GAGGGAGGGGATTCGGGAAGGGG + Intronic
1163777004 19:19224713-19224735 GAGGGAGGGGCTCGGTGAAGGGG - Intronic
1164292372 19:23879939-23879961 GAGAGAAGGACTTGGAGAAGAGG + Intergenic
1164726696 19:30470091-30470113 GAGGGAGGGGTTTGGGGAGGAGG + Intronic
1165202170 19:34153937-34153959 GAGGGATGGGAATTGGAAAGGGG + Intergenic
1165355895 19:35303856-35303878 GAGGGAATTGCTTAAGGAAGGGG - Intronic
1165453782 19:35899660-35899682 GTGGGAAGGAGTTTGGGAACTGG - Intronic
1166205202 19:41264844-41264866 GAGGAAAGGGCTGTGGGACGCGG + Intronic
1166544592 19:43626452-43626474 GAGGGAAGAGCTTTGGGAGGAGG - Intronic
1166549617 19:43656606-43656628 GAGGTAACGGCTTCGGGAATAGG + Exonic
1166794988 19:45420554-45420576 GAGGGAGGAGGTGTGGGAAGAGG - Intronic
1167256938 19:48436230-48436252 GCGGGTAGGGGCTTGGGAAGCGG + Intronic
1167295210 19:48645654-48645676 GGGGGCAGGGCGTTGGGCAGGGG - Exonic
1167303903 19:48696148-48696170 GAGAGCAGGGATTTGGGACGTGG + Intronic
1167586603 19:50378889-50378911 AGGGCAGGGGCTTTGGGAAGAGG + Intronic
1167664843 19:50818059-50818081 GAGGGCGGGGCCTCGGGAAGCGG + Intergenic
1167677183 19:50894631-50894653 GAGGAAAGGGCTTGGGCTAGGGG - Intergenic
1167703078 19:51062297-51062319 CAGGGAAGGCCTTTCTGAAGAGG - Intronic
1168075275 19:53978043-53978065 GAGAGAAGGGGTTTGGGGAAGGG + Intronic
1168153496 19:54461125-54461147 GAGGGATGGGATTGGGGAGGAGG + Exonic
1168267211 19:55229564-55229586 GTGGGCAGGGCCTTGGGCAGAGG - Intergenic
1168267962 19:55232466-55232488 GAGGGCAGGCCCTGGGGAAGTGG + Intronic
1168342512 19:55633434-55633456 GAGGGAAGGCAGGTGGGAAGAGG + Intergenic
1168401519 19:56088296-56088318 GCGGGAAGGGCTTCGGGCACGGG - Exonic
1168613608 19:57820268-57820290 GCGGGTAGGGGCTTGGGAAGTGG + Intronic
1168617505 19:57850392-57850414 GCGGGTAGGGGCTTGGGAAGTGG + Intronic
1168642155 19:58037843-58037865 GAGGCAGGGGCTTTGGGCCGTGG - Exonic
925178202 2:1799518-1799540 GAAGGAGGGGTTTTGGAAAGTGG + Intronic
925180779 2:1815683-1815705 GGGGGCAGGGCATGGGGAAGGGG - Intronic
925258792 2:2511945-2511967 GTGGGAGGGGCTTGGGGAAAGGG + Intergenic
925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG + Intergenic
925966516 2:9071825-9071847 AAGGGAATGGTTTTGTGAAGTGG - Intergenic
926025854 2:9544108-9544130 GAGGGTAGGGTATTGGGTAGAGG - Intronic
926087846 2:10031277-10031299 GAGGGCAAGGCTTGGGGCAGGGG + Intergenic
926501982 2:13667071-13667093 GAGAGAAGAGTTTTAGGAAGTGG - Intergenic
926794307 2:16606344-16606366 AAGAGAAGGGCATCGGGAAGAGG - Intronic
926823753 2:16881912-16881934 GAGGGAAGAGATTGGAGAAGTGG + Intergenic
927337581 2:21942888-21942910 CACGGGAGGGCTTTGGGAAGTGG + Intergenic
927440348 2:23111800-23111822 GAGGGGAAGGGATTGGGAAGGGG - Intergenic
927460784 2:23296560-23296582 GAGGGAAGCGATTTGGGAGGAGG + Intergenic
927846875 2:26476571-26476593 GAGGGAAGGGGTGGGGGAAGGGG - Intronic
927846882 2:26476583-26476605 GGGGGAAGGGGTGAGGGAAGGGG - Intronic
927846899 2:26476619-26476641 GGGGGAAGGGGTGGGGGAAGGGG - Intronic
927846918 2:26476655-26476677 GGGGGAAGGGGTGGGGGAAGGGG - Intronic
927846925 2:26476667-26476689 GGGGGAAGGGGTGGGGGAAGGGG - Intronic
927846944 2:26476703-26476725 GGGGGAAGGGGTGGGGGAAGGGG - Intronic
927870046 2:26617653-26617675 GAGGGAGGGGCTCAGGGCAGTGG + Intronic
927929085 2:27032832-27032854 GAGCGAAGAGCATCGGGAAGAGG - Intergenic
928022541 2:27715831-27715853 GAGGGAAGGGGTGTGGGGAGGGG - Intergenic
928111836 2:28516867-28516889 GAGGTAAGGGCTTTGGCTGGTGG + Exonic
928188241 2:29135463-29135485 GAAGACAGGGCTTTGGGAGGAGG - Intronic
928205060 2:29278134-29278156 CAGGGAAGGGCTTGAGGATGTGG + Intronic
928301756 2:30131534-30131556 CAAGGAATGGCTTTGGCAAGTGG - Intergenic
928953489 2:36836706-36836728 GTGGGCAGGGGCTTGGGAAGCGG + Intergenic
929321100 2:40544390-40544412 GTGGGTAGGGGCTTGGGAAGTGG + Intronic
929437270 2:41938409-41938431 CAGGGAAGGGCTATGGTATGCGG - Exonic
929437433 2:41939246-41939268 CAGGGAGGGGCTGTGGGAGGAGG + Intronic
929856516 2:45642703-45642725 GAGGTGAGGGTTGTGGGAAGTGG - Intergenic
930024124 2:47020138-47020160 CAGTGAAGGGCTGTGGGGAGCGG + Intronic
930032301 2:47065937-47065959 GAGGGGAGGGGCTGGGGAAGGGG - Exonic
930634161 2:53786774-53786796 GCGGGAATGGCTTCAGGAAGCGG + Intronic
930737833 2:54797660-54797682 CAGCTAAGGTCTTTGGGAAGTGG + Intronic
931054036 2:58448273-58448295 CAGGGAAGGCCTATGGGAGGAGG - Intergenic
931488361 2:62716770-62716792 GAGCAAAGGGCCTCGGGAAGAGG - Intronic
932219225 2:69987153-69987175 GAGGGGAAGGCATTGGGAGGAGG + Intergenic
932771882 2:74505106-74505128 GAGGGAAGGGGAGTGGGATGGGG + Exonic
932817581 2:74874203-74874225 GAGGGAAGAGGGGTGGGAAGGGG + Intronic
933165731 2:79072562-79072584 GAGGGAAGGACCCTGGGAGGAGG + Intergenic
933273552 2:80259495-80259517 GAAGGAAGGTCATTGTGAAGAGG - Intronic
934014599 2:87866640-87866662 GAGGGAAGGGGGGTGAGAAGGGG - Intergenic
934180201 2:89612555-89612577 GAGGGAGGGGCTGGGGGAAGCGG - Intergenic
934290493 2:91686815-91686837 GAGGGAGGGGCTGGGGGAAGCGG - Intergenic
934555078 2:95282797-95282819 GAGGGATGGACTTTGAGAATGGG + Intronic
935120015 2:100176220-100176242 GAGGGAAGGTGTTTGGGGAAGGG - Intergenic
935166996 2:100578632-100578654 GAGGGAAGGGTTGTGGGGAAAGG + Intergenic
935218248 2:100991186-100991208 GGGGGAGGGTCCTTGGGAAGGGG - Intronic
935308479 2:101759808-101759830 AAGGGAAGGGGGATGGGAAGGGG - Intronic
935675975 2:105595304-105595326 GAGGGCAGGCCAGTGGGAAGTGG - Intergenic
936034858 2:109102891-109102913 TAAGAAACGGCTTTGGGAAGTGG + Intergenic
936263578 2:110982331-110982353 GAGGGAAGGGCAAAGGGAAGCGG - Intronic
936509412 2:113133104-113133126 CATGGAAGGGCTTTGTGCAGGGG - Exonic
936970827 2:118174982-118175004 TTGGGAAGGGCTTTGGCTAGAGG + Intergenic
936987714 2:118327374-118327396 GAAGTAAAGGCATTGGGAAGGGG + Intergenic
937060932 2:118980021-118980043 AAGGGAATGGCTTTGGGAAGAGG - Intronic
937430282 2:121832286-121832308 GAGGGATGAACATTGGGAAGGGG + Intergenic
938310376 2:130285336-130285358 GAGGGCTGGGCTTGGGGAGGAGG + Intergenic
938639159 2:133262418-133262440 GTGGGAAGGGCTTAGAGAACGGG - Intronic
938791364 2:134679178-134679200 GAGGTAAGGGGCTTGGGCAGTGG + Intronic
938792944 2:134692771-134692793 GAGGGGGAGGCTTTGGGAGGTGG - Intronic
939774774 2:146370940-146370962 ATGGGAAGGGCTTGGGGCAGGGG + Intergenic
939844559 2:147227768-147227790 GTGGGCAGGAATTTGGGAAGTGG + Intergenic
940200077 2:151140719-151140741 GAAGGTGGGACTTTGGGAAGTGG + Intergenic
940200154 2:151141471-151141493 GAGGGAGGGGCTATGGGAATAGG - Intergenic
940809871 2:158230431-158230453 GAGGGGAGTACATTGGGAAGAGG + Intronic
941823229 2:169863958-169863980 CAGGGAAGGCCTTTCTGAAGAGG - Intronic
942247769 2:174023699-174023721 GACAGAAGGGCCTGGGGAAGGGG + Intergenic
942643194 2:178082535-178082557 GAGGGAAGGGCAAAGGGAACAGG + Intronic
943840556 2:192574625-192574647 CAGGGAAGGGGAATGGGAAGGGG + Intergenic
943983884 2:194594347-194594369 GTGGGTAGGGCTCTGGAAAGTGG - Intergenic
943987962 2:194647013-194647035 GAGGAAAGGGATCTGAGAAGAGG + Intergenic
944863387 2:203836782-203836804 GAAGCAAGGGATCTGGGAAGAGG + Intergenic
945188801 2:207166106-207166128 GAGGGAGGGAGTTTGGGGAGGGG - Intronic
945465883 2:210170879-210170901 GAGGGAAGGGGTCTAGGGAGGGG - Intronic
945493112 2:210478923-210478945 GAGGGAAGGGAGGGGGGAAGGGG - Intronic
945975212 2:216265076-216265098 AAGGGAAGGGGGATGGGAAGTGG + Intronic
946106634 2:217376050-217376072 CAGGGCAGACCTTTGGGAAGGGG + Intronic
946144200 2:217716491-217716513 GAGGGAAGTGGTGTGGGAAATGG + Intronic
946341582 2:219072989-219073011 GAGGTAAGGGCTTGGGAAAATGG + Intergenic
946358933 2:219207196-219207218 GAGGTAATGGGCTTGGGAAGGGG + Intronic
946389345 2:219405885-219405907 AGGGCAAGGGTTTTGGGAAGAGG + Intergenic
946392830 2:219426663-219426685 GAGGGGAGGGCGTGGGGAGGTGG - Exonic
946497904 2:220214500-220214522 GAGGGTAAGGGTTGGGGAAGAGG - Intergenic
946765588 2:223037121-223037143 GAGGGTAGGGGCTTGGGAAGTGG + Intergenic
946773287 2:223111406-223111428 TAGGGAGGGGCTTAGGGAATTGG + Intronic
947160406 2:227208559-227208581 GCGGGTAGGGGCTTGGGAAGTGG - Intronic
947216293 2:227753217-227753239 GCGGGTAGGGGTTTGGGAAGTGG - Intergenic
947373125 2:229468582-229468604 GCGGGTAGGGGCTTGGGAAGTGG - Intronic
947399255 2:229715031-229715053 GGGAGAAGCGCTGTGGGAAGGGG - Intergenic
947484932 2:230539398-230539420 GAAGGAAGGGCTCAGGGAAGGGG - Intronic
948274132 2:236695257-236695279 GAAGGCAGGGCTGAGGGAAGAGG + Intergenic
948352072 2:237349092-237349114 AAGGGAAGGGATATGGGGAGGGG - Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948526429 2:238573717-238573739 GGGAGAAGGGCCTTGGGATGAGG - Intergenic
948604104 2:239123759-239123781 GAGGTCAGGGCTGCGGGAAGAGG + Intronic
948828475 2:240585977-240585999 GAGGGAAGAGCTTGAGGGAGCGG - Intergenic
948853763 2:240720760-240720782 GAGGGAAGGGCCTGGAGGAGTGG - Intronic
1168807131 20:678240-678262 CAGGGAAGGACTCTGGGCAGTGG - Intergenic
1168949969 20:1790760-1790782 GAGGGAAGGACTTTGGCAGAGGG + Intergenic
1169073126 20:2745829-2745851 GAGGAAGGGTCCTTGGGAAGGGG - Intronic
1170601234 20:17843192-17843214 GAGGGCAGGCCATAGGGAAGGGG - Intergenic
1170880978 20:20296271-20296293 GAGGGAAGGGATGAGGGAAGGGG - Intronic
1170955128 20:20972847-20972869 GAAGGAAGGTGTCTGGGAAGGGG - Intergenic
1171014038 20:21523639-21523661 GAGGGAAGGATTTTGGGAAGCGG + Intergenic
1171467108 20:25337380-25337402 GAGGGCTGGGCTTGGGCAAGGGG - Intronic
1172097009 20:32465433-32465455 GGGGGAGGGGCTCTAGGAAGTGG - Intronic
1172231078 20:33336526-33336548 GAGGAAAGGGTTCTGGGCAGTGG + Intergenic
1172563528 20:35910251-35910273 AGGGGAAGGGCTTAGGGGAGGGG + Intronic
1172573335 20:35987184-35987206 GAGGGGAGGGCCTTGGGAAAAGG + Intronic
1172767427 20:37358312-37358334 CAGAGCTGGGCTTTGGGAAGGGG + Intronic
1173208687 20:41014993-41015015 GAGGGAAGAACTGAGGGAAGGGG + Intergenic
1173868634 20:46328613-46328635 GAGGGAGGGGCTGTGGAAGGAGG - Intergenic
1174173912 20:48633074-48633096 GAAGGAAGCGCTTAGGGCAGGGG + Intronic
1174212732 20:48892668-48892690 GTGGGATGGGCTATGGGAGGAGG - Intergenic
1174373211 20:50108090-50108112 GTGGGAAGGGCTTGCTGAAGGGG + Intronic
1174527587 20:51186009-51186031 CAGGTAAGGGGTTGGGGAAGGGG + Intergenic
1174735709 20:52963955-52963977 CAGGGAAAGGCTCTGGGAGGAGG - Intergenic
1175100537 20:56575834-56575856 GAGGGGAGGGTTTAGGGAGGAGG - Intergenic
1175127559 20:56763707-56763729 GAGGGAAGGGGGGAGGGAAGGGG + Intergenic
1175127566 20:56763719-56763741 GAGGGAAGGGGGGAGGGAAGGGG + Intergenic
1175203587 20:57294033-57294055 GGGGGAATGGTTTTGGGATGAGG + Intergenic
1175362592 20:58425302-58425324 GAGGGAGTGACTCTGGGAAGTGG + Intronic
1175447310 20:59032180-59032202 GAGGGAAGGGCTTCGCGAGCCGG - Intronic
1175565013 20:59967754-59967776 GAGGGAAGGGGAAGGGGAAGGGG - Intronic
1175595918 20:60232630-60232652 GAAGGAAGGGCTGTGGGAATTGG - Intergenic
1175921084 20:62450932-62450954 GAGGGAAGGGGTTCTGGGAGGGG - Intergenic
1175936624 20:62517237-62517259 GAGGAGTGGGTTTTGGGAAGTGG + Intergenic
1176132868 20:63503629-63503651 GAGGGAAGGGCTATTCAAAGAGG - Intergenic
1176242820 20:64083000-64083022 GAGGGCAGTGCTGTGGGCAGCGG - Intronic
1177189811 21:17838538-17838560 GAGGGAAATGCCTTGGGACGGGG + Intergenic
1177417730 21:20816236-20816258 GAGGGAAGAGATTTGAGGAGGGG - Intergenic
1178241309 21:30904130-30904152 GCGGGTAGGGGCTTGGGAAGTGG - Intergenic
1178992303 21:37366475-37366497 GAGGGTAGGGGCTGGGGAAGGGG - Intronic
1178992724 21:37367975-37367997 GAGGGAGGAGCTGGGGGAAGAGG - Intronic
1179371227 21:40807760-40807782 AAGGGAAGAGGGTTGGGAAGTGG + Intronic
1179373263 21:40826443-40826465 AAGGGAGAGGCTTTGGAAAGAGG + Intronic
1179394605 21:41026969-41026991 GAGATAAGTGCTTAGGGAAGAGG + Intergenic
1179481187 21:41679567-41679589 CTGGGAAGGGGTTTGGGAAGGGG + Intergenic
1179482433 21:41686684-41686706 GAGGCAGGGCCTTTGGGAGGTGG + Intergenic
1179538933 21:42071586-42071608 CCGGGTAGGGTTTTGGGAAGAGG + Intronic
1179896127 21:44364680-44364702 GAGGGAAAAGCTGGGGGAAGGGG + Intronic
1180051044 21:45331091-45331113 GAGGGAGGGGTTGTGGGAAAGGG + Intergenic
1180471355 22:15659302-15659324 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1180633021 22:17242785-17242807 GAGGGAAGTGATTTCAGAAGAGG + Intergenic
1180791308 22:18577111-18577133 GAGAGATGGGCTTGGGGGAGGGG - Intergenic
1181230429 22:21418200-21418222 GAGAGATGGGCTTGGGGGAGGGG + Intronic
1181248220 22:21516666-21516688 GAGAGATGGGCTTGGGGGAGGGG - Intergenic
1181418561 22:22779700-22779722 GAGGGAAGGGAAAGGGGAAGGGG + Intronic
1181924699 22:26348820-26348842 GAGGGAAGGGGGGAGGGAAGGGG + Intronic
1182079405 22:27518526-27518548 GAGGGAGGGGGCTTGGGAGGTGG - Intergenic
1182294359 22:29304528-29304550 GAGGGAAGGGCTGCTGGAGGTGG - Intergenic
1182560444 22:31154980-31155002 GAAGGAAGGGCTTGGGGTAGTGG - Intergenic
1182888584 22:33797278-33797300 GAGCTAAGGGCTTGGTGAAGGGG - Intronic
1183253061 22:36743979-36744001 AGGGGAAGGGGTTTGGGGAGGGG - Intergenic
1183269474 22:36851586-36851608 GAGGAGAGGGCTGTGGAAAGGGG + Intergenic
1183309309 22:37100905-37100927 GAGGAAAGGGCTTCTGGAGGTGG + Intronic
1183734394 22:39635849-39635871 GAGGGAAGGCCTCTAGGAGGAGG - Intronic
1183991696 22:41601213-41601235 GAGGGGTGGGCTCTGGGATGTGG + Intronic
1184652504 22:45925636-45925658 GAGGGAAGGGCTTTTCCAGGAGG - Intronic
1184672680 22:46023640-46023662 CAGGGAGGGGCCTTGGGCAGAGG - Intergenic
1184832066 22:46995193-46995215 GAGGGATGGGCTCCGGGGAGAGG - Intronic
1184995025 22:48199228-48199250 GAGGGAGGGTCCTGGGGAAGGGG + Intergenic
1185047946 22:48538309-48538331 GAGGGCAGGGCTCGGGGCAGCGG - Intronic
1185313506 22:50169529-50169551 GAGGGCGGGGCTGTGGGGAGCGG + Intergenic
949613416 3:5727779-5727801 GCGGGTAGGGGCTTGGGAAGTGG + Intergenic
949728283 3:7076342-7076364 GAGGGAAGGGCCTTGGTGGGAGG + Intronic
949936346 3:9119161-9119183 ATGGGAAGGACTTGGGGAAGAGG - Intronic
949937921 3:9131300-9131322 GAGGGAAAGGGGTTGGAAAGAGG + Intronic
949943217 3:9170821-9170843 AAGTGAAGGGCTTGGGGGAGAGG - Intronic
950041726 3:9924031-9924053 GTGGGAATGGACTTGGGAAGGGG - Intronic
950674651 3:14547359-14547381 GAGGGAAGGAATTTGGGGTGGGG + Intergenic
950790376 3:15466889-15466911 GAGAGAAGGGTCTTGAGAAGGGG - Intronic
950854289 3:16091107-16091129 GAAGGATGGGCTATGTGAAGAGG - Intergenic
951208270 3:19947018-19947040 GCGGGGAGGGATTCGGGAAGGGG + Intronic
951263509 3:20540086-20540108 GCGGGTAGGTGTTTGGGAAGAGG + Intergenic
951788489 3:26452210-26452232 CTGGAAAGAGCTTTGGGAAGGGG + Intergenic
951967651 3:28405274-28405296 GAGGTAAAGCCTTTGGGAGGTGG + Intronic
951982110 3:28576576-28576598 CAGGGAAGGGGGTTGGGGAGCGG - Intergenic
953925060 3:46978554-46978576 GAGGTAAGGGGATGGGGAAGGGG + Intronic
953928535 3:46994556-46994578 GAGGGAAGGGGCTTGGGACCAGG + Intronic
953947227 3:47160254-47160276 AAGGTAAGTGCTTTGGAAAGTGG - Intronic
954072618 3:48154035-48154057 GAGGGAAGGGCTTTAGGTGCTGG - Intergenic
954484815 3:50837771-50837793 GGTGGAAGGGGTTTGGGGAGGGG + Intronic
954514468 3:51160356-51160378 CAGGGAAGAGCTTTGGCCAGAGG + Intronic
954709662 3:52499203-52499225 GAGGAAGGGGCATAGGGAAGGGG - Intronic
954869457 3:53756662-53756684 GAGGGAAAGGCTTGGAGAATGGG - Intronic
955557503 3:60153796-60153818 GCTGGAAGGGCCTGGGGAAGGGG - Intronic
956447674 3:69341686-69341708 GAGGCAAGGCCTTTAGGAGGTGG + Intronic
956907343 3:73780463-73780485 GAGGAAAGGCCTGTTGGAAGAGG + Intergenic
957054474 3:75433522-75433544 ATGGGAAGGGCTTGGGGAACAGG - Intergenic
958472618 3:94540417-94540439 GAGTGGAGGGATTTGTGAAGAGG - Intergenic
960149448 3:114236057-114236079 GTGGGAAGGCCTTTTGCAAGTGG - Exonic
960734908 3:120768307-120768329 GAGGGAAGGCATCTGGGTAGAGG + Intronic
961094300 3:124141444-124141466 GAGGTAAGGGCATTTGGAAAAGG - Intronic
961280183 3:125760405-125760427 GAGGAAAGGACTTTGGGAATAGG - Intergenic
961300372 3:125918183-125918205 ATGGGAAGGGCTTGGGGAACAGG + Intergenic
961361924 3:126373427-126373449 AAGGAAAGGCCTGTGGGAAGGGG + Intergenic
961810989 3:129521567-129521589 GGGGCAAGGGCTCTGGGATGGGG - Intergenic
961874220 3:130009142-130009164 GAGGAAAGGACTTTGGGAATAGG + Intergenic
962056157 3:131873885-131873907 GAGAGAACAGCTGTGGGAAGAGG + Intronic
962249831 3:133829124-133829146 GAGGGAAGGCTTCTGGGAAAGGG - Intronic
963076664 3:141353538-141353560 AGGGAAAGGGCATTGGGAAGGGG + Intronic
963330627 3:143910690-143910712 AAGGGAAGGGCTTTGGAAAAGGG + Intergenic
963850674 3:150207497-150207519 GCGGGAAGGGAATGGGGAAGAGG - Intergenic
964359347 3:155878136-155878158 GAGGTGAGGTCTTTGGGAGGTGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
964627388 3:158772443-158772465 GAGGTAAGGGCTGTGGGTGGGGG + Intronic
964698128 3:159533238-159533260 AAGGCAAGGGGTTGGGGAAGGGG + Intronic
965596972 3:170419624-170419646 GCGGGAAGCACTTCGGGAAGCGG - Intronic
965762196 3:172091118-172091140 CAAGGACGGGCTTGGGGAAGTGG + Intronic
966463388 3:180202763-180202785 GAGGGGAGGACTATTGGAAGTGG - Intergenic
966739461 3:183218736-183218758 GAAGGAAGGGGGATGGGAAGAGG - Intronic
967316457 3:188155089-188155111 GAGGCAAGGGGTTGGGGATGGGG + Intronic
967768884 3:193312499-193312521 GAGGGAAAGGGTTTCGGAAAAGG - Intronic
968312691 3:197697139-197697161 CTTGGGAGGGCTTTGGGAAGGGG - Intronic
968921404 4:3523971-3523993 GGGGGAGGGGATTGGGGAAGGGG + Intronic
968923843 4:3536688-3536710 GGGGGAAGGGGTCTGAGAAGGGG - Intergenic
968947444 4:3672794-3672816 GAGGTGAGGACTTTGGGAGGTGG - Intergenic
968997287 4:3953832-3953854 ATGGGAAGGGCTTGGGGAACAGG - Intergenic
969017484 4:4113625-4113647 GAGGAAAGGACTTTGGGAATAGG + Intergenic
969050586 4:4370089-4370111 GAGGGAAGGGCAATGTGAAAAGG + Intronic
969064842 4:4470652-4470674 GAGAGAAGGCCTCTGGGAAGAGG + Intronic
969080720 4:4615949-4615971 GAGGGGAAGGCTTTGGGGAGAGG - Intergenic
969210202 4:5681465-5681487 GAGGAAGGGGCTTTGGGGATAGG + Intronic
969303802 4:6313518-6313540 GTGGGTAGGGGCTTGGGAAGTGG - Intergenic
969535800 4:7755490-7755512 GAGGGAAGGCATTTGGGAACTGG - Intergenic
969613477 4:8239690-8239712 GAGGCAAGGGCTTCCTGAAGCGG - Intronic
969736459 4:8994680-8994702 GAGGAAAGGATTTTGGGAATAGG - Intergenic
969795652 4:9526243-9526265 GAGGAAAGGACTTTGGGAATAGG - Intergenic
969816698 4:9692419-9692441 ATGGGAAGGGCTTGGGGAACAGG + Intergenic
969829071 4:9781074-9781096 GAGAGAGGGGCTGGGGGAAGCGG + Intronic
970056796 4:11983046-11983068 GATGGAAGGGCTGTGGAAATTGG - Intergenic
970566474 4:17336682-17336704 GACGGAGAGGCTGTGGGAAGTGG - Intergenic
970644005 4:18098571-18098593 GAGGGTTGGGCTGTGGGAAGGGG + Intergenic
971274387 4:25182130-25182152 AGGGGAAGGGCTTTGGTAAGGGG + Intronic
971448559 4:26778445-26778467 GAGGGAAGGGGGAAGGGAAGGGG + Intergenic
971577338 4:28292182-28292204 GAGGGGAGGACAATGGGAAGAGG + Intergenic
971806104 4:31358916-31358938 ATTGAAAGGGCTTTGGGAAGTGG + Intergenic
972602728 4:40587117-40587139 ATGGAAAGGGCTTTGTGAAGAGG + Intronic
972789702 4:42359093-42359115 GAGGAAAGGGCTTCCAGAAGGGG + Intergenic
972871508 4:43305437-43305459 GTGGGAAGGGTATTGGGAGGTGG + Intergenic
973019624 4:45186628-45186650 GAGGGAAGGAGGTGGGGAAGGGG - Intergenic
973533881 4:51861333-51861355 GAAGGAAGGGTTTTGTGGAGTGG + Intronic
973614554 4:52665572-52665594 CAGGGAAGGTCTCAGGGAAGAGG - Intergenic
973622234 4:52738378-52738400 CAGGGAAGGTGTTTGGAAAGAGG + Intronic
975004520 4:69269331-69269353 GAGAGTAGGGCTGAGGGAAGAGG - Intergenic
975012937 4:69378306-69378328 GAGAGTAGGGCTGAGGGAAGAGG - Intronic
975200531 4:71582959-71582981 GAGGTAGGGCCTTTGGGAGGTGG + Intergenic
975293526 4:72705587-72705609 GTGGGTAGGGGCTTGGGAAGTGG - Intergenic
975522191 4:75312991-75313013 GAGGCATGGGCTCTGGGGAGTGG + Intergenic
975607304 4:76168038-76168060 GAGGGAAAGGCTTAGTGGAGTGG + Intronic
976008098 4:80454859-80454881 GTGGGTAGGGGGTTGGGAAGTGG + Intronic
976721230 4:88170623-88170645 GAGGGCAGGGGTTTCAGAAGAGG - Intronic
977065155 4:92304865-92304887 GAGGGAAGGGTAGCGGGAAGGGG - Intronic
978417260 4:108489569-108489591 AAGGGCTGGGCTTTGCGAAGGGG - Intergenic
978606588 4:110486922-110486944 GCGGGTAGGGGCTTGGGAAGTGG + Intronic
978739213 4:112118930-112118952 AAGGGAAGGGATGGGGGAAGGGG + Intergenic
981050464 4:140304706-140304728 GAAGGCTGGTCTTTGGGAAGGGG + Intronic
981536521 4:145805948-145805970 GAAAGAGGGGGTTTGGGAAGGGG - Intronic
982342665 4:154319258-154319280 GAGGGGAAAGCTTTGTGAAGTGG + Intronic
982409761 4:155061373-155061395 GGGGGAAGGGCAGTGAGAAGTGG + Intergenic
983632990 4:169868610-169868632 GAGGGAAGGGTAGTGGGAATGGG - Intergenic
984091543 4:175381162-175381184 GAGGGTAGGGGCTTGAGAAGTGG - Intergenic
984164670 4:176293097-176293119 GAGGGAAGGTGCTTGAGAAGTGG + Intergenic
984881071 4:184410390-184410412 GGGGGAAGGGATTTGAGAAAAGG - Intronic
984918416 4:184743481-184743503 GAGGGGAGGGCAGAGGGAAGAGG + Intergenic
985471623 5:50522-50544 TAGGGAAGGGGTTAGGGTAGGGG - Intergenic
985777212 5:1851076-1851098 GAGGGGAGGGGTGAGGGAAGGGG + Intergenic
986371598 5:7085845-7085867 GAGGGAACTGCTAGGGGAAGCGG + Intergenic
986764351 5:10911354-10911376 GAGGGAGGACCTTTGGGAAGTGG + Intergenic
986946595 5:13029111-13029133 GAGGGAAGGGGAAGGGGAAGGGG + Intergenic
986984686 5:13487159-13487181 GAGGAAGGGCCTTTGGGAGGAGG + Intergenic
989236609 5:39155211-39155233 AAGTGAAGAGCTTTGGCAAGAGG - Intronic
989534245 5:42545763-42545785 AAGTGAAGGACTTTGGGAAAAGG - Intronic
989780870 5:45263105-45263127 GAAGAAAGGGCTTTTGGAATAGG + Intronic
990516317 5:56534190-56534212 TAGCCTAGGGCTTTGGGAAGGGG - Intronic
990712829 5:58604417-58604439 TAGGGAAGGACTATGGGGAGTGG + Intronic
992009492 5:72512499-72512521 GCGGGTAGGGGCTTGGGAAGTGG + Intergenic
992286619 5:75242137-75242159 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
992359605 5:76023556-76023578 TTGGGAAGGGCTAGGGGAAGTGG - Intergenic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
992863002 5:80930841-80930863 GAAGGTAGGGCCTTGGGGAGAGG - Intergenic
994261171 5:97660402-97660424 GTGTGAAGGCCTTTGAGAAGAGG - Intergenic
994381010 5:99071188-99071210 TAGCAAAGGGCATTGGGAAGTGG + Intergenic
994638092 5:102367542-102367564 GAGGGAAGGGGAAGGGGAAGGGG + Intergenic
994856423 5:105126857-105126879 GAAAGAAGGGCATAGGGAAGTGG - Intergenic
996336629 5:122390728-122390750 AAAGGCAGGGCTTTGGGAAATGG - Intronic
996796513 5:127353840-127353862 GAGGGAAGAGGTTTGGGGACTGG + Intronic
997201530 5:132012655-132012677 CAAGCAAGGGCATTGGGAAGAGG - Intergenic
997641716 5:135452740-135452762 GAGGGCAGGGCCTGGGGACGGGG + Intergenic
997850147 5:137325110-137325132 GAGGAAAGGTTTTTGGGATGGGG + Intronic
997896983 5:137727670-137727692 GAGGGAAGGCTTCAGGGAAGAGG - Intronic
997959049 5:138304891-138304913 GAAGGGAGGGCTTTAGGCAGGGG - Intronic
998106645 5:139473156-139473178 GAGGGAGGGACTTTGTGAGGTGG - Intergenic
998370693 5:141659240-141659262 GAGAGAAGTGCTTTGGGGAGTGG - Intronic
998945578 5:147336331-147336353 GAGGGAAGGGGTGGGGGATGAGG - Intronic
999224172 5:150006390-150006412 GAGGGATGGGGAGTGGGAAGTGG + Intronic
999262815 5:150247974-150247996 GAGGGATGGGCTCTGGGCTGGGG - Intronic
1001106680 5:168860528-168860550 GAGGGAAGGGTTCTTGGCAGGGG + Intronic
1002025972 5:176396536-176396558 GAGGGAAAGGTTGAGGGAAGGGG + Intronic
1002645445 5:180650547-180650569 GATGAAAGGGCTTTGGGGGGCGG - Intergenic
1003058856 6:2846829-2846851 CAGGGAAGGTCTCAGGGAAGAGG - Intergenic
1003112481 6:3261377-3261399 GTGGGCAGGGCTTTGGGCACTGG + Intronic
1003923477 6:10855616-10855638 GAGGGTAGGGCTGGGGGGAGGGG - Intronic
1004178940 6:13364668-13364690 GAGGGAAGGGCCGAGGGGAGAGG - Exonic
1004261134 6:14108873-14108895 GAGGGAAGGGCTGTGGTAATGGG + Intergenic
1004582757 6:16970234-16970256 GAGGGAAGGAGTGTGAGAAGGGG + Intergenic
1004667124 6:17758499-17758521 TAGAGAATGGGTTTGGGAAGTGG - Intergenic
1005456166 6:26021698-26021720 GCGGGAAGGGTTTGGGTAAGGGG + Exonic
1005489778 6:26336981-26337003 GATGGAGGGGCAGTGGGAAGAGG + Intergenic
1005570342 6:27139328-27139350 GAGGTAAGGGCCTGGGGAAAGGG + Exonic
1005996975 6:30937377-30937399 GAGAACAGGGCTTTGGGGAGGGG + Intergenic
1006093168 6:31640167-31640189 GAGAGAGAGGCTTAGGGAAGAGG + Intronic
1006194410 6:32229504-32229526 GAGGGAAGGGCCTTGGCTGGGGG - Intergenic
1006256431 6:32836180-32836202 CAGAGAAGGGCTTTGGGTATGGG - Intronic
1006508061 6:34503409-34503431 GAGGAAAGTGCTTTGTGAATCGG + Intronic
1006626464 6:35401532-35401554 GAGAGAAGGGCTGTGGCTAGAGG - Intronic
1007119413 6:39367754-39367776 GAGAGGAGGGCATGGGGAAGTGG - Intronic
1007167785 6:39841057-39841079 GGGGGAGGGGCGCTGGGAAGAGG + Intronic
1007167859 6:39841237-39841259 GGGGGAGGGGCGCTGGGAAGAGG + Intronic
1007616456 6:43182414-43182436 GAGGGAACGGGTTTGGGGGGAGG - Intronic
1007920701 6:45607070-45607092 GAGGGAAGAGCAGTGGGGAGGGG + Intronic
1009451959 6:63811746-63811768 AAGGGAAGGGATTTGGGTTGGGG - Intronic
1009591049 6:65671745-65671767 AAGGGCAGGGCTTTGGCAAGTGG - Intronic
1009750897 6:67878398-67878420 GCGGGTAGGGGCTTGGGAAGTGG + Intergenic
1009949678 6:70381062-70381084 ACGGGTAGGGCCTTGGGAAGTGG - Intergenic
1010119166 6:72353635-72353657 GAGGGAAGGTGATTGGGAAGTGG + Intronic
1010388364 6:75308682-75308704 GGGGGAAGGGCTGAGGGCAGTGG - Exonic
1010704547 6:79091971-79091993 GAGCGAAGTGCCTGGGGAAGCGG + Intergenic
1010816018 6:80359180-80359202 GAGGGAGAGGCTTTGGGAGCAGG - Intergenic
1011005984 6:82646062-82646084 GAGAGAAGGGCATAGGGAAAGGG + Intergenic
1011548896 6:88511048-88511070 GTGGGGAGGGATTGGGGAAGGGG - Intergenic
1012398364 6:98824917-98824939 GCGGGAAGGGGTTCGGGACGGGG - Intergenic
1013217946 6:108047269-108047291 GAGGGAAGGGCCTTGGAAAAGGG + Intronic
1013273616 6:108562592-108562614 GAGGGAAGGGCTCTGGTGTGGGG + Intronic
1013472673 6:110478506-110478528 GAGGGAAGCACTTTGGGAAATGG - Intergenic
1013532614 6:111033983-111034005 GCGGGTAGGGGCTTGGGAAGTGG + Intergenic
1014117948 6:117687598-117687620 CAGGCATGGGCTTGGGGAAGTGG + Intronic
1014766254 6:125410034-125410056 GAAGGAAGGGCACTGGGGAGGGG + Intergenic
1015209340 6:130678963-130678985 GAGAGAAGGGATGTAGGAAGAGG + Intergenic
1016350349 6:143160108-143160130 GAGGGAAGGACAGAGGGAAGAGG - Intronic
1017013809 6:150083901-150083923 GTGTGAAGGGCTGTGTGAAGTGG + Intergenic
1017074112 6:150601451-150601473 GGGGGTAGGGGTTTGGGAGGGGG - Intronic
1017200546 6:151749557-151749579 GAGGAAATGGCTATGGGGAGAGG - Intronic
1017259655 6:152371634-152371656 GAGGGGAGGGCAAGGGGAAGAGG + Intronic
1017772823 6:157656229-157656251 GATGGAAGGGTTGTTGGAAGAGG + Intronic
1017795726 6:157842593-157842615 GTGGGTAGGGGCTTGGGAAGTGG + Intronic
1017810312 6:157979655-157979677 GAGGGTAGGGAATTGGGAAGGGG - Intergenic
1017938663 6:159031408-159031430 GAGGGAAAGGTTGGGGGAAGAGG + Intergenic
1018021915 6:159769252-159769274 GAAGGAAGGGCTTAGGGATATGG + Intronic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1019798100 7:3067016-3067038 GAGAGCAGGGGCTTGGGAAGGGG - Intergenic
1020032929 7:4945551-4945573 GAGGGAAGGGCTGGGTGAGGCGG - Intronic
1020483052 7:8685783-8685805 GAGGGAATGGCGGGGGGAAGTGG + Intronic
1022504336 7:30901066-30901088 AAGGGAGGTGGTTTGGGAAGAGG - Intergenic
1022649492 7:32261396-32261418 GCGGGTAGGGGCTTGGGAAGTGG - Intronic
1022718099 7:32916686-32916708 GAGGGATGGATTTTGGGATGTGG + Intergenic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1023204000 7:37728656-37728678 GTGGGCAAGGCTTTGGGAAGGGG + Intronic
1023570052 7:41562510-41562532 GAGGGCAGGGCTTTGCCAACTGG + Intergenic
1023899548 7:44464964-44464986 GAGGGCAGGGCTCAGGGAAGTGG + Intronic
1024020606 7:45364448-45364470 GAGAGAAGGGCCCTGGGCAGAGG + Intergenic
1024036440 7:45510898-45510920 GTTGGAAGGGCTGTGGGGAGAGG + Intergenic
1024233117 7:47377802-47377824 GAGGGAAGGCCTTTGAAGAGGGG - Intronic
1024939413 7:54746489-54746511 GAGGGTGGAGCTGTGGGAAGAGG - Intergenic
1025028500 7:55537027-55537049 AAGGAAGGGGCTTTGGGGAGGGG + Intronic
1025624431 7:63207309-63207331 GCGGGCAGGGGCTTGGGAAGTGG + Intergenic
1025995090 7:66522880-66522902 GGGGGAAGGGCCTGGGGATGAGG - Intergenic
1026110920 7:67458448-67458470 GCGGGTAGGGGCTTGGGAAGTGG - Intergenic
1026583684 7:71638494-71638516 TAGGAAAGGGCTTCTGGAAGAGG + Intronic
1026589576 7:71683313-71683335 GAAGGAGTGGGTTTGGGAAGTGG - Intronic
1026839819 7:73664019-73664041 GAAGGAAGGGCTCTGGACAGAGG + Intergenic
1026969579 7:74459839-74459861 GATGGATGGGGTTTGGGGAGGGG + Intronic
1027267275 7:76501342-76501364 GTGGCAAGGGCTTGTGGAAGGGG - Intronic
1027319086 7:77001207-77001229 GTGGCAAGGGCTTGTGGAAGGGG - Intergenic
1028743115 7:94298701-94298723 GTGGGATGGGCTATGGGCAGGGG - Intergenic
1028755544 7:94429448-94429470 ATGGGAATAGCTTTGGGAAGTGG + Intronic
1029075977 7:97934455-97934477 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1029202409 7:98847891-98847913 GAGGGAGGGGCTTGTGGCAGTGG + Exonic
1029514299 7:101016262-101016284 GTTGGCAGGGCTTTGGGAATGGG + Intronic
1029588768 7:101493220-101493242 GAGGCAAGGGCAGGGGGAAGGGG - Intronic
1029846655 7:103418836-103418858 GGGGGAATGGATTTGGGTAGTGG - Intronic
1031866111 7:127039943-127039965 GAGGGGAGGGGATGGGGAAGGGG + Intronic
1031944350 7:127823349-127823371 GTGGGAATGGCCTTGGGAAGGGG + Intronic
1032413594 7:131719105-131719127 GTGTGAAAGGCCTTGGGAAGTGG + Intergenic
1032464162 7:132133422-132133444 GAGGGAAGGGATTTGGGGAGTGG + Intronic
1033243650 7:139701426-139701448 TAGGTGAGGGCTTTGGGAACAGG - Intronic
1033553162 7:142465795-142465817 GTGGAAAGGGCTTTGGTAGGAGG - Intergenic
1033733093 7:144197034-144197056 TAGTGAATGGCTTTGGGGAGTGG - Intergenic
1033743945 7:144295600-144295622 TAGTGAATGGCTTTGGGGAGTGG - Intergenic
1033749956 7:144353954-144353976 TAGTGAATGGCTTTGGGGAGTGG + Intergenic
1033811099 7:145012095-145012117 GAGATAGGGCCTTTGGGAAGTGG + Intergenic
1034082323 7:148290767-148290789 CAGGGAAGGGCTTTGTAAAGAGG - Intronic
1034529027 7:151684029-151684051 GAGGGTAGGGCTCTGGAATGAGG - Intronic
1034702092 7:153105456-153105478 GAGGGAAGGGAAAAGGGAAGGGG - Intergenic
1035019561 7:155792492-155792514 GAGGGAAGGATTATGGAAAGAGG - Intergenic
1035028844 7:155844396-155844418 GCCGGAAGGGCGTTGGGAGGCGG + Intergenic
1035147241 7:156831540-156831562 AAGGGAGGGGCATGGGGAAGAGG - Intronic
1035412747 7:158658203-158658225 GAGGGAAGGGCAGAAGGAAGAGG + Intronic
1035827073 8:2656270-2656292 GAGAGAAGGGCTCTGGAGAGAGG - Intergenic
1036175998 8:6539122-6539144 GAGGGAAGGGCTGGGAGATGCGG + Intronic
1036241541 8:7085884-7085906 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1036260297 8:7234233-7234255 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1036306320 8:7605290-7605312 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1036312334 8:7692789-7692811 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1036357166 8:8053275-8053297 GAGGAAAGGACTTTGGGAATAGG - Intergenic
1036557583 8:9873758-9873780 GAGGGAAGGGCTTCTGGGATAGG + Intergenic
1036831192 8:12021193-12021215 GAGGAAAGGACTTTGAGAATAGG + Intergenic
1036901403 8:12671978-12672000 GAGGAAAGGACTTTGGGAATAGG + Intergenic
1037074825 8:14701756-14701778 GAGGCAGGGGGTTTGGTAAGAGG - Intronic
1037764560 8:21764395-21764417 AAGGCAAGGGTTTTAGGAAGTGG - Intronic
1037907809 8:22725682-22725704 GCGGGAAGGGGAGTGGGAAGGGG - Intronic
1038198027 8:25385789-25385811 GAGAAAAGGACTTAGGGAAGGGG + Intronic
1038210694 8:25516888-25516910 GAGGGAAGCGCTTGGAGGAGCGG + Intergenic
1038265403 8:26035846-26035868 GAGACAAGGGCTTTAGGAGGTGG - Intronic
1038319824 8:26515396-26515418 GTGGGAGGCGCTTTAGGAAGCGG + Intronic
1039214935 8:35259310-35259332 GATGGAAGGGGATTGGGGAGTGG + Intronic
1039331857 8:36546477-36546499 GAGGGAAGGGCTAAAGGAATGGG + Intergenic
1039409797 8:37343180-37343202 GAGGGAAGGGGTATGGGGTGGGG - Intergenic
1039422534 8:37455025-37455047 GAGGAAAGGGCTTTGTGGGGAGG + Intergenic
1040694242 8:49977104-49977126 GAGGGAAGGTGGGTGGGAAGTGG + Intronic
1040987614 8:53313714-53313736 GAGGGGCAGGCTTTGGGAGGTGG + Intergenic
1041255104 8:55973147-55973169 GAGAGTAGGGCATGGGGAAGTGG - Intronic
1042039893 8:64579902-64579924 GAGGGAAGGGCAGTGGGGGGTGG + Intergenic
1042166371 8:65949833-65949855 CAGGGAAGGCCTTTCTGAAGAGG + Intergenic
1042533580 8:69837945-69837967 AAGGGAAGGGCTGTGGGAAAAGG - Intergenic
1042983637 8:74558377-74558399 GCGGGTAGGGGCTTGGGAAGTGG - Intergenic
1044803004 8:95976281-95976303 GAGGGAAGGCAGCTGGGAAGAGG + Intergenic
1045218829 8:100176859-100176881 GAGGGAGGGGTATGGGGAAGGGG - Intronic
1045727391 8:105190280-105190302 CTGGGAAGGGTTTTGGGTAGGGG - Intronic
1046583242 8:116119625-116119647 GTGGCAGGGGCTTGGGGAAGAGG - Intergenic
1046771172 8:118118113-118118135 AAGGGAAGAGCTTGGGAAAGAGG + Intergenic
1046932844 8:119858298-119858320 GATGGAGGGGCAGTGGGAAGGGG - Intergenic
1047042097 8:121007616-121007638 GCGGGAAGGGGCATGGGAAGTGG + Intergenic
1047254773 8:123206974-123206996 GGGGGAAGGGAAGTGGGAAGGGG - Intronic
1047705645 8:127496880-127496902 TAAGGTATGGCTTTGGGAAGAGG + Intergenic
1048048617 8:130796369-130796391 GAGGCAGGGGCTGTGGGATGAGG + Intronic
1048337033 8:133510264-133510286 CAGAGAAGCACTTTGGGAAGTGG - Intronic
1048442559 8:134470541-134470563 GTGGAAAGGGCTTTGGGATGTGG - Intergenic
1048459969 8:134613602-134613624 GAGGGACGGGTATTGGGAACGGG - Intronic
1049013937 8:139906535-139906557 TAGGGAAGGGCATAGGGGAGGGG + Intronic
1049272296 8:141702437-141702459 GACGCAGGGGCTTGGGGAAGGGG - Intergenic
1049478700 8:142809897-142809919 GAGGGAAGAGCTGAGGGCAGGGG + Intergenic
1049798418 8:144506801-144506823 CAGGGAGCGGCTTTGGGCAGCGG + Exonic
1049820792 8:144632029-144632051 GAGGGCAGGGCGGTGGCAAGGGG - Intergenic
1050405994 9:5309254-5309276 GTGAGAAGGGATGTGGGAAGAGG - Intergenic
1050487211 9:6146955-6146977 GAGGCAAGGTGTTGGGGAAGGGG + Intergenic
1050627995 9:7526360-7526382 GAGGAGAGGCCTTTGGGAGGTGG - Intergenic
1051376683 9:16409164-16409186 GGGGCAAAGGCTTTGGGAAAAGG + Intergenic
1051537427 9:18175968-18175990 GAGGGTAGGATTTAGGGAAGGGG + Intergenic
1051715464 9:19978383-19978405 GAGGGAAGGGCATTTGGAGCAGG - Intergenic
1052951860 9:34219833-34219855 GAGGGAAGGGGGAGGGGAAGGGG - Intronic
1053273252 9:36764852-36764874 GAGGGAAGGAATTTCGGAGGAGG + Intergenic
1053799556 9:41755712-41755734 GGGGGAAGGGGTCTGAGAAGGGG - Intergenic
1054187966 9:61967773-61967795 GGGGGAAGGGGTCTGAGAAGGGG - Intergenic
1054650549 9:67620808-67620830 GGGGGAAGGGGTCTGAGAAGGGG + Intergenic
1056104011 9:83329101-83329123 GAGGGATGGGCTGGGGCAAGTGG - Intronic
1056275826 9:84993198-84993220 GAGGAAATGGCTTTGGGAAGAGG - Intronic
1056771067 9:89478777-89478799 GAAGGAAGGGCCTTGGGGTGGGG - Intronic
1056821597 9:89845937-89845959 GAGGGAAGGTGTTTGGGTGGAGG + Intergenic
1057186095 9:93058434-93058456 GGGGGAAGGGTGTTGGGCAGAGG + Intergenic
1057404664 9:94758103-94758125 CAGGGAAGGGTTTTAGGAGGTGG + Intronic
1057521339 9:95762842-95762864 CCGGGAAGGGTTTGGGGAAGGGG + Intergenic
1057566270 9:96168655-96168677 GAGGGAAGGACTGTGGGATGTGG - Intergenic
1057700381 9:97359827-97359849 CAGGGAAGGCCCTTGGGGAGTGG - Intronic
1057855049 9:98595307-98595329 GAGGTAGGGCCTTTGGGAAGGGG - Intronic
1057874456 9:98743297-98743319 AGGGAAAGGGCTTTGGGGAGGGG - Intronic
1057969513 9:99540757-99540779 AAGGGCAGGGATTTGGGCAGCGG - Intergenic
1058067431 9:100565005-100565027 GTGGGAAATGCATTGGGAAGAGG + Intronic
1058139465 9:101342434-101342456 GAGGGAAGGGGAGGGGGAAGAGG + Intergenic
1058498227 9:105583125-105583147 AAGAGAAGGGGTTTGGGAATGGG + Intronic
1058541791 9:106019313-106019335 GAGAGAGGGGGTTGGGGAAGGGG + Intergenic
1058740617 9:107938873-107938895 GAGGGAAGGGCATGGGAAAAGGG + Intergenic
1058902676 9:109456049-109456071 GAGGGAAGAACTTTGAGAATCGG + Intronic
1059041404 9:110819175-110819197 TAGGCAAGGGCTTTGGCAAGGGG - Intergenic
1059142204 9:111864211-111864233 GAGAGAAGGGTCTTGGGAATTGG + Intergenic
1059782870 9:117548346-117548368 TAGGGAAGGCCTTCTGGAAGAGG - Intergenic
1059937922 9:119330329-119330351 GAGGGAAGAGCATGGGGGAGTGG - Intronic
1060201509 9:121654261-121654283 GAGGGGAGTGGATTGGGAAGGGG + Intronic
1060815319 9:126632220-126632242 GAGGGAAGAGTTGTGGGCAGGGG + Intronic
1061010348 9:127950910-127950932 GAGGGAAGGCCTGTGGGAAGTGG + Intronic
1061115443 9:128607819-128607841 GAGGGAAGGGATTAGGTAACTGG - Intronic
1061237592 9:129351654-129351676 GAGGAAAGGGCTAGGGGAGGAGG + Intergenic
1061256368 9:129455978-129456000 GAGGGAAGGGAGGGGGGAAGAGG - Intergenic
1061359124 9:130129929-130129951 GAGGGAAAGGATGTGGGAAGCGG - Intronic
1061507169 9:131037958-131037980 GAAGGAAGGACTTTGTGCAGTGG - Intronic
1062037214 9:134387814-134387836 GAGGCACGGGCTTGGGGAAAAGG - Intronic
1062397544 9:136358511-136358533 ACGGGAAGGGCTTGGGGGAGAGG - Exonic
1062539223 9:137034303-137034325 GAGGGAGGGGGCTTGGGAGGGGG + Intronic
1185756937 X:2659776-2659798 GAGGGAAGGGGAGGGGGAAGGGG - Intergenic
1185776002 X:2803541-2803563 GCGGGTAGGGGCTTGGGAAGTGG + Intronic
1186036671 X:5430326-5430348 GTGGGTAGGGGCTTGGGAAGTGG - Intergenic
1186134630 X:6505999-6506021 TAGGGCACGCCTTTGGGAAGAGG + Intergenic
1186816445 X:13242284-13242306 GCGGGTAGGGTCTTGGGAAGTGG - Intergenic
1186903910 X:14090496-14090518 TAGGGAAGGTCTTTGTGAGGAGG + Intergenic
1187682282 X:21779411-21779433 GAGTGAAAGGGTTAGGGAAGGGG - Intergenic
1187694545 X:21905419-21905441 GTGGGAAGGGGTTAGGGAGGGGG + Intergenic
1188881230 X:35494242-35494264 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1188982130 X:36735926-36735948 GAAGGAAGTGCATTGGGAATGGG - Intergenic
1190105441 X:47557456-47557478 CAGTGAGGGGCTTTGGGGAGGGG - Intergenic
1190584294 X:51922703-51922725 GAGGGAAAGGGATGGGGAAGGGG - Intergenic
1190748030 X:53338093-53338115 GGGGCAAGGCCTGTGGGAAGGGG + Intergenic
1190798706 X:53769298-53769320 GGGGCAAGGCCTGTGGGAAGGGG + Intergenic
1191006443 X:55715794-55715816 GTGGGTAGGGGCTTGGGAAGTGG + Intergenic
1191112170 X:56812459-56812481 GAGGGAAGGACTCTGGAAATGGG - Intergenic
1192162049 X:68795844-68795866 GAGGGAAGGTCTCTGTGAACAGG - Intergenic
1192432992 X:71125248-71125270 AAGGGAAGGGCTTTAGCATGTGG + Intronic
1192594616 X:72393658-72393680 GCTGGATGGGCTTTGGGAAAAGG + Intronic
1194355370 X:92876517-92876539 GAGGGAAGGGAGTTTGGGAGTGG - Intergenic
1194399004 X:93420249-93420271 GCTGGTAGGGCTTTGGGAAGAGG - Intergenic
1195272166 X:103242695-103242717 GAGGGAAGGGCTGGAGAAAGAGG - Intergenic
1195778985 X:108439901-108439923 GAGAGACCGGCTTTGGGGAGGGG + Exonic
1198428773 X:136545627-136545649 GAGGGAAGGCCTTTCTGAAAGGG + Intronic
1198458161 X:136837833-136837855 GATGGGAGGGCTTGGGGAACAGG + Intergenic
1198463178 X:136882376-136882398 CAGGGAAGGTCTATGTGAAGAGG + Intergenic
1198466655 X:136909810-136909832 GAGGGGAAGGCTTCGGGTAGGGG + Intergenic
1198534761 X:137574708-137574730 GAGGGGAGGTATGTGGGAAGGGG + Intronic
1199634989 X:149805938-149805960 GAGGAGAGGGCTTTGGTATGAGG + Intergenic
1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG + Intergenic
1200663726 Y:5993543-5993565 GAGGGAAGGGAGTTTGGGAGTGG - Intergenic
1201230141 Y:11856261-11856283 GAGGGAAGGGGAAGGGGAAGGGG + Intergenic
1201293995 Y:12448160-12448182 GCGGGTAGGGGCTTGGGAAGTGG - Intergenic
1201315398 Y:12640365-12640387 GAGGACAGGGGTTAGGGAAGAGG + Intergenic
1202044775 Y:20727151-20727173 GCAGGAAGGGCTCCGGGAAGTGG - Intergenic
1202388024 Y:24343533-24343555 GAGAGAAGGGATGTGGGGAGAGG + Intergenic
1202482763 Y:25326595-25326617 GAGAGAAGGGATGTGGGGAGAGG - Intergenic