ID: 1113378895

View in Genome Browser
Species Human (GRCh38)
Location 13:109786023-109786045
Sequence CGGGCGGCCCGTGCCGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113378889_1113378895 -10 Left 1113378889 13:109786010-109786032 CCGCTCGCCGGCCCGGGCGGCCC 0: 1
1: 1
2: 2
3: 46
4: 383
Right 1113378895 13:109786023-109786045 CGGGCGGCCCGTGCCGCGGCGGG 0: 1
1: 0
2: 2
3: 26
4: 249
1113378886_1113378895 -4 Left 1113378886 13:109786004-109786026 CCGTCTCCGCTCGCCGGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1113378895 13:109786023-109786045 CGGGCGGCCCGTGCCGCGGCGGG 0: 1
1: 0
2: 2
3: 26
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113378895 Original CRISPR CGGGCGGCCCGTGCCGCGGC GGG Exonic
900159667 1:1217485-1217507 GGGGCGGCGCGGGGCGCGGCCGG + Exonic
900201124 1:1407093-1407115 CGGGCGCCCAGTGCCCAGGCCGG + Intronic
900205592 1:1430832-1430854 CGGGCGGCCGGGGCCGGGGCCGG - Intergenic
900349667 1:2228492-2228514 CGGGGGGCCCGGGCGGCGGCGGG + Intergenic
900971112 1:5992860-5992882 CGCGAGGCCCGCGCTGCGGCAGG + Intronic
901706939 1:11081117-11081139 CGGGCAGCCGGTGCAGCTGCAGG - Exonic
902336732 1:15758606-15758628 GGGGCGGCGCGGGGCGCGGCCGG + Intronic
902476851 1:16692953-16692975 TTGGCGGCACGTGCCGCCGCAGG + Intergenic
902629286 1:17695237-17695259 CCTGCTGCCCGTGCCTCGGCTGG + Exonic
902911022 1:19597244-19597266 CGAGCCGCCCGGGCCCCGGCGGG + Intronic
903652440 1:24930145-24930167 CCGGCTGCCTGGGCCGCGGCGGG + Intronic
904768963 1:32870614-32870636 CGGGGGGCCGGCGCCGGGGCAGG - Intronic
905132193 1:35769651-35769673 CGGGCATCCCGTCCCGCCGCCGG - Intronic
906320715 1:44813696-44813718 GGGGCGCCCCGTGTCGCCGCCGG + Exonic
907540862 1:55214853-55214875 GCGGCGGCCCCTCCCGCGGCGGG - Exonic
908355700 1:63323393-63323415 AGGGCGGCGCGAGCGGCGGCGGG + Exonic
908572084 1:65420667-65420689 CAGGCTGCCCGGGCCGTGGCAGG + Exonic
910981247 1:92961552-92961574 AGCGCGGCGCGCGCCGCGGCGGG - Intergenic
913144505 1:115976469-115976491 GGGGCGGGCCGGGCCGGGGCGGG - Intergenic
915441841 1:155950459-155950481 CAGGCGGTCAGTGCCTCGGCTGG + Exonic
915629229 1:157138650-157138672 CGGCCGGCCCGGTCCGCTGCTGG + Intergenic
919101850 1:193105490-193105512 CGGACTGCCCGCGCCGCCGCCGG + Intronic
919929917 1:202214418-202214440 CGGGCGGCGCGGGCAGGGGCGGG + Intronic
922287620 1:224183546-224183568 CTGGCGGCCCGAGCGGCGACGGG - Intronic
922372996 1:224929885-224929907 CGGGCGGCGCGTGGGGCAGCCGG + Intronic
922496515 1:226062267-226062289 CGGGCGTCTCGGGCCGCGGCGGG - Intronic
922758125 1:228107982-228108004 CTGGTGACCCGTGCCGGGGCAGG + Exonic
924172439 1:241356756-241356778 CGGGAGCCCCGCGCCGGGGCTGG - Intronic
924801616 1:247332313-247332335 TGGGCGGCCCGGGCTTCGGCTGG - Intergenic
1064011866 10:11742317-11742339 GGGGCGGGGCGTGCCGGGGCGGG + Intergenic
1064011886 10:11742357-11742379 GGGGCGGGGCGTGCCGGGGCGGG + Exonic
1064645321 10:17454116-17454138 CGCGCGGCGCGGGGCGCGGCCGG + Intronic
1064764757 10:18659556-18659578 CGCGCAGCCCGCGCCGCGGTGGG + Exonic
1065102056 10:22340883-22340905 CCGGCGGCCCGCGGCGCGGAGGG + Intergenic
1065883710 10:30059166-30059188 CGGGCACCGCGGGCCGCGGCTGG - Intronic
1066240104 10:33525125-33525147 CTGGTGGCCCGGGTCGCGGCTGG + Intergenic
1067060923 10:43077522-43077544 CGGGCGCCTCGGGCCGGGGCTGG + Intronic
1071858010 10:89645162-89645184 CGGGCGGCGGGAGCCCCGGCTGG - Exonic
1073049181 10:100656674-100656696 CGGCCGGCTAGGGCCGCGGCGGG + Intergenic
1074088389 10:110226010-110226032 CGGGCTGCCCGCGGCACGGCGGG + Intronic
1074169724 10:110919971-110919993 CGGGCGGCCCGGACAGCGCCTGG + Intronic
1074182965 10:111079034-111079056 CCCCCGGCCCGCGCCGCGGCAGG - Exonic
1076722103 10:132397201-132397223 GGGGCGGCCTGGGACGCGGCGGG + Exonic
1076878790 10:133230227-133230249 TGGGCGGCCCGGGCGGCGTCTGG + Intergenic
1077495765 11:2885913-2885935 CGCGGGGGCCGGGCCGCGGCGGG - Intergenic
1077919150 11:6630347-6630369 CGGGCGGCTCCTGGCGCAGCAGG + Exonic
1078128683 11:8594011-8594033 CGGGCGGCCCGGGGCGCAGCCGG - Intronic
1081672743 11:44950752-44950774 CGCGCCGCCCGTGCCGGGCCGGG + Intronic
1083743511 11:64723089-64723111 CGGGCGGGCGGGGACGCGGCGGG - Exonic
1083747782 11:64745023-64745045 CGGGAGGCCAGGGCCGCGGGCGG + Intronic
1083876081 11:65525085-65525107 CCGGCCGCCCGAGCCGGGGCGGG - Exonic
1083936593 11:65872817-65872839 GGGGTGGGCCGCGCCGCGGCAGG - Exonic
1083999586 11:66288920-66288942 CGGGCGGGGCGCGGCGCGGCCGG - Intronic
1084070077 11:66728180-66728202 CGGGCGGGCGGGGGCGCGGCGGG + Intronic
1084165583 11:67373421-67373443 CGGGAGCCCCGCGCCGGGGCCGG - Intronic
1084175620 11:67420848-67420870 AGGGCGGCCGGGGCCGGGGCCGG + Intronic
1084284275 11:68121410-68121432 AGGGCGGGCTGTGACGCGGCCGG - Intronic
1087188689 11:95230716-95230738 CGAGCCGCCCGAGCCCCGGCCGG + Intronic
1089533855 11:119149219-119149241 CCGGCGGCCCGGGCCGGGGCGGG - Exonic
1091616195 12:2052906-2052928 CGGGCGGCGCGGGCAGGGGCGGG + Intronic
1096241397 12:49961980-49962002 CCGGCGGCAGCTGCCGCGGCGGG - Exonic
1096870293 12:54588504-54588526 CGGTGGGCCCGCGCTGCGGCGGG + Exonic
1097262416 12:57727063-57727085 CGAGCGGCCCGTGTCGCGCATGG + Exonic
1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG + Exonic
1102151015 12:110689170-110689192 GGGGCGGCCCGGGCGGGGGCGGG - Intronic
1103764500 12:123271174-123271196 GGAGCGGCCCGGGCCGCGCCGGG - Intronic
1105502937 13:20988522-20988544 CAGGCGGACCGGGCCGCGGCTGG + Exonic
1106517019 13:30464940-30464962 CGGGCGGCCCCCACCGCGGCGGG - Intronic
1112216349 13:97434381-97434403 CGGGCCGCCGGGGCCGGGGCTGG + Exonic
1112752567 13:102597239-102597261 CGGGCGGCCGGGGACGCGGGTGG + Intronic
1113311957 13:109140730-109140752 GGGGCGGCCGGTGCGGCAGCAGG - Exonic
1113312042 13:109141006-109141028 GGGGCGGCCCGGGCGGGGGCGGG - Exonic
1113378895 13:109786023-109786045 CGGGCGGCCCGTGCCGCGGCGGG + Exonic
1113874249 13:113584773-113584795 CGGGCGGTCCCGGCCGTGGCGGG - Exonic
1113896256 13:113766272-113766294 CGGGCGGCCTGGGCCGGGGAGGG + Intronic
1113981666 13:114281673-114281695 CGGGCGGCCGTTGCCGCGCGGGG + Exonic
1114259136 14:21025076-21025098 CGGGAAGCCCGAGCCGGGGCGGG - Intronic
1114655140 14:24311309-24311331 CGGGCGGCACGGGGCGCGGGTGG + Exonic
1116437587 14:44912267-44912289 CTGGTGGCCGGTGGCGCGGCCGG - Intergenic
1121546963 14:94769806-94769828 CGGGAGGCCCGCGCCGCCGGGGG + Exonic
1121803866 14:96797508-96797530 CGGGCGGCCGGGGCTGGGGCCGG + Intronic
1122065897 14:99174478-99174500 TGGGCGGCCCGGGCCCCGGGCGG - Exonic
1122221228 14:100240044-100240066 ATGGCGGGCCGTGCGGCGGCGGG + Intronic
1122719891 14:103716077-103716099 CGGGCGGCCCCTTCCCCAGCCGG + Intronic
1202905450 14_GL000194v1_random:68917-68939 AGGGCGGCCCGTTCAGGGGCTGG + Intergenic
1123710077 15:22980455-22980477 GGAGCGGCCGGGGCCGCGGCCGG - Intronic
1124613374 15:31224169-31224191 CGTGCTGGCCGTGCCGCAGCTGG + Intergenic
1124652457 15:31483856-31483878 CGTGCGGCGCGGGCGGCGGCGGG - Exonic
1124696750 15:31870317-31870339 CGGGGGGCGCGGGCCCCGGCTGG - Intronic
1125536067 15:40441626-40441648 CGGGCGTCCCGAGCTGCGGAGGG + Intronic
1127547487 15:60004476-60004498 CGGGCGGCACGGGACGCTGCGGG + Exonic
1128344153 15:66842881-66842903 CGGGCGGCCCGGGGCTCCGCGGG + Intergenic
1129162259 15:73753254-73753276 CGGGCGGCCAGTCCGGCGGGGGG - Intergenic
1129230653 15:74195396-74195418 CTGGCTGCCTGTGCCACGGCTGG - Exonic
1129330907 15:74826673-74826695 CAGGCGCCCGGTGCCCCGGCCGG + Exonic
1130076555 15:80695180-80695202 CGGGCCGCCCGCGCCTCGCCTGG + Intronic
1130370849 15:83284460-83284482 CAGGCGGCCCGGGACGCCGCTGG - Intronic
1132314294 15:100879409-100879431 CGAGCGCGCCGTGCGGCGGCTGG + Exonic
1132480675 16:164893-164915 GGGGCGGGCCGGGCCGGGGCGGG + Intronic
1132728978 16:1351480-1351502 CTTGCGGCCCGTGCAGCGCCGGG + Exonic
1132734703 16:1379652-1379674 CGGCCGCCCCGCGCCGCCGCCGG + Intronic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1133020533 16:2964931-2964953 CGGGCCGCCCGTGCCTCTTCTGG + Exonic
1133021712 16:2969769-2969791 CAGGCAGCCCGAGCCGCTGCTGG - Exonic
1137300591 16:47144218-47144240 CGGGCGCCCTGCGCGGCGGCTGG - Intergenic
1139633722 16:68245587-68245609 CGGGCGGGACGGGCCGCGGGCGG + Intronic
1142206477 16:88785335-88785357 CGCGCGGCCCGTCCCGCCTCCGG + Intergenic
1144547860 17:16215012-16215034 CGGGCAGCCGGTGCCCCGGGTGG - Intronic
1146439029 17:32877249-32877271 GCGGCGGCCAGGGCCGCGGCTGG - Intergenic
1147150373 17:38510568-38510590 CGGGAGGCCAGCGCCGCCGCCGG - Exonic
1147240856 17:39089703-39089725 TGGGCGTCCCGTGCCACTGCTGG + Intronic
1147382207 17:40062760-40062782 CGGGGGTCCCGGGGCGCGGCAGG + Intronic
1148930048 17:51120674-51120696 CGGGCGGCCCGGGGCGTCGCCGG + Exonic
1150326593 17:64263040-64263062 CCGGCGGCCCTTGGCGTGGCGGG - Intronic
1150488867 17:65561245-65561267 GGGGCGGCCCGGGGCGCGGCCGG - Intronic
1152751842 17:82065830-82065852 CGGGCGGCCCACGGTGCGGCGGG + Intronic
1153794510 18:8609801-8609823 CGGGCGGCCAGGGCCGCCGGAGG + Exonic
1153855140 18:9137346-9137368 CGGGCGCCCCTCACCGCGGCTGG + Intronic
1157565584 18:48676998-48677020 CGGGAGGCCGGGGCCGCGGCTGG + Intronic
1157614050 18:48976319-48976341 TGTGCGGCCCGAGCCGCGCCCGG - Intergenic
1160424190 18:78769162-78769184 CAGGCGGCCTGTGCCGCGGCCGG + Intergenic
1160668390 19:344395-344417 CGCGGGGCCCGGGCCGGGGCCGG + Intronic
1160791801 19:926698-926720 CGGGCGCCCGGTTCCTCGGCGGG + Intronic
1161468641 19:4445658-4445680 GAGTCGGCCCTTGCCGCGGCAGG + Intronic
1162100467 19:8335623-8335645 CGGGGGTCCCGGGGCGCGGCGGG + Exonic
1163557587 19:18001364-18001386 CGGGCGGCGCCTACCGCGGCGGG + Intronic
1164576702 19:29409345-29409367 CGGGCAGCCCCTCCTGCGGCAGG - Intergenic
1165236792 19:34428375-34428397 CGGGAGAACCGAGCCGCGGCCGG - Exonic
1165859521 19:38900006-38900028 CGGGGGGCCCCTGAGGCGGCGGG + Exonic
1166064350 19:40348394-40348416 CGGGCAGCCCGGGCCGGGGGAGG - Intronic
1166199341 19:41226347-41226369 CGGGCGGCCCGAGTGGGGGCGGG - Intronic
1166960536 19:46493759-46493781 CGGGCGGCCGAGGCCGAGGCCGG - Exonic
1167109044 19:47448053-47448075 CGGGCGGCCCAAGGGGCGGCTGG - Exonic
1168246952 19:55117272-55117294 CGGGCGGGCGGCGGCGCGGCGGG + Exonic
1168297403 19:55384155-55384177 CGGCCGGCCTGGGCCGCTGCCGG - Exonic
1202710866 1_KI270714v1_random:18779-18801 TTGGCGGCACGTGCCGCCGCAGG + Intergenic
925609897 2:5693687-5693709 CGGGCTGCGCGAGCGGCGGCGGG - Exonic
925927201 2:8678979-8679001 CGCGCGGGCCAGGCCGCGGCGGG - Exonic
925928242 2:8685577-8685599 AGGTCGGCCGGGGCCGCGGCTGG - Intergenic
926285251 2:11482811-11482833 CGAGCGCCCCGCGCCGTGGCCGG + Intergenic
927544423 2:23940380-23940402 AGGGCGGGGCTTGCCGCGGCCGG - Intronic
927702619 2:25277452-25277474 CCGGCGGACCCTGACGCGGCGGG + Intronic
927714155 2:25341740-25341762 CGGGCGGGGGGCGCCGCGGCTGG - Intronic
931515788 2:63050260-63050282 CGGGCTGCTCGTGCCGGCGCAGG - Intronic
932699998 2:73985462-73985484 AGGGCGGCCCGCGCCGCCGAGGG - Intergenic
932757914 2:74421688-74421710 CGGCCGGAACGTGCCGCGGGCGG - Intronic
934763801 2:96869595-96869617 CGCGCGGTCCGGTCCGCGGCCGG - Intronic
936412761 2:112275389-112275411 CGGGCGGCGAGAGACGCGGCCGG - Intergenic
937284524 2:120741708-120741730 GGCGCCGACCGTGCCGCGGCCGG + Intronic
937933023 2:127220105-127220127 CGGGCGGCCGGGGTCGCCGCCGG - Intergenic
938368843 2:130756268-130756290 CCGGCGCCGCGCGCCGCGGCCGG - Intronic
941021088 2:160408067-160408089 CGGGCGGCCCGGGGAGCAGCCGG + Intronic
941111770 2:161424248-161424270 CTGGGGGTCCGGGCCGCGGCGGG - Exonic
941819139 2:169827558-169827580 CGAGCTGCCCGCGCCGGGGCTGG + Exonic
943033753 2:182716019-182716041 CGGCCGGCGCCTGCCGCGGGCGG - Intronic
946242987 2:218368015-218368037 CGGGCGGGACGCGCCGGGGCGGG + Exonic
948158229 2:235801709-235801731 CAGGCGGCCTGTGCCCCGGGAGG + Intronic
948784893 2:240347212-240347234 CTGACTGCCTGTGCCGCGGCTGG - Intergenic
949014528 2:241702013-241702035 CGGGCGGGCGGTGCCGCGGGAGG - Intronic
1169065594 20:2692869-2692891 CGGGCGGCGGCGGCCGCGGCGGG + Exonic
1169437997 20:5610759-5610781 AGGGCGGCCCGGGACGCGGCGGG - Intronic
1171892375 20:30728349-30728371 AGGGCGGCCCGTGCAGGGCCTGG - Intergenic
1173251556 20:41366532-41366554 CGGGCGGCGCAGGCCGCGCCAGG + Exonic
1175736700 20:61392126-61392148 CGGGCAGCCCGTGCTGCAGGAGG + Intronic
1176014990 20:62926377-62926399 AGGGCGGCCCAAGCGGCGGCCGG + Intronic
1176089224 20:63311633-63311655 CGGGCGGCCCGAGGTGCTGCTGG + Exonic
1176110887 20:63410237-63410259 CGGGCGGCCCGTCATGTGGCAGG - Intronic
1176149554 20:63582864-63582886 AGGACGGCTCGTGCCGCGGAGGG + Intergenic
1176156925 20:63626756-63626778 CGGGCGGCGCGGGCGGTGGCGGG - Intronic
1176547906 21:8209314-8209336 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176555802 21:8253527-8253549 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176566839 21:8392347-8392369 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176574739 21:8436561-8436583 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176611353 21:8987854-8987876 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176624821 21:9083676-9083698 AGGGCGGCCCGTGCAGGGGCTGG + Intergenic
1178327856 21:31659957-31659979 CGGGCGGCACGGGCCGGGACCGG - Intronic
1178962010 21:37073676-37073698 CCCGCTGCCCGTGCCTCGGCCGG + Intronic
1179225090 21:39445848-39445870 CGGGCAGCAGGAGCCGCGGCGGG + Intronic
1180070627 21:45434302-45434324 CAGGCGGCCCGTGCTGGGACGGG + Intronic
1180568480 22:16695394-16695416 CTGGCGGCCAGTGCCCCTGCTGG - Intergenic
1180620578 22:17159175-17159197 CGGGCGGCGCGCGCGGCTGCGGG - Exonic
1180957321 22:19746821-19746843 TGGGTGGCCCGTGCTGCAGCAGG + Intergenic
1180960527 22:19760573-19760595 CGGGCCGAGCGAGCCGCGGCGGG + Intronic
1183401692 22:37608825-37608847 CGGGGGGGCGGTGCCGAGGCTGG + Exonic
1184146509 22:42614627-42614649 CGGGCGGTCGGGGCCACGGCGGG + Intronic
1184164800 22:42720840-42720862 CGGGCGGGCGGCGCGGCGGCCGG + Intronic
1184236673 22:43186857-43186879 CGGCGGGCACGTGCGGCGGCCGG - Intronic
1184276342 22:43411598-43411620 CGCGCGGCCCGGTCCGGGGCTGG + Intronic
1185255085 22:49827441-49827463 CGGGCGGCCCGCGAGGCGGCGGG + Intronic
1203252787 22_KI270733v1_random:125612-125634 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1203260843 22_KI270733v1_random:170698-170720 CGGACGGCCCGACCCGCGCCCGG - Intergenic
949414412 3:3799928-3799950 CTGGCCGGCCGCGCCGCGGCAGG + Intronic
950065487 3:10108328-10108350 AGGGCAGCCCGAGCCGCGGCGGG + Intergenic
950729858 3:14947835-14947857 CGGGCGGCCCCCGGCGCGGAGGG - Intronic
954223057 3:49166209-49166231 GGGGCGGCCCGCGAGGCGGCAGG - Intronic
954401263 3:50321106-50321128 CGGGCGGCCGGCGCCGCCGTGGG - Exonic
954632851 3:52056438-52056460 CGGGCGCCCGGAGACGCGGCTGG - Exonic
954694057 3:52410835-52410857 CGGGCGGCCAGTGCAGGGCCGGG - Exonic
955971982 3:64445406-64445428 CGGTCCGTCCGCGCCGCGGCCGG + Intronic
960120906 3:113947982-113948004 CGCGCCGCCCGGGCCGCGGCGGG + Exonic
960223712 3:115146866-115146888 CGGGCGGGACGTCCCGCAGCTGG - Intronic
964482801 3:157159637-157159659 CGGCCGGGGCGTGCCGGGGCGGG - Intronic
966886666 3:184380810-184380832 CGGCCGGCCCGGGCCCTGGCGGG + Intronic
968514879 4:1011787-1011809 CGGGCGGCTCGGGCCGGGTCGGG - Intronic
968775262 4:2536447-2536469 CGTGCTGCCCGTGCAGCAGCTGG - Intronic
969716056 4:8868701-8868723 CGGGCCGCCCGTGGTGCAGCTGG - Intronic
970319705 4:14863050-14863072 GGGGCGGCGCGTGCGGGGGCGGG - Intergenic
971756679 4:30717291-30717313 CGGGGCGCCCTTGCGGCGGCTGG - Intergenic
972396467 4:38663564-38663586 AGGGCGGCCCCGGGCGCGGCGGG - Intergenic
983577058 4:169271169-169271191 CGGGAGGCCGGCGCGGCGGCGGG - Intergenic
990003726 5:50922538-50922560 TGGGGGGCCCGGGCCGAGGCCGG - Intergenic
990308801 5:54518566-54518588 CGGGGGGACCGAGCCGCCGCGGG - Exonic
994072836 5:95620879-95620901 CGGGCGGCCGGGGGCGCGCCTGG - Exonic
995759050 5:115544600-115544622 AGGGCGGCCCGGGCGGCGGTGGG - Exonic
997980371 5:138464741-138464763 TGGGCGGCCCCTGCCCAGGCGGG + Intergenic
998467483 5:142357237-142357259 CGCTCGGCCCGTGGCCCGGCCGG - Intergenic
1002139979 5:177132719-177132741 CGGGCGAGCAGTGCCGGGGCGGG + Intergenic
1002559473 5:180071768-180071790 GGCGCGGCCCGGGCGGCGGCGGG + Exonic
1002666803 5:180831286-180831308 AGGGCGGGACGTGCCGGGGCCGG - Intergenic
1002715140 5:181222561-181222583 CCGGGGACCCCTGCCGCGGCCGG + Intronic
1003049416 6:2766049-2766071 CCGGCGGCCGCCGCCGCGGCGGG + Exonic
1004044583 6:12012116-12012138 TGGGGGGCGCGCGCCGCGGCGGG - Intronic
1008109630 6:47478159-47478181 CGCGCGGCCGCTCCCGCGGCTGG - Exonic
1008545069 6:52576982-52577004 CGGGCGGACCGGGCCGGTGCTGG - Intergenic
1018416713 6:163607993-163608015 CGGGCGGCCTGTACTGCTGCCGG + Intergenic
1019536165 7:1530916-1530938 AGCGGGGCCCGGGCCGCGGCGGG + Intronic
1019701261 7:2475961-2475983 CGGGCGGCCTGGCCCCCGGCTGG - Exonic
1020224962 7:6272613-6272635 CGCGCGGCCCGGGTCGCGGCCGG + Exonic
1022106384 7:27200298-27200320 GGGACGGCGCGGGCCGCGGCGGG - Intergenic
1023287069 7:38631252-38631274 CGGGCGGCCGGGGCTGGGGCCGG - Intronic
1026471055 7:70694411-70694433 CAGGCAGCCCGCGGCGCGGCTGG + Intronic
1027251324 7:76400548-76400570 CAGGCGGCCCCGGCAGCGGCTGG + Exonic
1027421178 7:78019562-78019584 GAGGCGCCCCGTGCGGCGGCGGG - Exonic
1029506497 7:100966538-100966560 GGGGCGGCCAGCGCCGAGGCCGG + Exonic
1031604281 7:123749201-123749223 CGCGCGGTCCGCGCCTCGGCCGG - Intergenic
1032174398 7:129611898-129611920 CGGCCGGCCCGCCCCGCAGCCGG + Intronic
1032237880 7:130140713-130140735 AGGGCGGTCCGTGCTGCGGGCGG + Intergenic
1033662053 7:143408873-143408895 CGGGCGGGCCGGGCGGGGGCGGG + Exonic
1033757033 7:144403970-144403992 CAGGCGGCCCCTCCCGTGGCGGG + Intronic
1034174826 7:149091492-149091514 CGGGCACCCCGGGCCCCGGCAGG + Intergenic
1035205463 7:157291536-157291558 CGGGCGGCCCGTCCCCCGGCTGG - Intergenic
1037788874 8:21919587-21919609 CCGGCGGCCCGGGCCGTGGTTGG - Intergenic
1038540348 8:28385867-28385889 TGGGAGGCCGGGGCCGCGGCGGG - Intronic
1039921310 8:41896265-41896287 CGGGCGGCCCGGGACGCGGTGGG - Intronic
1039921556 8:41897088-41897110 CGGGCGGCGCGCCCCGCGCCCGG + Intergenic
1039996883 8:42541758-42541780 CGGGCGGCGCGGGGCGGGGCCGG - Intronic
1042271579 8:66961657-66961679 CGGGCGGACCGGGCCGGGGCCGG - Exonic
1045098978 8:98825972-98825994 GGCGGGGCCGGTGCCGCGGCGGG + Intronic
1049409123 8:142464666-142464688 CCGGCGGCCCGGCCCGGGGCCGG - Exonic
1049570623 8:143368819-143368841 GGGGCGGCCCGCGGCGCGGCTGG - Intergenic
1049573208 8:143379082-143379104 AGGGCGGCCCGGGCCGCGGTGGG + Intronic
1049879436 8:145052231-145052253 CGGGCGGGGCGGGGCGCGGCTGG - Intergenic
1051876908 9:21802879-21802901 CGTGCGTCCCTTGCCGCCGCGGG + Intronic
1052991802 9:34522965-34522987 GGGGCGGCCTCTGCCGCGGGCGG + Exonic
1053010286 9:34628980-34629002 CAGGCGGCCCTGGCCTCGGCTGG + Intergenic
1056992346 9:91423723-91423745 CGGGCCTCCGGGGCCGCGGCGGG + Exonic
1059208260 9:112486796-112486818 CGGGCGGGCCGGGGCGGGGCCGG - Intronic
1060897337 9:127225864-127225886 CCGGCGGCCCGGGCAGAGGCCGG - Intronic
1061123155 9:128656609-128656631 GGGGCGGCCAGGGCCGCTGCAGG - Exonic
1061208490 9:129177545-129177567 GGGGCGCGCCGTGCGGCGGCTGG + Exonic
1061666161 9:132162019-132162041 CGGGCGGCCCCCCCGGCGGCCGG + Exonic
1061758584 9:132833786-132833808 CGGACGGCTCGTGCCGCATCAGG - Intronic
1061975881 9:134067884-134067906 CGGGCGGCGCGGGCGGCGGCGGG - Intronic
1062420972 9:136482718-136482740 ACGGCGGCCCGCGCCGCGTCCGG + Intronic
1203747984 Un_GL000218v1:54104-54126 AGGGCGGCCCGTGCAGGGGCTGG + Intergenic
1203469190 Un_GL000220v1:108763-108785 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1203477011 Un_GL000220v1:152735-152757 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1203561740 Un_KI270744v1:63869-63891 AGGGCGGCCCGTGCAGGAGCTGG - Intergenic
1187173109 X:16870469-16870491 TGGGCGGAGCGTGCCGCGGCAGG + Intergenic
1187173257 X:16871022-16871044 CCGGCGGCCTGTGCCGCCACAGG - Intergenic
1189002921 X:36964073-36964095 CGGGCGGTCCAGGCCGCGGCGGG + Intergenic
1189391645 X:40581289-40581311 CGGGCCGCCGGGGCCGGGGCTGG + Intronic
1190324886 X:49200220-49200242 AGGGCGGCGCGGGGCGCGGCGGG + Exonic
1198683361 X:139204351-139204373 CGAGCGGCTCCTCCCGCGGCCGG - Intronic
1199794343 X:151180229-151180251 CTGGCGGCCCGTGACCCTGCAGG + Exonic
1200058824 X:153475002-153475024 CGGGCGCCCCCTCCCCCGGCCGG - Intronic
1200092933 X:153644259-153644281 CGGGCGCCCCGGGCCTCCGCCGG - Intronic
1201161332 Y:11169098-11169120 AGGGCGGCCCGTGCAGGGGCTGG + Intergenic