ID: 1113379008

View in Genome Browser
Species Human (GRCh38)
Location 13:109786321-109786343
Sequence CGCTGCCTCCTCGGGCTCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 529}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113379000_1113379008 -6 Left 1113379000 13:109786304-109786326 CCCCGGCTGCCTGCGGCCGCTGC 0: 1
1: 0
2: 3
3: 51
4: 513
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378996_1113379008 0 Left 1113378996 13:109786298-109786320 CCCCCTCCCCGGCTGCCTGCGGC 0: 1
1: 1
2: 4
3: 64
4: 603
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113379002_1113379008 -8 Left 1113379002 13:109786306-109786328 CCGGCTGCCTGCGGCCGCTGCCT 0: 1
1: 0
2: 9
3: 47
4: 502
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378991_1113379008 20 Left 1113378991 13:109786278-109786300 CCGGCGCGGGCGGTGGCCGCCCC 0: 1
1: 0
2: 1
3: 20
4: 200
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113379001_1113379008 -7 Left 1113379001 13:109786305-109786327 CCCGGCTGCCTGCGGCCGCTGCC 0: 1
1: 0
2: 6
3: 49
4: 579
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378994_1113379008 1 Left 1113378994 13:109786297-109786319 CCCCCCTCCCCGGCTGCCTGCGG 0: 1
1: 0
2: 4
3: 58
4: 596
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378998_1113379008 -2 Left 1113378998 13:109786300-109786322 CCCTCCCCGGCTGCCTGCGGCCG 0: 1
1: 0
2: 2
3: 24
4: 370
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378993_1113379008 4 Left 1113378993 13:109786294-109786316 CCGCCCCCCTCCCCGGCTGCCTG 0: 1
1: 0
2: 10
3: 174
4: 1429
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378997_1113379008 -1 Left 1113378997 13:109786299-109786321 CCCCTCCCCGGCTGCCTGCGGCC 0: 1
1: 0
2: 2
3: 54
4: 495
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378999_1113379008 -3 Left 1113378999 13:109786301-109786323 CCTCCCCGGCTGCCTGCGGCCGC 0: 1
1: 0
2: 1
3: 36
4: 412
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529
1113378990_1113379008 21 Left 1113378990 13:109786277-109786299 CCCGGCGCGGGCGGTGGCCGCCC 0: 1
1: 0
2: 2
3: 28
4: 232
Right 1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113379008 Original CRISPR CGCTGCCTCCTCGGGCTCTC GGG Exonic
900421239 1:2556855-2556877 CCCTGCTGCCTGGGGCTCTCGGG + Intronic
900519509 1:3098799-3098821 GGCTGCCTCCTTGGGCTCCTGGG + Intronic
900563992 1:3323508-3323530 CGCTGTCTCCCCGGCCTCCCTGG - Intronic
900656084 1:3758262-3758284 CGCTGCCACCTCTGCCTCCCGGG + Intronic
900795245 1:4703883-4703905 CACTGCCTCCCCGAGCTCCCTGG + Intronic
902468243 1:16631036-16631058 CGCAGCCTGCGGGGGCTCTCGGG - Intergenic
902526955 1:17065354-17065376 CACTGCCACCTCCGGCTCCCTGG - Intergenic
903213229 1:21830010-21830032 CGCTGCCACCTGGGCCGCTCGGG - Exonic
903433371 1:23326707-23326729 CGCTGCAACCTCCGCCTCTCAGG - Intronic
903515470 1:23908054-23908076 CACTGCAACCTCCGGCTCTCTGG + Intronic
903642481 1:24869514-24869536 CGCTGCAACCTCTGCCTCTCAGG + Intergenic
904004750 1:27357858-27357880 CGCAGGCTCCTCGGGCACCCTGG + Exonic
904760208 1:32797944-32797966 CACTGCCACCTCTGCCTCTCAGG + Intronic
905596464 1:39211803-39211825 CGCTGCAACCTCTGCCTCTCGGG - Intronic
905742436 1:40383970-40383992 CACTGCCTCCTCTGGCTCCCGGG + Intronic
905884812 1:41485893-41485915 CCCTGCCTCCTCTGGGGCTCTGG - Intergenic
906992202 1:50751417-50751439 CTCTGCCTCCTCCGCCTCCCAGG + Intronic
907435305 1:54441988-54442010 CACTGCAACCTCGGCCTCTCAGG - Intergenic
908295952 1:62713277-62713299 CACTGCAGCCTCGGCCTCTCTGG - Intergenic
908320217 1:62971486-62971508 CGCTGCAACCTCTGCCTCTCGGG - Intergenic
909106637 1:71418387-71418409 CACTGCATCCTCTGCCTCTCGGG + Intronic
909492306 1:76239073-76239095 AGCTGTCTCCTGGGGTTCTCAGG + Intronic
910541638 1:88365176-88365198 CCCTGCCTTCTCCGGCTCTGAGG + Intergenic
911052349 1:93681610-93681632 CGCTGGGCGCTCGGGCTCTCAGG + Intronic
912385462 1:109269140-109269162 CTCTGGCTCCTGGGCCTCTCCGG - Exonic
912418895 1:109530358-109530380 GGCTGCCTTCTCTGGCACTCTGG - Intergenic
912787902 1:112621835-112621857 CGCTGCAACCTCTGCCTCTCTGG + Intronic
913661182 1:121007652-121007674 CACTGCCACCTCTGCCTCTCAGG - Intergenic
914012549 1:143790832-143790854 CACTGCCACCTCTGCCTCTCAGG - Intergenic
914165282 1:145170352-145170374 CACTGCCACCTCTGCCTCTCAGG + Intergenic
914651178 1:149699441-149699463 CACTGCCACCTCTGCCTCTCAGG - Intergenic
914707797 1:150185441-150185463 CACTGCATCCTCTGGCTCCCGGG - Intergenic
915514238 1:156403494-156403516 CGCTGCAACCTCCGCCTCTCGGG + Intergenic
916008315 1:160681562-160681584 CTCTGCCTCCTGGGGCATTCAGG - Intronic
916588303 1:166166614-166166636 CGCTGCCGCCTCCTCCTCTCCGG - Exonic
917846854 1:179026517-179026539 GGCTGCCTCAACGGGCGCTCCGG - Intronic
919125159 1:193384393-193384415 CGCTGCAGCCTCTGCCTCTCAGG + Intergenic
920108798 1:203572773-203572795 TGCTGCCTCCTCCTGCTCCCAGG - Intergenic
920841508 1:209559292-209559314 CACTGCAACCTCTGGCTCTCAGG + Intergenic
921019045 1:211219837-211219859 CGCTGGCTCCGGGGGCACTCTGG - Intergenic
921104373 1:211960937-211960959 CACTGCCACCTCTGCCTCTCAGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921885393 1:220299884-220299906 CACTGCCACCTCTGCCTCTCAGG + Intergenic
923171483 1:231421598-231421620 CGCTGCCTTCCTGGGCTCCCGGG + Exonic
923377269 1:233377017-233377039 CACTGCCACCTCTGGCTCCCAGG - Intronic
923939856 1:238809659-238809681 CACTGCAACCTCCGGCTCTCGGG - Intergenic
924233649 1:241982873-241982895 CACTGCATCCTCCGTCTCTCAGG + Intergenic
924376322 1:243413279-243413301 CGCTGCATCCTCTACCTCTCAGG + Intronic
1062873575 10:928144-928166 CACTGCATCCTCCGCCTCTCGGG - Intronic
1062920064 10:1272908-1272930 TGCTGCCTCCTGAGGCTCTGGGG + Intronic
1063829512 10:9935751-9935773 CACTGCAACCTCGGGCTCCCAGG - Intergenic
1063968442 10:11364639-11364661 CGCTGCAACCTCTGCCTCTCAGG + Intergenic
1064022902 10:11823682-11823704 CGCTGCCTCCTCGGGGACCTCGG + Intronic
1064189617 10:13194285-13194307 CGCTGCCACCTCTGCCTCCCAGG - Intronic
1064320214 10:14297794-14297816 CTCTGCCTCCTTGGACTCCCAGG - Intronic
1064990015 10:21248144-21248166 CGCTGCCCCCTCGACCTCCCGGG + Intergenic
1065629227 10:27660364-27660386 CGCTGCAGCCTCGACCTCTCAGG - Intergenic
1067808621 10:49410128-49410150 CACTTCCTCCTGGGGCTGTCTGG - Intergenic
1068391892 10:56408804-56408826 CCCTTCCTCCTGTGGCTCTCAGG - Intergenic
1069024078 10:63521439-63521461 CGCCGGCTCCTCGCGCTCCCCGG - Exonic
1070041753 10:72787792-72787814 CGCTGCAACCTCTGCCTCTCAGG + Intronic
1070209030 10:74295384-74295406 CACTGCCACCTCCGCCTCTCAGG - Intronic
1070753573 10:78977802-78977824 AGCTGCCTCCTGGGGTTCTGTGG + Intergenic
1073295785 10:102437737-102437759 CACTGCCACCTCTGCCTCTCAGG - Intergenic
1073743583 10:106440042-106440064 CACTGCCACCTCCGGCTCCCGGG - Intergenic
1073923248 10:108482951-108482973 CGCTGCCACCTCTGCCTCCCAGG + Intergenic
1073998819 10:109346558-109346580 CGCTGCAACCTCTGCCTCTCGGG + Intergenic
1075517308 10:123119231-123119253 CCCAGGCTCCTCTGGCTCTCTGG - Intergenic
1076462375 10:130655985-130656007 CACTGCCTCCAGGGCCTCTCAGG + Intergenic
1076521920 10:131086625-131086647 TGCATCCTCCTCGTGCTCTCTGG + Intergenic
1076560200 10:131357806-131357828 CGCTCCCTGCTCCGGCTCTCAGG + Intergenic
1076869663 10:133187169-133187191 CGCTGCCTCCGCGGGGACGCTGG + Intronic
1077072217 11:680532-680554 CGCTGCAGCCTCGGCCTCCCAGG - Intronic
1077376491 11:2207598-2207620 AGCTTCCTCCTGGAGCTCTCGGG - Intergenic
1078498183 11:11841679-11841701 CCCTGCCTTCTCGGGCTCTTCGG - Intronic
1078551879 11:12286797-12286819 CACTGCCCCCTCGACCTCTCGGG - Intronic
1080556269 11:33420302-33420324 CGCTGCAACCTCGACCTCTCAGG + Intergenic
1082771823 11:57213650-57213672 CCCTGGCTCCTGGGCCTCTCTGG - Intergenic
1082838463 11:57668483-57668505 CCCTGCGCCCTCGGGCTCTGCGG + Intronic
1083623958 11:64062499-64062521 CGCAGCCTCCTCCTGCACTCTGG + Intronic
1084001588 11:66298077-66298099 CACTGCATCCTCTGCCTCTCGGG - Intergenic
1084605493 11:70169512-70169534 CGCTGCCTACTCTGGCACTAAGG - Intronic
1084662937 11:70557754-70557776 CCCAGCCTCCTCGGGATCACTGG - Intronic
1084706805 11:70820474-70820496 CGCGGCCCCCTCGGGCTTGCTGG + Intronic
1085070271 11:73537483-73537505 CTCTGCCTCCTCTGCCTCCCGGG - Intronic
1085099356 11:73787467-73787489 CACTGCCACCTCCGCCTCTCGGG - Exonic
1085363207 11:75911607-75911629 CTCTGCCCCCTCGGGGTCTGGGG + Intronic
1085403417 11:76247812-76247834 AGCTGCGTCCTCCTGCTCTCTGG + Intergenic
1085445188 11:76596769-76596791 CCCTGCCTCCTGGTGCTCGCTGG - Intergenic
1085734939 11:79030906-79030928 CTCTGTCTCCTGGGTCTCTCTGG - Intronic
1086560991 11:88169018-88169040 CTCTGCCTCCTCCAGTTCTCAGG - Intronic
1087157836 11:94922142-94922164 CGCTCCCTGCATGGGCTCTCAGG + Intergenic
1088068822 11:105755931-105755953 CATTGCCTCCTCTGGTTCTCAGG + Intronic
1088796155 11:113268435-113268457 CCCTTCCTCCTCAGGCTCTCTGG - Intronic
1088996153 11:114999065-114999087 CTCTGCCTCCTCAGCCTCTGTGG - Intergenic
1089513101 11:119013369-119013391 CGCTGCAACCTCTGCCTCTCAGG + Intronic
1089685958 11:120147041-120147063 GGCTGCCTCCTCCTGCTCCCTGG - Intronic
1090636726 11:128694405-128694427 CGCCGGCTCCTCCGGCGCTCGGG + Intronic
1091839959 12:3613738-3613760 CGCACCCTCCACGGGCTCTCTGG + Intronic
1093132900 12:15413737-15413759 CGCTGCAACCTCCGCCTCTCAGG - Intronic
1093642338 12:21542121-21542143 CACTGCCTCCTCCGCCTCCCAGG + Intronic
1094087032 12:26605010-26605032 CACTGCCACCTCCGCCTCTCAGG - Intronic
1094536036 12:31323957-31323979 TGCTTCCCCCTCGGGCACTCCGG + Intronic
1096498323 12:52051266-52051288 CCCCGCCCCCTCGGGCTCCCCGG + Intronic
1097188535 12:57208656-57208678 GCCTGCCTCCTCTGGCCCTCCGG + Intronic
1097262546 12:57727661-57727683 CGCTGCCTCCTGGCACTCACTGG + Exonic
1097314371 12:58156143-58156165 CACTGGCTCCTTGGGTTCTCAGG - Intergenic
1098931683 12:76424074-76424096 CGCTGCCACCTCTACCTCTCGGG + Intronic
1099127375 12:78779838-78779860 CACTGCCACCTCCGCCTCTCGGG + Intergenic
1100014039 12:89987377-89987399 CACTGCAACCTCCGGCTCTCAGG + Intergenic
1100371059 12:93969061-93969083 CACTCCCTCCAGGGGCTCTCGGG + Intergenic
1100509222 12:95252887-95252909 CACTGCCACCTCCGCCTCTCAGG - Intronic
1101020914 12:100553072-100553094 CGCTGCAACCTCCGTCTCTCGGG + Intronic
1101781886 12:107844728-107844750 CCCAGCCTCCGCGGGTTCTCAGG - Intergenic
1102015369 12:109644752-109644774 GGCTGCCTCCTGGGGCTCAAGGG - Intergenic
1102784619 12:115594418-115594440 CGCTGCCACCTCTGCCTCCCCGG + Intergenic
1102887483 12:116533073-116533095 GGCTACCTCCTAGGGCTCTTGGG + Intergenic
1103071304 12:117944780-117944802 CACTGCATCCTCGGCCTCCCAGG - Intronic
1103093400 12:118113736-118113758 CACTGCAACCTCCGGCTCTCAGG - Intronic
1103184405 12:118943859-118943881 TGCTGCCTCCTCTGCCTCCCGGG - Intergenic
1103249493 12:119487371-119487393 CACTGCCACCTCCGCCTCTCAGG + Intronic
1103252889 12:119516179-119516201 CGCTGCAACCTCTGCCTCTCAGG + Intronic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103687281 12:122742033-122742055 CACTGCAGCCTCGGCCTCTCAGG - Intergenic
1104031900 12:125070867-125070889 AGCTGCCTCATCGGGCCCTCAGG - Intronic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1105715788 13:23063673-23063695 CACTGCATCCTCCGCCTCTCGGG + Intergenic
1105971913 13:25436850-25436872 CACTGCAGCCTCGGCCTCTCAGG + Intronic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1107053317 13:36075947-36075969 CACTGCATCCTCGGCCTCCCAGG - Intronic
1107313563 13:39106304-39106326 GGCTGCCTGCTCAGGCTCTGGGG + Intergenic
1107480203 13:40779819-40779841 CACTGCAGCCTCGAGCTCTCAGG - Intergenic
1107777247 13:43857825-43857847 CACTGCCGCCTCGGCCTCCCGGG - Intronic
1107782814 13:43922943-43922965 CACTGCCACCTCCGTCTCTCGGG + Intergenic
1108768196 13:53661991-53662013 CGCTGCAACCTCCGGCTCCCGGG + Intergenic
1109872055 13:68345095-68345117 CGTTGTCTCTCCGGGCTCTCAGG - Intergenic
1110319729 13:74147985-74148007 CACTGCAACCTCGGCCTCTCAGG + Intergenic
1110472292 13:75873900-75873922 CACTGCATCCTCGGCCTCCCAGG + Exonic
1111999347 13:95195707-95195729 CGCTGCAGCCTCCGCCTCTCCGG + Intronic
1112264009 13:97905966-97905988 AGCTGCCTCCTCGGGCTGGAAGG + Intergenic
1112493266 13:99885608-99885630 AGCTGGCTCCTGGAGCTCTCAGG - Intronic
1113333413 13:109354629-109354651 CGCTGCAACCTCTGCCTCTCAGG + Intergenic
1113366116 13:109677432-109677454 CGCTGCAGCCTCCGGCTCCCAGG - Intergenic
1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG + Exonic
1113750948 13:112776048-112776070 AGCCGCCTCCACGGGCTCCCAGG - Intronic
1113777162 13:112954367-112954389 TGCTGCCTCCTCGAGGTTTCAGG - Intronic
1113796193 13:113060100-113060122 GGCTGCCTCCTGGGTCTCCCTGG + Intronic
1113902845 13:113806231-113806253 TGCTCCCTCCTCGGGGTCCCTGG - Intronic
1115164753 14:30435964-30435986 CGCTGCAACCTCCGGCTCCCAGG + Intergenic
1115475367 14:33808229-33808251 CTCTGCAACCTCGGCCTCTCAGG - Intergenic
1116949206 14:50863526-50863548 CGCTGCATCCTCTGCCTCCCAGG + Intronic
1117668438 14:58081024-58081046 CACTGCCACCTCTGCCTCTCAGG - Intronic
1119099393 14:71866213-71866235 CACTGCATCCTCTGCCTCTCAGG - Intergenic
1121101951 14:91255291-91255313 CTCTGCCTCCTCCTGCTCCCCGG - Intergenic
1121114692 14:91335425-91335447 CGCTGCTTTCTCGGGCTTCCAGG + Intronic
1121524029 14:94606139-94606161 CACTGCCACCTCTGCCTCTCGGG + Intronic
1122559664 14:102603398-102603420 CCCTGCATCCTCAGCCTCTCAGG + Intronic
1122659840 14:103287847-103287869 CGCTCCCTCCTGGGGGTCTAGGG - Intergenic
1123026968 14:105429830-105429852 CACTGCCACCTCCAGCTCTCGGG + Intronic
1123104593 14:105834173-105834195 CGCTGCAACCTCTGCCTCTCGGG - Intergenic
1123113834 14:105884988-105885010 TGCTGCGTCCTGGGGATCTCAGG + Intergenic
1123116061 14:105894623-105894645 TGCTGCGTCCTGGGGATCTCAGG + Intergenic
1123118085 14:105903729-105903751 TGCTGCGTCCTGGGGATCTCAGG + Intergenic
1123122924 14:105926464-105926486 GGCTGCCTCCTCGAGCTCTGTGG + Intronic
1123405567 15:20017883-20017905 GGCTGCCTCCTCGAGTTCTGTGG + Intergenic
1123514898 15:21024531-21024553 GGCTGCCTCCTCGAGTTCTGTGG + Intergenic
1123693883 15:22862975-22862997 CACTGCATCCTCTGCCTCTCGGG + Intronic
1124218677 15:27831208-27831230 CGCTGCAACCTCGGACTCCCTGG - Intronic
1125606812 15:40944144-40944166 CGCTTCCTCTTCTGTCTCTCTGG + Intergenic
1126014944 15:44341770-44341792 CACTGCATCCTCGGCCTCCCGGG + Intronic
1126623747 15:50666363-50666385 CGCTGCAGCCTCGAGCTCCCTGG - Intronic
1127489024 15:59444596-59444618 ACCTGCCTCCTCTGGCTGTCTGG + Intronic
1127884779 15:63189581-63189603 CACCGCCTCCTCTGGCTCCCCGG + Exonic
1129142816 15:73616552-73616574 TGCTGCCTCCTCAGTCCCTCAGG + Intronic
1129592275 15:76927798-76927820 CACTGCCTCCTCTGCCTCCCAGG + Intergenic
1129876500 15:78978993-78979015 CGCTGCCTCCACTGCCTCTGGGG - Intronic
1129922302 15:79329659-79329681 CGCTACCTGCTCCGGCTCTGAGG - Intronic
1131081788 15:89542824-89542846 CACTGCCACCTCCGGCTCCCGGG + Intergenic
1131486523 15:92825498-92825520 CGCTGCAACCTCTGCCTCTCAGG + Intergenic
1132398358 15:101489926-101489948 CGCCGACTTCTGGGGCTCTCGGG + Intronic
1132631031 16:917606-917628 CGCTGACCCCTCCGGCTCACTGG + Intronic
1132724437 16:1332803-1332825 CGCTGCAACCTCGAACTCTCCGG - Intergenic
1132870559 16:2114008-2114030 GGCTGGCTCCTCGGGCTACCTGG - Intronic
1133097115 16:3455125-3455147 CGCTGCAACCTCGGCCTCCCGGG + Intronic
1133544361 16:6790979-6791001 CACTGCGTCTTCTGGCTCTCAGG + Intronic
1133751580 16:8730100-8730122 AGCTGCCTCCTAGGGCTCTGGGG + Intronic
1133813698 16:9180348-9180370 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1134369083 16:13606806-13606828 CCCTGCAACCTCCGGCTCTCGGG - Intergenic
1134878983 16:17727795-17727817 CGCTGCAACCTCCGCCTCTCGGG - Intergenic
1136151532 16:28353810-28353832 CACTGCAACCTCGGCCTCTCAGG + Intronic
1136174584 16:28508062-28508084 CTCTGCCTCCTCGGCCTGCCTGG + Intronic
1136195210 16:28647363-28647385 CACTGCAACCTCGGCCTCTCAGG - Intronic
1136211548 16:28761479-28761501 CACTGCAACCTCGGCCTCTCAGG - Intronic
1136223054 16:28840961-28840983 CACTGCATCCTCTGCCTCTCGGG + Intergenic
1137555970 16:49470561-49470583 CTCTCCCTCCTCAGACTCTCAGG + Intergenic
1137664086 16:50238270-50238292 CGCTGCCACCTCAGCCTCCCAGG - Intergenic
1138229361 16:55326071-55326093 CCCGGCCTCCTGGGGCTCTGGGG + Intronic
1138539989 16:57682284-57682306 CCCTGCCTCCTGGGGGTCCCTGG + Intronic
1138725454 16:59133590-59133612 TGCTGCATCCTCCGCCTCTCAGG + Intergenic
1139705823 16:68739688-68739710 CACTGCCACCTCTGGCTCCCAGG + Intronic
1139839194 16:69864623-69864645 CACTGCCACCTTGGCCTCTCGGG + Intronic
1141420259 16:83910442-83910464 GGCTGCCTCCTCAGCCTCCCGGG - Intronic
1141457326 16:84152021-84152043 AGCTTCCTCCTCAGGCTCTCTGG - Intronic
1141619620 16:85230019-85230041 ATCTGCCTCCTCAGGCTCTGTGG + Intergenic
1141659998 16:85436632-85436654 AGCTGCCTCCCGGGACTCTCTGG - Intergenic
1141726738 16:85794611-85794633 CGCTGCAACCTTGGCCTCTCAGG - Intronic
1141817855 16:86425159-86425181 AGCTGCTTCCCCGGGCTATCAGG - Intergenic
1142023682 16:87800792-87800814 CGTTCCCTCCTAGGGCTCTTGGG - Intergenic
1142215029 16:88825862-88825884 AGCTGCCGCCTCCGGCTATCTGG - Intronic
1142502948 17:343604-343626 AGCTGCCTCCTGGGGCTATTGGG + Intronic
1142871617 17:2824817-2824839 CGCCGCCTCCTCCTCCTCTCTGG - Intronic
1142949848 17:3470015-3470037 CACTGCAACCTCGGCCTCTCGGG - Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1143529304 17:7492490-7492512 CACTGCCACCTCTGCCTCTCAGG - Intronic
1143637093 17:8171377-8171399 CACTGCAACCTCGGCCTCTCGGG - Intergenic
1144021207 17:11241210-11241232 CGCGGGCTGCTCGGGCTCTCAGG - Intergenic
1144428514 17:15168991-15169013 CACGGCCCCCTCTGGCTCTCAGG - Intergenic
1145372735 17:22320629-22320651 CACTGCATCCTCCGCCTCTCAGG - Intergenic
1146135146 17:30313691-30313713 CACTGCCACCTCCGCCTCTCAGG + Intergenic
1146197310 17:30824583-30824605 CGCTGCCTCCACGTTCTCGCGGG + Exonic
1146978996 17:37141765-37141787 CGCTGCCACCTCTGCCTCCCAGG + Intronic
1148329629 17:46806010-46806032 CTCTGCCTCCTGGGGTTGTCGGG + Intronic
1148338892 17:46861454-46861476 TTCTGCCTCCATGGGCTCTCTGG + Intronic
1148711283 17:49683148-49683170 CACTGCCACCTCGGGCTCCCAGG + Intergenic
1149560847 17:57606915-57606937 TGCTCCCTCCTCTGGGTCTCTGG - Intronic
1150248788 17:63694721-63694743 AGACACCTCCTCGGGCTCTCTGG - Exonic
1151148051 17:72059320-72059342 CGCTGCAACCTCCGCCTCTCTGG - Intergenic
1151451195 17:74199377-74199399 CGCTGCAGCCTCGACCTCTCGGG - Intergenic
1151799859 17:76372076-76372098 CGCTGCAACCTCCGTCTCTCTGG - Intronic
1152349907 17:79778557-79778579 CGCGGGCTCCTCCGGCTCTGAGG + Intronic
1152939123 17:83157001-83157023 CGCTGCAACCTCCGCCTCTCGGG + Intergenic
1153685935 18:7545402-7545424 CGCTCCCTCCAGGGGCTCTAGGG + Intergenic
1154373832 18:13792224-13792246 CACTGCCACCTCCGCCTCTCGGG + Intergenic
1155291980 18:24351613-24351635 CGCTGCAACCTCCGCCTCTCAGG + Intronic
1156530835 18:37813602-37813624 TTCTGCCTCCTCAGGTTCTCAGG + Intergenic
1157285324 18:46373634-46373656 CACTGGCTCCTCGGGCTCCAGGG + Intronic
1158064922 18:53395072-53395094 CGCTGCAACCTCAGCCTCTCGGG - Intronic
1158105737 18:53883020-53883042 CCCTGCCTCATGTGGCTCTCAGG + Intergenic
1158718827 18:59905193-59905215 CCCTGCATCCTCCAGCTCTCTGG - Intergenic
1158730486 18:60017476-60017498 CGCTTCCCCCTCCGGCACTCCGG + Intergenic
1158882963 18:61798732-61798754 TGGTGGCTCCTAGGGCTCTCAGG + Intergenic
1159112456 18:64074874-64074896 CGCTGCAACCTCTGCCTCTCAGG - Intergenic
1160954251 19:1682860-1682882 GGGTGCCTCCTCCGGGTCTCCGG + Intergenic
1161165402 19:2784437-2784459 CGCTGCAACCTCTGCCTCTCGGG - Intergenic
1162266910 19:9583399-9583421 CACTGCAACCTCGGCCTCTCAGG + Intronic
1162445087 19:10718076-10718098 CGCCGCCTCATCCGGTTCTCAGG - Intronic
1162520851 19:11178560-11178582 CCCGGCCTCCTCGGACTCTTGGG + Exonic
1162539433 19:11285520-11285542 CACTGCCACCTCTGCCTCTCGGG + Intergenic
1162820815 19:13222469-13222491 CGCTGCAACCTCTGCCTCTCGGG + Intronic
1162978524 19:14223205-14223227 CGCTGCAACCTCGGTCTCCCGGG + Intergenic
1163359228 19:16835302-16835324 CGCTGCATCCTCTGCCTCCCGGG + Intronic
1163363690 19:16864216-16864238 CACTGCAGCCTCGGCCTCTCTGG - Intronic
1163376493 19:16936001-16936023 CACTGCCACCTCAGCCTCTCAGG + Intronic
1164947674 19:32310125-32310147 CGCTGCCTTCACAGGCTGTCGGG + Intergenic
1165746308 19:38231805-38231827 CGCTGCAACCTCTGTCTCTCAGG - Intergenic
1167920959 19:52782797-52782819 CACTGCAACCTCCGGCTCTCGGG - Intronic
1168007187 19:53499915-53499937 CACTGCATCCTCCGCCTCTCAGG - Intergenic
1168100521 19:54138608-54138630 CGCAGCCTCCCCTGGATCTCAGG + Intronic
1168145943 19:54420313-54420335 CGCTTCCTCCTCCGGCTCTCTGG + Intronic
1168280810 19:55304633-55304655 CGCTGCCTTCTCGGGGCCCCAGG + Exonic
1168304153 19:55425568-55425590 CACTGCCACCTCTGCCTCTCAGG - Intergenic
925965522 2:9062041-9062063 CTCTGCCTCCTCTGCCTCCCGGG + Intergenic
926624851 2:15082637-15082659 CCCTGCCTCCTTGGGGGCTCTGG - Intergenic
926756139 2:16237662-16237684 CACTGCCACCTCTGGCTCCCAGG + Intergenic
927526393 2:23745209-23745231 CACTGCCGCCTCTGCCTCTCAGG - Intergenic
927904425 2:26847039-26847061 CCCTCCCTCCCCGGGCTCCCCGG - Intergenic
928757667 2:34545909-34545931 CCCTGCCGCCTGTGGCTCTCAGG + Intergenic
928824802 2:35406889-35406911 CACTGCCACCTCTGTCTCTCGGG + Intergenic
929107220 2:38377074-38377096 CGCTCGCTGCTCGGGCTCGCGGG - Intronic
929703261 2:44183623-44183645 CCCTTCCTCCTGGGGCTCACTGG - Intronic
930047170 2:47182972-47182994 AGCTGCCTTCTCGGACTGTCTGG - Intergenic
930146393 2:48010091-48010113 CACTGCCACCTCCGCCTCTCAGG - Intergenic
930426311 2:51217280-51217302 CACTGCAACCTCGGCCTCTCAGG + Intergenic
932104243 2:68928286-68928308 CGCTGCCTCATGGTGCTCTCAGG - Intergenic
932438960 2:71719746-71719768 CCCTGCCTCCAGGGGCTCTGGGG - Intergenic
933042155 2:77483043-77483065 CGCTGCAACCTCTGCCTCTCAGG - Intronic
933354178 2:81194265-81194287 CGCTCCCTCCTCGGCCCCTGGGG + Intergenic
933378430 2:81511983-81512005 CGCTGCAACCTCCGCCTCTCGGG - Intergenic
935040019 2:99417213-99417235 CGCTGCAACCTCTGCCTCTCGGG + Intronic
935064213 2:99633988-99634010 CGCTGCCTCCTCCGCCTCCTGGG + Intronic
935740785 2:106145994-106146016 AGCTGCCTCATCGTGCTCTGTGG - Intronic
937218934 2:120330349-120330371 ACCTGCCTGCTCTGGCTCTCTGG + Intergenic
937332851 2:121042984-121043006 CTCTGCCTGGTCGGGCTCGCAGG + Intergenic
937341190 2:121091662-121091684 CACTGCAGCCTCGAGCTCTCAGG - Intergenic
937493998 2:122398846-122398868 CACTGGCTCCCCAGGCTCTCAGG + Intergenic
938251589 2:129820009-129820031 CTCTGCCCCCTCGGGCTGCCTGG - Intergenic
940228672 2:151427284-151427306 CACTGCAGCCTCGGCCTCTCAGG + Intronic
942558909 2:177199967-177199989 CACTGCAGCCTCGGCCTCTCAGG + Intergenic
944793048 2:203152960-203152982 CACTGCCACCTCTGCCTCTCGGG - Intronic
944816159 2:203377828-203377850 CACTGCATCCTCGACCTCTCAGG - Intronic
945073924 2:206018214-206018236 CACTGCCACCTCGGCCTCCCGGG + Intronic
945737221 2:213615513-213615535 CGCTGCAACCTCCGCCTCTCAGG - Intronic
946438767 2:219677753-219677775 CGCTGCAACCTCAGCCTCTCAGG + Intergenic
946657257 2:221961782-221961804 CGCAGCCTCCCCGGGCCCTACGG + Intergenic
947712495 2:232324020-232324042 CCCTGCCTCCCAGGGCTCTGCGG + Intronic
947823030 2:233085308-233085330 CGCTGCAGCCTCTGCCTCTCAGG - Intronic
947928451 2:233942029-233942051 ATCTGCCTCATCAGGCTCTCTGG - Intronic
948353422 2:237359379-237359401 CCTTGCCTTCTAGGGCTCTCGGG - Exonic
948369962 2:237482611-237482633 GGCTGCCTCCGCTTGCTCTCTGG - Intergenic
948795800 2:240401518-240401540 CCCTGCCTCCTCCCGCTCTGTGG - Intergenic
949009726 2:241671624-241671646 CGCTGCCTGCCCGGGCGCTGTGG + Intronic
1168818618 20:758310-758332 CGCTGCAACCTCTGCCTCTCAGG + Intergenic
1169005996 20:2207586-2207608 CGCTTCCTCTGCGGGGTCTCTGG + Intergenic
1169439984 20:5625866-5625888 CACTGCAACCTCGGCCTCTCAGG - Intergenic
1169880828 20:10344310-10344332 CGCTGCCACCTCCGTCTCCCGGG + Intergenic
1171195867 20:23198851-23198873 GGCTGCCTCCTCTGGTTCTTGGG - Intergenic
1171961348 20:31497098-31497120 TGCTTCCTCCTTGGGCTCCCCGG + Intergenic
1172654369 20:36528006-36528028 CGCCGCCGCCGCTGGCTCTCGGG + Exonic
1172836238 20:37875013-37875035 CGCTGTCTCCTTGGTCCCTCGGG - Intergenic
1173225505 20:41160233-41160255 CCCTGGGTCCTCTGGCTCTCCGG - Intronic
1173262381 20:41448195-41448217 TGCTGCCTCCTGTGGCTCACAGG - Intronic
1173706687 20:45115221-45115243 CACTGAGTCCTCGGGCCCTCAGG - Intergenic
1173794948 20:45853283-45853305 CTCTGCCTCCTTGGGCACTGTGG + Intronic
1174508796 20:51035280-51035302 CTCTGGCTTCTGGGGCTCTCTGG + Intergenic
1174523080 20:51147949-51147971 CGCTGCAGCCTCGGCCTCTTGGG + Intergenic
1174706130 20:52658056-52658078 CGCTGCATCCTCCGCCTCCCAGG + Intergenic
1175736202 20:61389223-61389245 CTCTGCCTCCTCTTGCTCTTGGG + Intronic
1176547499 21:8208136-8208158 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1176555408 21:8252345-8252367 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1176566450 21:8391183-8391205 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1176574326 21:8435370-8435392 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1176610938 21:8986662-8986684 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1178143038 21:29705947-29705969 CGCTGCAACCTCTGGCTCCCGGG + Intronic
1178296423 21:31414071-31414093 CCCTACCGCCTCAGGCTCTCAGG + Intronic
1178568696 21:33713908-33713930 CACTGCAACCTCCGGCTCTCGGG + Intronic
1178620534 21:34170209-34170231 CGCTGCAACCTCTGTCTCTCAGG + Intergenic
1178841341 21:36139961-36139983 CGCTGCAACCTCCGCCTCTCAGG + Intronic
1178947843 21:36962715-36962737 CACTGCAACCTCGGGCTCCCAGG - Intronic
1179293954 21:40044044-40044066 CGCTGCCTCCTCCGTCCCTGGGG - Intronic
1179820660 21:43935105-43935127 CACTGCTTCCTCACGCTCTCAGG - Intronic
1180096647 21:45558424-45558446 CACTGCCTTCCCGGGTTCTCAGG - Intergenic
1180887714 22:19259179-19259201 CACTGCCACCTCTGCCTCTCAGG + Intronic
1180989540 22:19926703-19926725 CACTGCAACCTCGGCCTCTCGGG - Intronic
1181041652 22:20195254-20195276 ACCTGGCTCCTGGGGCTCTCCGG - Intergenic
1181095968 22:20505482-20505504 CACTGCATCCTCCGCCTCTCAGG - Intronic
1181152888 22:20897896-20897918 CACTGCCACCTCGGCCTCCCAGG + Intergenic
1181257756 22:21574887-21574909 CGCTGCAACCTCTGCCTCTCAGG - Intronic
1181394721 22:22612933-22612955 CTCTCCCTCCTCAGGCTCCCTGG + Intergenic
1181564312 22:23725042-23725064 CACTGCCACCTCGGCCTCTGGGG - Intergenic
1182205474 22:28620272-28620294 CACTGCCACCTCTGCCTCTCTGG - Intronic
1182218524 22:28739611-28739633 CACTGCCTCCTCTGCCTCCCGGG - Intronic
1182225278 22:28793062-28793084 CGCTGCATCCTCTGCCTCCCGGG + Intergenic
1182296055 22:29311693-29311715 CCCTGCCTCCTGGGGCCCCCCGG - Intronic
1182299172 22:29328453-29328475 CCCTGGCTCCTTGGTCTCTCCGG - Exonic
1182446953 22:30395410-30395432 CGCTGCATCCTCTGCCTCCCAGG + Intronic
1182447208 22:30396940-30396962 CGCTCCCTACTCCGCCTCTCGGG + Exonic
1183242920 22:36671772-36671794 CTCTGCCTCCTCGATCTCTGTGG + Intronic
1183257818 22:36774126-36774148 CACTGCCTCCTCTGGTGCTCTGG + Intronic
1183381624 22:37493148-37493170 GGCAGCCTCCCCAGGCTCTCAGG - Intronic
1183790800 22:40067618-40067640 AGCAGCCTCTTGGGGCTCTCAGG - Intronic
1184540725 22:45122393-45122415 CGCTGCAACCTCTGCCTCTCGGG - Intergenic
1184720712 22:46311151-46311173 CACTGCATCCTCTGCCTCTCGGG + Intronic
1185247667 22:49781633-49781655 AGCTGCCACCTCGGCTTCTCCGG + Intronic
1185400372 22:50612590-50612612 GTCTGCGTCCTCGGTCTCTCTGG - Intronic
1185416340 22:50712405-50712427 GGCAGCCTCCTCTGCCTCTCGGG + Intergenic
1203252372 22_KI270733v1_random:124421-124443 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1203260429 22_KI270733v1_random:169507-169529 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
950142389 3:10624357-10624379 CTCTGCCTCTTCCAGCTCTCAGG + Intronic
950459084 3:13110511-13110533 CGCTGCAACCTCGGCCTCCCGGG - Intergenic
951858276 3:27222295-27222317 CACTGCCACCTCTGCCTCTCAGG - Intronic
952369736 3:32710069-32710091 CACTGCAACCTCGGCCTCTCGGG - Intronic
953806446 3:46073511-46073533 CACTGCAACCTCCGGCTCTCAGG - Intergenic
954022002 3:47750357-47750379 CACTGCATCCTCTGCCTCTCGGG - Intronic
954578930 3:51692561-51692583 TCCTGACTCCTCTGGCTCTCAGG + Intronic
954662942 3:52235877-52235899 CTGTGGCTCCTCGGGGTCTCAGG - Intronic
954974968 3:54684695-54684717 CGCTGTCTCCTGGGCTTCTCAGG - Intronic
956143717 3:66171563-66171585 CACTGCAACCTCGGCCTCTCAGG + Intronic
956262157 3:67356097-67356119 CTCTGCCTCCTCTGCCTCCCGGG + Intergenic
957041895 3:75341949-75341971 CGCTTCCTCATCGGTCTCTAGGG + Intergenic
959946342 3:112129550-112129572 CAATGCCTTCTCTGGCTCTCTGG + Intronic
962296038 3:134188234-134188256 CACTGCATCCTCCGCCTCTCGGG + Intronic
962365609 3:134777687-134777709 CGCTGCAACCTCCGCCTCTCAGG + Intronic
964745491 3:160008436-160008458 CACTGCCACCTCCGCCTCTCAGG + Intergenic
965160889 3:165131572-165131594 CGCTGCAACCTCCGCCTCTCAGG + Intergenic
966187861 3:177244334-177244356 CACTGCAGCCTCGGCCTCTCGGG + Intergenic
966809354 3:183829535-183829557 CGATGTCTCCTGGGGCTCTCAGG + Exonic
967162231 3:186748934-186748956 CTCTGCCTCCTGGGCCTCCCGGG - Intergenic
967192925 3:187000484-187000506 CACTGCCACCTCGGCCTCCCGGG - Intronic
968150265 3:196332336-196332358 CACTGCCACCTCTGCCTCTCGGG - Intronic
968640405 4:1711903-1711925 CTCTGCCTCCTCGGCGTCTTCGG + Exonic
969547311 4:7839258-7839280 CACTGCAGCCTCGGGCTCCCAGG - Intronic
969603829 4:8192063-8192085 CACTGCCACCTCGGCCTCCCAGG + Intronic
970591602 4:17564892-17564914 CGCTGCCACCTCTGCCTCCCGGG + Intergenic
972120864 4:35700606-35700628 TGCTGCCTCCTCAGGCTCCTCGG + Intergenic
974067139 4:57088954-57088976 CGCTGCCACCTCTGCCTCCCAGG - Intronic
974483027 4:62470423-62470445 CACTGCCACCTCCGCCTCTCGGG + Intergenic
976289709 4:83405058-83405080 CACTGCCTCCTCTGCCTCCCGGG + Intergenic
977891772 4:102320018-102320040 CACTGGCTCCTCTGGTTCTCGGG + Intronic
979734998 4:124072697-124072719 CCCTGCCTCATGTGGCTCTCAGG - Intergenic
981279328 4:142939226-142939248 CACTGGCTCCCCTGGCTCTCAGG + Intergenic
981555847 4:145992733-145992755 CACTGCAACCTCCGGCTCTCAGG + Intergenic
982980557 4:162128998-162129020 CGCTGCAACCTCCGGCTCCCGGG + Intronic
983653590 4:170057441-170057463 CGCTGCATCCTCTGCCTCCCAGG + Intergenic
983780254 4:171661691-171661713 CGCTGCAACCTCCGCCTCTCGGG - Intergenic
984959150 4:185077692-185077714 CACTGCATCCTCTGCCTCTCAGG - Intergenic
985808968 5:2069169-2069191 AGCTCCCTCCTAGGGCCCTCTGG - Intergenic
985824188 5:2180592-2180614 GGCTGCCACCCCGAGCTCTCAGG + Intergenic
986918778 5:12660403-12660425 CGCTGCCATCTTGGGATCTCTGG - Intergenic
988312590 5:29580516-29580538 CACTGCAACCTCGGCCTCTCGGG + Intergenic
989228873 5:39064640-39064662 TGCTGCCTCCTCCCGCTCCCAGG - Intronic
989589413 5:43099465-43099487 CACTGCCGCCTCTGCCTCTCGGG - Intronic
989955357 5:50352757-50352779 AGCTCCCTCCCCTGGCTCTCAGG + Intergenic
990165555 5:52989576-52989598 CGCGGCTTCCTGGGGCTCGCTGG + Intronic
990756484 5:59077542-59077564 CGCTGCAACCTCTGCCTCTCAGG + Intronic
992304733 5:75424494-75424516 CGCTGCAACCTCCGGCTCCCTGG - Intronic
993362827 5:86999313-86999335 TGCTGCCACCTCCGCCTCTCAGG - Intergenic
994815162 5:104576622-104576644 CGCTGCAACCTCCGGCTCCCGGG + Intergenic
995198895 5:109404440-109404462 CGCTGCAACCTCGGTCTCCCAGG - Intronic
999793451 5:154965498-154965520 CGCTGCAACCTCTGCCTCTCGGG + Intronic
1001427355 5:171631677-171631699 CGCTGCAACCTCTGCCTCTCCGG - Intergenic
1001525060 5:172423022-172423044 CTCTGCCTCCTCTGCCTCCCAGG + Intronic
1002180064 5:177426702-177426724 CGCGGCCTCCCCGGCCTCCCCGG - Intronic
1002269322 5:178059402-178059424 CGCTGCAACCTCTGCCTCTCAGG - Intergenic
1002277426 5:178113324-178113346 CGCTGCCTCCTTGAGCGCCCCGG - Intergenic
1003137424 6:3444573-3444595 CACTGCCTCCTGGAGTTCTCAGG - Intronic
1003293744 6:4805611-4805633 CACTGGCTCCCCTGGCTCTCAGG - Intronic
1003471853 6:6443617-6443639 AGAGGCCTCCTGGGGCTCTCAGG + Intergenic
1003736753 6:8886451-8886473 CGCTGCAACCTCCGCCTCTCAGG + Intergenic
1003876796 6:10445065-10445087 CACTGCCACCTCCGCCTCTCGGG + Intergenic
1004660685 6:17706599-17706621 CGGAGCCTCCTCGGCCTCTGCGG - Exonic
1005640149 6:27788265-27788287 CACTGCAACCTCGGCCTCTCGGG + Intergenic
1005963132 6:30707571-30707593 TGATGCCTCCTGGGGCTCACTGG + Exonic
1006895769 6:37469601-37469623 CGCTGCCACCTCCGCCTCTGGGG + Intronic
1007080824 6:39102502-39102524 CCCTGCATCCCCGGGCTCTTAGG + Intergenic
1007420217 6:41714753-41714775 GGCTGCCTCCAGGGCCTCTCTGG - Intronic
1007586470 6:42993219-42993241 CACTGCATCCTCCGGCTCTTGGG - Intronic
1007979495 6:46136709-46136731 TGCTGCCTACTCAGTCTCTCTGG - Intronic
1008048609 6:46876677-46876699 CACTGCAACCTCGGCCTCTCGGG + Intronic
1008611432 6:53187885-53187907 CACTGCATCCTCCGCCTCTCGGG - Intergenic
1008763327 6:54880518-54880540 CACTGCCACCTCTGCCTCTCAGG + Intronic
1009818197 6:68763995-68764017 CACTGCAACCTCTGGCTCTCAGG - Intronic
1010438975 6:75871323-75871345 CGCTGCAACCTCCGCCTCTCTGG + Intronic
1011761918 6:90576345-90576367 CACTGCAACCTCGGCCTCTCAGG - Intronic
1013094668 6:106933674-106933696 CACTGCATCCTCCGCCTCTCAGG - Intergenic
1013836723 6:114342887-114342909 AGCTGCCGGCTCGGGCGCTCTGG - Exonic
1015143593 6:129961253-129961275 CACTGCAGCCTCCGGCTCTCAGG + Intergenic
1015277481 6:131399083-131399105 CACTGCCCCCTCGGCCTCCCAGG - Intergenic
1015515744 6:134081153-134081175 CACTGCCACCTCCGCCTCTCGGG + Intergenic
1016368408 6:143343424-143343446 CGATGTCTCCTGGGGCTCTCCGG - Intergenic
1016869092 6:148798943-148798965 CGCTGCAACCTCTGCCTCTCGGG + Intronic
1017918409 6:158851391-158851413 CTCTGCCTCCCCTGCCTCTCCGG + Intergenic
1018267448 6:162040479-162040501 CACTGCCACCTCTGCCTCTCAGG + Intronic
1018670576 6:166173472-166173494 CGCTACCTCCCTGGACTCTCTGG - Intergenic
1019142311 6:169956703-169956725 CGCTGCCTCCTTGGGATCAGAGG + Intergenic
1019161820 6:170074042-170074064 CGCAGCCTCCTTGGCCTCACGGG + Intergenic
1019204528 6:170348846-170348868 AGCTGCCTCCTAGGGCTGTTGGG + Intronic
1019398866 7:839458-839480 CACTGCCTCCTCTGTCTCCCGGG + Intronic
1019914459 7:4123883-4123905 TGCTGCCTCCCAGGGCTCTCAGG + Intronic
1020108012 7:5431223-5431245 CGCTGCAGCCTCAGCCTCTCGGG + Intergenic
1020122016 7:5509874-5509896 AGCTGCCTCCTAGGGTCCTCTGG - Intronic
1020130926 7:5558193-5558215 CACAGCCTTCTGGGGCTCTCTGG - Intronic
1021939799 7:25668449-25668471 CGTTGCCCCCTTGGGCTCCCTGG + Intergenic
1022505841 7:30908283-30908305 CCCAGCCTCCTAGGGCTCACTGG + Intergenic
1023316322 7:38941399-38941421 TGCAGCCTCCTCTGCCTCTCAGG + Intergenic
1023392013 7:39719998-39720020 CACTGCCACCTCTGCCTCTCAGG + Intergenic
1025638571 7:63347351-63347373 CGCTGCAACCTCCGCCTCTCGGG + Intergenic
1025644125 7:63400738-63400760 CGCTGCAACCTCCGCCTCTCGGG - Intergenic
1029973911 7:104815102-104815124 CCATGCATCCTCGTGCTCTCGGG - Intronic
1029974612 7:104821246-104821268 CTCTGCATCCTCCTGCTCTCAGG + Intronic
1031051232 7:116948357-116948379 CGCTGCAACCTCCGCCTCTCAGG + Intergenic
1032174485 7:129612106-129612128 CTCCGCCGCCTGGGGCTCTCGGG + Intronic
1032271576 7:130413065-130413087 CTCTGCCACCTCCGCCTCTCAGG + Intronic
1032540667 7:132700361-132700383 TGCAGCCTCCTGGGGCTCTAGGG + Intronic
1032709159 7:134447381-134447403 CACTGTCTCCTTGGGCTCACAGG - Exonic
1034630543 7:152527126-152527148 CACTGCAACCTCGGCCTCTCTGG - Intergenic
1034783798 7:153906524-153906546 CGCTGCAGCCTCGGCCTCCCAGG + Intronic
1035018539 7:155787325-155787347 CGCTGCCTCCTGGGACCCTCGGG - Intergenic
1035100811 7:156394815-156394837 CTCAGCCTCCTCTGCCTCTCTGG - Intergenic
1036061644 8:5328367-5328389 CGCTGCAGCCTCTGCCTCTCAGG - Intergenic
1036237321 8:7051383-7051405 AGCTGCCACCTCAGCCTCTCAGG - Intergenic
1036440581 8:8778171-8778193 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1038087528 8:24216400-24216422 CGCTGCAACCTCGGCCGCTCGGG - Intergenic
1038336115 8:26646905-26646927 CACTGCAGCCTCGGCCTCTCAGG - Intronic
1038883712 8:31640436-31640458 CGCCTCCTCCCCGGGCTCGCCGG - Intronic
1038888784 8:31695243-31695265 CGCTGCACCCTCTGCCTCTCAGG + Intronic
1039751114 8:40479674-40479696 CACTGGCTCCTCTGGTTCTCAGG - Intergenic
1039962122 8:42256494-42256516 CACTGCCACCTCTGCCTCTCGGG - Intergenic
1040628752 8:49184069-49184091 CGCTGCATCCTCTGCCTCTTGGG + Intergenic
1040831844 8:51685505-51685527 CGCTGCCTACTTAGCCTCTCTGG + Intronic
1041738566 8:61135914-61135936 CTGTGCCCTCTCGGGCTCTCCGG + Intronic
1041935867 8:63331297-63331319 CGCTGCAACCTCCGCCTCTCGGG + Intergenic
1042603956 8:70527760-70527782 CACTGCATCCTCTGCCTCTCAGG + Intergenic
1042902923 8:73746610-73746632 CCCTCCCACATCGGGCTCTCGGG - Intronic
1043478085 8:80625006-80625028 CACTGCCACCTCCGCCTCTCAGG + Intergenic
1044578998 8:93803948-93803970 CACTGCAACCTCTGGCTCTCAGG + Intronic
1044821351 8:96158071-96158093 CGCTGTCTCCTCCGCGTCTCCGG - Intronic
1044934305 8:97278133-97278155 CGCGGGCTCATCGTGCTCTCAGG + Intergenic
1045001621 8:97883461-97883483 CACTGCCACCTCGACCTCTCGGG + Intronic
1045551011 8:103172475-103172497 CACTGCATCCTCGGCCTCCCGGG + Intronic
1046662088 8:116958923-116958945 CACTGCCACCTCCGCCTCTCGGG + Intronic
1046718393 8:117592139-117592161 CACTGCATCCTCGGCCTCCCAGG + Intergenic
1047422339 8:124717418-124717440 CGCTGCCACCTCTGCCTCCCAGG - Intronic
1047422359 8:124717517-124717539 CGCTGCCACCTCTGCCTCCCAGG - Intronic
1048244733 8:132781502-132781524 CGCTGCAACCTCCGCCTCTCAGG + Intronic
1048305243 8:133279532-133279554 CTCAGCCACCTCTGGCTCTCTGG + Intronic
1049978526 9:882845-882867 CACTGCCACCTCTGCCTCTCAGG + Intronic
1051145229 9:14020097-14020119 CACTGCATCCTCTGCCTCTCGGG - Intergenic
1052128337 9:24807706-24807728 CGCTGCAACCTCCGGCTCCCAGG - Intergenic
1052297836 9:26918185-26918207 CGCTGCCACCTCTGCCTCCCAGG + Intronic
1052420832 9:28241503-28241525 CCCTGCCCCCTGTGGCTCTCAGG - Intronic
1052729292 9:32266354-32266376 CGCTGCAACCTTGGCCTCTCAGG - Intergenic
1053023081 9:34709163-34709185 CTCTCCCTCCTCGGTCTCTCTGG + Exonic
1053403869 9:37853335-37853357 CGCTGCAACCTCTGCCTCTCGGG - Intronic
1054147165 9:61571018-61571040 CACTGCATCCTCCGCCTCTCAGG - Intergenic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055104551 9:72498973-72498995 CACTGCCACCTCTGCCTCTCAGG - Intergenic
1056911008 9:90700620-90700642 AGCTGCCTCTTCTGGCTCTAGGG - Intergenic
1060267941 9:122123052-122123074 TGATGCGTCCTTGGGCTCTCTGG - Intergenic
1060350436 9:122853674-122853696 CACTGCAGCCTCTGGCTCTCAGG - Intronic
1061508793 9:131048130-131048152 CGCTGCAACCTCCGCCTCTCGGG + Intronic
1061621005 9:131811368-131811390 CACTGCAACCTCTGGCTCTCAGG + Intergenic
1061714817 9:132512135-132512157 CGCTCCCTCTGCGGGCTCTAGGG + Intronic
1062552831 9:137097956-137097978 CCCTTCCTCCCCGGGCGCTCAGG + Intronic
1062600951 9:137318358-137318380 CCCTGCCTCCGAGGGCTCCCGGG - Intronic
1062654144 9:137593572-137593594 CGCTGCCACCTCCGCCTCCCGGG + Intergenic
1062715486 9:138008108-138008130 CACTGCCCCCTCAGGCTCTCTGG - Intronic
1203468777 Un_GL000220v1:107572-107594 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1203476598 Un_GL000220v1:151544-151566 CGCCGCCTCTGCGGGCTCCCGGG + Intergenic
1185491908 X:524371-524393 CACTGCCACCTCCGCCTCTCGGG + Intergenic
1185689792 X:2144893-2144915 CGCTGCCACCTCTGCCTCCCGGG - Intergenic
1185722883 X:2396018-2396040 TGCTCCCTCCGGGGGCTCTCAGG + Intronic
1185800339 X:3004983-3005005 CGCTGCAACCTCCGCCTCTCAGG + Intergenic
1186002415 X:5027610-5027632 CGCTGCCACCTCCGCCTCCCAGG - Intergenic
1186460291 X:9743029-9743051 CGCTGCAACCTCCGCCTCTCAGG - Intronic
1186550347 X:10498177-10498199 CACTGCATCCTCGACCTCTCAGG + Intronic
1187248456 X:17575031-17575053 CGCTGCCTCCTCTTCATCTCTGG + Intronic
1187419328 X:19121764-19121786 CCCTGCTTCGTCTGGCTCTCGGG + Intronic
1187669742 X:21656835-21656857 CTCTTCTTCCTCGGGCTCTGGGG + Exonic
1187831672 X:23388753-23388775 CGCTGCAGCCTCGGCCTCCCGGG - Intronic
1187943606 X:24405626-24405648 CGCTGCAACCTCTGCCTCTCAGG + Intergenic
1188073645 X:25748595-25748617 CGCTGCAACCTCCGCCTCTCGGG - Intergenic
1188092063 X:25976658-25976680 CCCTGCCTCTTGTGGCTCTCAGG - Intergenic
1189310401 X:40013957-40013979 CGCCCCCTCCCCGGGCTCTCTGG - Intergenic
1189826219 X:44920948-44920970 CGCTGCAACCTCCGCCTCTCGGG + Intronic
1190126713 X:47712032-47712054 CACTGCCACCTCAGTCTCTCAGG + Intergenic
1190156789 X:48000058-48000080 CACTGCAACCTCCGGCTCTCAGG - Intronic
1190182824 X:48207859-48207881 CACTGCAGCCTCTGGCTCTCGGG - Intronic
1190867975 X:54400700-54400722 CGCTGCATCCTCTGCCTCCCAGG + Intergenic
1193365246 X:80623631-80623653 CCCTGCCTCATGTGGCTCTCAGG + Intergenic
1194173741 X:90621863-90621885 CACTGCCTCCTCTGCCTCCCGGG + Intergenic
1195599156 X:106726678-106726700 GGCTGCCGCGTCGGGCTCTGGGG - Exonic
1199000788 X:142633772-142633794 TGCTGCCTTCTCAGGCTCTTTGG - Intergenic
1199257585 X:145734223-145734245 CACTGCATCCTCAGCCTCTCAGG + Intergenic
1199760222 X:150899020-150899042 CGCTGCCGCCTCCCGCTCCCCGG - Intergenic
1199834987 X:151581150-151581172 CGCTGCCACCTCCGCCTCCCAGG - Intronic
1200060957 X:153483567-153483589 CCCTGCCTCCTGGCCCTCTCTGG - Intronic
1200519960 Y:4199553-4199575 CACTGCCTCCTCTGCCTCCCGGG + Intergenic
1200936731 Y:8744824-8744846 CCCTTCCTCCTGGGGCTCACAGG + Intergenic
1202143129 Y:21749948-21749970 CACTGCAACCTCTGGCTCTCAGG - Intergenic
1202143698 Y:21755867-21755889 CACTGCAACCTCTGGCTCTCAGG + Intergenic